A Comparative Analysis of Aquatic and Polyethylene-Associated Antibiotic-Resistant Microbiota in the Mediterranean Sea
Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Study Area and Sample Collection
2.2. DNA Extraction, PCR Amplification, and Sequencing
2.3. Detection of Antibiotic Resistance Genes (ARGs)
3. Results
3.1. Microbiome Sequencing Output and Analysis
3.2. Taxonomic Composition
3.3. Resistome Analysis
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Geyer, R.; Jambeck, J.R.; Law, K.L. Production, use, and fate of all plastics ever made. Sci. Adv. 2017, 3, e1700782. [Google Scholar] [CrossRef] [Scilit]
- Caracappa, S.; Persichetti, M.F.; Piazza, A.; Caracappa, G.; Gentile, A.; Marineo, S.; Crucitti, D.; Arculeo, M. Incidental catch of loggerhead sea turtles (Caretta caretta) along the Sicilian coasts by longline fishery. PeerJ 2018, 6, e5392. [Google Scholar] [CrossRef] [Scilit]
- Savoca, D.; Arculeo, M.; Barreca, S.; Buscemi, S.; Caracappa, S.; Gentile, A.; Persichetti, M.F.; Pace, A. Chasing phthalates in tissues of marine turtles from the Mediterranean sea. Mar. Pollut. Bull. 2018, 127, 165–169. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Murphy, F.; Ewins, C.; Carbonnier, F.; Quinn, B. Wastewater Treatment Works (WwTW) as a Source of Microplastics in the Aquatic Environment. Environ. Sci. Technol. 2016, 50, 5800–5808. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Barboza, L.G.A.; Vieira, L.R.; Branco, V.; Figueiredo, N.; Carvalho, F.; Carvalho, C.; Guilhermino, L. Microplastics cause neurotoxicity, oxidative damage and energy-related changes and interact with the bioaccumulation of mercury in the European seabass, Dicentrarchus labrax (Linnaeus, 1758). Aquat. Toxicol. 2018, 195, 49–57. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Yang, Y.; Liu, G.; Song, W.; Ye, C.; Lin, H.; Li, Z.; Liu, W. Plastics in the marine environment are reservoirs for antibiotic and metal resistance genes. Environ. Int. 2019, 123, 79–86. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Yang, Y.; Liu, W.; Zhang, Z.; Grossart, H.P.; Gadd, G.M. Microplastics provide new microbial niches in aquatic environments. Appl. Microbiol. Biotechnol. 2020, 104, 6501–6511. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Arias-Andres, M.; Kettner, M.T.; Miki, T.; Grossart, H.P. Microplastics: New substrates for heterotrophic activity contribute to altering organic matter cycles in aquatic ecosystems. Sci. Total Environ. 2018, 635, 1152–1159. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Arias-Andres, M. Who is where in the Plastisphere, and why does it matter? Mol. Ecol. Resour. 2020, 20, 617–619. [Google Scholar] [CrossRef] [Scilit]
- Dussud, C.; Meistertzheim, A.L.; Conan, P.; Pujo-Pay, M.; George, M.; Fabre, P.; Coudane, J.; Higgs, P.; Elineau, A.; Pedrotti, M.L.; et al. Evidence of niche partitioning among bacteria living on plastics, organic particles and surrounding seawaters. Environ. Pollut. 2018, 236, 807–816. [Google Scholar] [CrossRef] [Scilit]
- Galloway, T.S.; Cole, M.; Lewis, C. Interactions of microplastic debris throughout the marine ecosystem. Nat. Ecol. Evol. 2017, 1, 116. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Amaral-Zettler, L.A.; Zettler, E.R.; Mincer, T.J. Ecology of the plastisphere. Nat. Rev. Microbiol. 2020, 18, 139–151. [Google Scholar] [CrossRef] [Scilit]
- Zettler, E.R.; Mincer, T.J.; Amaral-Zettler, L.A. Life in the “plastisphere”: Microbial communities on plastic marine debris. Environ. Sci. Technol. 2013, 47, 7137–7146. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Drudge, C.N.; Elliott, A.V.; Plach, J.M.; Ejim, L.J.; Wright, G.D.; Droppo, I.G.; Warren, L.A. Diversity of integron- and culture-associated antibiotic resistance genes in freshwater floc. Appl. Environ. Microbiol. 2012, 78, 4367–4372. [Google Scholar] [CrossRef] [Scilit]
- Imran, M.; Das, K.R.; Naik, M.M. Co-selection of multi-antibiotic resistance in bacterial pathogens in metal and microplastic contaminated environments: An emerging health threat. Chemosphere 2019, 215, 846–857. [Google Scholar] [CrossRef] [Scilit]
- Lagana, P.; Caruso, G.; Corsi, I.; Bergami, E.; Venuti, V.; Majolino, D.; la Ferla, R.; Azzaro, M.; Cappello, S. Do plastics serve as a possible vector for the spread of antibiotic resistance? First insights from bacteria associated to a polystyrene piece from King George Island (Antarctica). Int. J. Hyg. Environ. Health 2019, 222, 89–100. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Moore, R.E.; Millar, B.C.; Moore, J.E. Antimicrobial resistance (AMR) and marine plastics: Can food packaging litter act as a dispersal mechanism for AMR in oceanic environments? Mar. Pollut. Bull. 2020, 150, 110702. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kraemer, S.A.; Ramachandran, A.; Perron, G.G. Antibiotic Pollution in the Environment: From Microbial Ecology to Public Policy. Microorganisms 2019, 7, 180. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Alduina, R. Antibiotics and Environment. Antibiotics 2020, 9, 202. [Google Scholar] [CrossRef] [Scilit]
- Alduina, R.; Gambino, D.; Presentato, A.; Gentile, A.; Sucato, A.; Savoca, D.; Filippello, S.; Visconti, G.; Caracappa, G.; Vicari, D.; et al. Is Caretta Caretta a Carrier of Antibiotic Resistance in the Mediterranean Sea? Antibiotics 2020, 9, 116. [Google Scholar] [CrossRef] [Scilit]
- Blasi, M.F.; Migliore, L.; Mattei, D.; Rotini, A.; Thaller, M.C.; Alduina, R. Antibiotic Resistance of Gram-Negative Bacteria from Wild Captured Loggerhead Sea Turtles. Antibiotics 2020, 9, 162. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Vitale, M.; Gaglio, S.; Galluzzo, P.; Cascone, G.; Piraino, C.; di Marco Lo Presti, V.; Alduina, R. Antibiotic Resistance Profiling, Analysis of Virulence Aspects and Molecular Genotyping of Staphylococcus aureus Isolated in Sicily, Italy. Foodborne Pathog. Dis. 2018, 15, 177–185. [Google Scholar] [CrossRef] [Scilit]
- Vitale, M.; Galluzzo, P.; Buffa, P.G.; Carlino, E.; Spezia, O.; Alduina, R. Comparison of Antibiotic Resistance Profile and Biofilm Production of Staphylococcus aureus Isolates Derived from Human Specimens and Animal-Derived Samples. Antibiotics 2019, 8, 97. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Gambino, D.; Persichetti, M.F.; Gentile, A.; Arculeo, M.; Visconti, G.; Curro, V.; Caracappa, G.; Crucitti, D.; Piazza, A.; Mancianti, F.; et al. First data on microflora of loggerhead sea turtle (Caretta caretta) nests from the coastlines of Sicily. Biol. Open 2020, 9, bio045252. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Pace, A.; Dipineto, L.; Fioretti, A.; Hochscheid, S. Loggerhead sea turtles as sentinels in the western Mediterranean: Antibiotic resistance and environment-related modifications of Gram-negative bacteria. Mar. Pollut. Bull. 2019, 149, 110575. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Pace, A.; Rinaldi, L.; Ianniello, D.; Borrelli, L.; Cringoli, G.; Fioretti, A.; Hochscheid, S.; Dipineto, L. Gastrointestinal investigation of parasites and Enterobacteriaceae in loggerhead sea turtles from Italian coasts. Bmc Vet. Res. 2019, 15, 370. [Google Scholar] [CrossRef] [Scilit]
- Peterson, E.; Kaur, P. Antibiotic Resistance Mechanisms in Bacteria: Relationships Between Resistance Determinants of Antibiotic Producers, Environmental Bacteria, and Clinical Pathogens. Front. Microbiol. 2018, 9, 2928. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Yoshizawa, N.; Usui, M.; Fukuda, A.; Asai, T.; Higuchi, H.; Okamoto, E.; Seki, K.; Takada, H.; Tamura, Y. Manure Compost Is a Potential Source of Tetracycline-Resistant Escherichia coli and Tetracycline Resistance Genes in Japanese Farms. Antibiotics 2020, 9, 76. [Google Scholar] [CrossRef] [Scilit]
- Ekwanzala, M.D.; Lehutso, R.F.; Kasonga, T.K.; Dewar, J.B.; Momba, M.N.B. Environmental Dissemination of Selected Antibiotics from Hospital Wastewater to the Aquatic Environment dagger. Antibiotics 2020, 9, 431. [Google Scholar] [CrossRef] [Scilit]
- Liu, Y.H.; Dyall-Smith, M.; Marenda, M.; Hu, H.W.; Browning, G.; Billman-Jacobe, H. Antibiotic Resistance Genes in Antibiotic-Free Chicken Farms. Antibiotics 2020, 9, 120. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Bondarczuk, K.; Piotrowska-Seget, Z. Microbial diversity and antibiotic resistance in a final effluent-receiving lake. Sci. Total Environ. 2019, 650, 2951–2961. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Di Cesare, A.; Eckert, E.M.; D’Urso, S.; Bertoni, R.; Gillan, D.C.; Wattiez, R.; Corno, G. Co-occurrence of integrase 1, antibiotic and heavy metal resistance genes in municipal wastewater treatment plants. Water Res. 2016, 94, 208–214. [Google Scholar] [CrossRef] [Scilit]
- Di Cesare, A.; Luna, G.M.; Vignaroli, C.; Pasquaroli, S.; Tota, S.; Paroncini, P.; Biavasco, F. Aquaculture can promote the presence and spread of antibiotic-resistant Enterococci in marine sediments. PLoS ONE 2013, 8, e62838. [Google Scholar] [CrossRef] [Scilit]
- Deng, Y.; Bao, X.; Ji, L.; Chen, L.; Liu, J.; Miao, J.; Chen, D.; Bian, H.; Li, Y.; Yu, G. Resistance integrons: Class 1, 2 and 3 integrons. Ann. Clin. Microbiol. Antimicrob. 2015, 14, 45. [Google Scholar] [CrossRef] [Scilit]
- Oberbeckmann, S.; Labrenz, M. Marine Microbial Assemblages on Microplastics: Diversity, Adaptation, and Role in Degradation. Annu. Rev. Mar. Sci. 2020, 12, 209–232. [Google Scholar] [CrossRef] [Scilit]
- Arizza, V.; Vecchioni, L.; Caracappa, S.; Sciurba, G.; Berlinghieri, F.; Gentile, A.; Persichetti, M.F.; Arculeo, M.; Alduina, R. New insights into the gut microbiome in loggerhead sea turtles Caretta caretta stranded on the Mediterranean coast. PLoS ONE 2019, 14, e0220329. [Google Scholar] [CrossRef] [Scilit]
- Takahashi, S.; Tomita, J.; Nishioka, K.; Hisada, T.; Nishijima, M. Development of a prokaryotic universal primer for simultaneous analysis of Bacteria and Archaea using next-generation sequencing. PLoS ONE 2014, 9, e105592. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Bolyen, E.; Rideout, J.R.; Dillon, M.R.; Bokulich, N.; Abnet, C.C.; Al-Ghalith, G.A.; Alexander, H.; Alm, E.J.; Arumugam, M.; Asnicar, F.; et al. Reproducible, interactive, scalable and extensible microbiome data science using QIIME 2. Nat. Biotechnol. 2019, 37, 852–857. [Google Scholar] [CrossRef] [Scilit]
- Pruesse, E.; Peplies, J.; Glockner, F.O. SINA: Accurate high-throughput multiple sequence alignment of ribosomal RNA genes. Bioinformatics 2012, 28, 1823–1829. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Clarke, K.R.; Gorley, R.N. PRIMER v6: User Manual/Tutorial (Plymouth Routines in Multivariate Ecological Research); Primer-E Plymouth: Auckland, New Zealand, 2006. [Google Scholar]
- Ng, L.K.; Martin, I.; Alfa, M.; Mulvey, M. Multiplex PCR for the detection of tetracycline resistant genes. Mol. Cell. Probes 2001, 15, 209–215. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Bibbal, D.; Dupouy, V.; Ferre, J.P.; Toutain, P.L.; Fayet, O.; Prere, M.F.; Bousquet-Melou, A. Impact of three ampicillin dosage regimens on selection of ampicillin resistance in Enterobacteriaceae and excretion of blaTEM genes in swine feces. Appl. Environ. Microbiol. 2007, 73, 4785–4790. [Google Scholar] [CrossRef] [Scilit]
- Marti, E.; Jofre, J.; Balcazar, J.L. Prevalence of antibiotic resistance genes and bacterial community composition in a river influenced by a wastewater treatment plant. PLoS ONE 2013, 8, e78906. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Marti, E.; Balcazar, J.L. Real-Time PCR assays for quantification of qnr genes in environmental water samples and chicken feces. Appl. Environ. Microbiol. 2013, 79, 1743–1745. [Google Scholar] [CrossRef] [Scilit]
- Pei, R.; Kim, S.C.; Carlson, K.H.; Pruden, A. Effect of river landscape on the sediment concentrations of antibiotics and corresponding antibiotic resistance genes (ARG). Water Res. 2006, 40, 2427–2435. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zambri, M.; Cloutier, M.; Adam, Z.; Lapen, D.R.; Wilkes, G.; Sunohara, M.; Topp, E.; Talbot, G.; Khan, I.U.H. Novel virulence, antibiotic resistance and toxin gene-specific PCR-based assays for rapid pathogenicity assessment of Arcobacter faecis and Arcobacter lanthieri. BMC Microbiol. 2019, 19, 11. [Google Scholar] [CrossRef] [Scilit]
- Luo, Y.; Mao, D.; Rysz, M.; Zhou, Q.; Zhang, H.; Xu, L.; Alvarez, J.J.P. Trends in antibiotic resistance genes occurrence in the Haihe River, China. Environ. Sci. Technol. 2010, 44, 7220–7225. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Tu, C.; Chen, T.; Zhou, Q.; Liu, Y.; Wei, J.; Waniek, J.J.; Luo, Y. Biofilm formation and its influences on the properties of microplastics as affected by exposure time and depth in the seawater. Sci. Total Environ. 2020, 734, 139237. [Google Scholar] [CrossRef] [Scilit]
- Zothanpuia; Passari, A.K.; Leo, V.V.; Singh, B.P. Freshwater Actinobacteria. In New and Future Developments in Microbial Biotechnology and Bioengineering. Actinobacteria: Diversity and Biotechnological Applications; Elsevier: Amsterdam, The Netherlands, 2018; pp. 67–77. [Google Scholar] [CrossRef] [Scilit]
- Herrmann, M.; Wegner, C.E.; Taubert, M.; Geesink, P.; Lehmann, K.; Yan, L.; Lehmann, R.; Totsche, K.U.; Kusel, K. Predominance of Cand. Patescibacteria in Groundwater Is Caused by Their Preferential Mobilization From Soils and Flourishing Under Oligotrophic Conditions. Front. Microbiol. 2019, 10, 1407. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Collingro, A.; Kostlbacher, S.; Horn, M. Chlamydiae in the Environment. Trends Microbiol. 2020, 28, 877–888. [Google Scholar] [CrossRef] [Scilit]
- Graham, E.D.; Tully, B.J. Marine Dadabacteria Exhibit Genome Streamlining and Phototrophy-Driven Niche Partitioning. ISME J 2020. [Google Scholar] [CrossRef] [Scilit]
- Momper, L.; Aronson, H.S.; Amend, J.P. Genomic Description of “Candidatus Abyssubacteria”, a Novel Subsurface Lineage Within the Candidate Phylum Hydrogenedentes. Front. Microbiol. 2018, 9, 1993. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Bougouffa, S.; Yang, J.K.; Lee, O.O.; Wang, Y.; Batang, Z.; Al-Suwailem, A.; Qian, P.Y. Distinctive microbial community structure in highly stratified deep-sea brine water columns. Appl. Environ. Microbiol. 2013, 79, 3425–3437. [Google Scholar] [CrossRef] [Scilit]
- Kirchman, D.L.; Yu, L.; Cottrell, M.T. Diversity and abundance of uncultured cytophaga-like bacteria in the Delaware estuary. Appl. Environ. Microbiol. 2003, 69, 6587–6596. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Elifantz, H.; Horn, G.; Ayon, M.; Cohen, Y.; Minz, D. Rhodobacteraceae are the key members of the microbial community of the initial biofilm formed in Eastern Mediterranean coastal seawater. Fems Microbiol. Ecol. 2013, 85, 348–357. [Google Scholar] [CrossRef] [Scilit]
- Baker, A.; Mayo, M.; Owens, L.; Burgess, G.; Norton, R.; McBride, W.J.; Currie, B.J.; Warner, J. Biogeography of Burkholderia pseudomallei in the Torres Strait Islands of Northern Australia. J. Clin. Microbiol. 2013, 51, 2520–2525. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Alves, M.S.; Pereira, A.; Araujo, S.M.; Castro, B.B.; Correia, A.C.; Henriques, I. Seawater is a reservoir of multi-resistant Escherichia coli, including strains hosting plasmid-mediated quinolones resistance and extended-spectrum beta-lactamases genes. Front. Microbiol. 2014, 5, 426. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Hong, B.; Ba, Y.; Niu, L.; Lou, F.; Zhang, Z.; Liu, H.; Pan, Y.; Zhao, Y. A Comprehensive Research on Antibiotic Resistance Genes in Microbiota of Aquatic Animals. Front. Microbiol. 2018, 9, 1617. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Stoll, C.; Sidhu, J.P.; Tiehm, A.; Toze, S. Prevalence of clinically relevant antibiotic resistance genes in surface water samples collected from Germany and Australia. Environ. Sci. Technol. 2012, 46, 9716–9726. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Jiang, H.; Zhou, R.; Yang, Y.; Chen, B.; Cheng, Z.; Zhang, M.; Li, J.; Zhang, G.; Zou, S. Characterizing the antibiotic resistance genes in a river catchment: Influence of anthropogenic activities. J. Environ. Sci. 2018, 69, 125–132. [Google Scholar] [CrossRef] [Scilit]
- Gillings, M.R.; Gaze, W.H.; Pruden, A.; Smalla, K.; Tiedje, J.M.; Zhu, Y. Using the class 1 integron-integrase gene as a proxy for anthropogenic pollution. ISME J. 2015, 9, 1269–1279. [Google Scholar] [CrossRef] [Scilit]
- Zhou, L.J.; Ying, G.G.; Liu, S.; Zhang, R.Q.; Lai, H.J.; Chen, Z.F.; Pan, C.G. Excretion masses and environmental occurrence of antibiotics in typical swine and dairy cattle farms in China. Sci. Total Environ. 2013, 444, 183–195. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Han, Y.; Wang, J.; Zhao, Z.; Chen, J.; Lu, H.; Liu, G. Fishmeal Application Induces Antibiotic Resistance Gene Propagation in Mariculture Sediment. Environ. Sci. Technol. 2017, 51, 10850–10860. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Smaldone, G.; Marrone, R.; Cappiello, S.; Martin, G.A.; Oliva, G.; Cortesi, M.L.; Anastasio, A. Occurrence of antibiotic resistance in bacteria isolated from seawater organisms caught in Campania Region: Preliminary study. BMC Vet. Res. 2014, 10, 161. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Thomas, S.G.; Glover, M.A.; Parthasarathy, A.; Wong, N.H.; Shipman, P.A.; Hudson, A.O. Expression of a Shiga-Like Toxin during Plastic Colonization by Two Multidrug-Resistant Bacteria, Aeromonas hydrophila RIT668 and Citrobacter freundii RIT669, Isolated from Endangered Turtles (Clemmys guttata). Microorganisms 2020, 8, 1172. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Caracappa, S.; Pisciotta, A.; Persichetti, M.F.; Caracappa, G.; Alduina, R.; Arculeo, M. Nonmodal scutes patterns in the Loggerhead Sea Turtle (Caretta caretta): A possible epigenetic effect? Can. J. Zool. 2016, 94, 379–383. [Google Scholar] [CrossRef] [Scilit]
- Smith, M.; Love, D.C.; Rochman, C.M.; Neff, R.A. Microplastics in Seafood and the Implications for Human Health. Curr. Environ. Health Rep. 2018, 5, 375–386. [Google Scholar] [CrossRef] [Scilit] [PubMed]




| Target Name | Primer Sequence (5′-3′) | Amplicon Size (bp) | Annealing Temperature (°C) | Reference |
|---|---|---|---|---|
| 16S rDNA for V3-V4 sequencing | cctacgggnbgcascag | 464 | 55 | [37] |
| gactacnvgggtatctaatcc | ||||
| 16S rDNA | cggtgaatacgttcycgg | 142 | 55 | [32] |
| gghtaccttgttacgactt | ||||
| tetA | gctacatcctgcttgccttc | 210 | 64 | [41] |
| catagatcgccgtgaagagg | ||||
| blaTEM | ttcctgtttttgctcacccag | 112 | 60 | [42] |
| ctcaaggatcttaccgctgttg | ||||
| blaCTXM | ctatggcaccaccaacgata | 103 | 60 | [43] |
| acggctttctgccttaggtt | ||||
| qnrS | gacgtgctaacttgcgtgat | 118 | 62 | [44] |
| tggcattgttggaaacttg | ||||
| sulII | tccggtggaggccggtatctgg | 191 | 60 | [45] |
| cgggaatgccatctgccttgag | ||||
| ermB | ccgaacactagggttgctc | 139 | 55 | [33] |
| atctggaacatctgtggtatg | ||||
| tetW | acatcattgatactccaggtcacg | 120 | 56 | [46] |
| tttcactttgtggttgaacccctc | ||||
| int1 | ggcttcgtgatgcctgctt | 148 | 59 | [47] |
| cattcctggccgtggttct |
| Tag * | Total Reads | Merged Reads | Filtered Reads | Chimeras | OTUs |
|---|---|---|---|---|---|
| SP1 | 26,675 | 16,644 | 18,340 | 270 | 592 |
| SP2 | 111,375 | 80,453 | 67,895 | 6599 | 410 |
| SP3 | 47,278 | 23,472 | 37,537 | 1212 | 659 |
| SW1 | 85,593 | 52,885 | 60,866 | 8000 | 211 |
| SW2 | 80,494 | 55,120 | 60,922 | 6563 | 213 |
| SW3 | 73,051 | 45,744 | 53,042 | 8863 | 204 |
| SW4 | 6414 | 4040 | 4471 | 127 | 165 |
| FP1 | 8556 | 5250 | 5401 | 18 | 144 |
| FP2 | 51,174 | 26,681 | 40,353 | 5480 | 331 |
| FP3 | 43,526 | 25,192 | 34,954 | 5000 | 293 |
| FW1 | 47,811 | 29,800 | 34,770 | 2281 | 204 |
| FW2 | 69,353 | 40,831 | 47,251 | 4153 | 234 |
| FW3 | 7387 | 142 | 444 | 0 | 14 |
| Sample | Mean ± Std.Dev | C.v. OTUs |
|---|---|---|
| Seawater (SW1-SW4) | 198 ± 22.5 | 11.3 |
| Freshwater (FW1-FW2) | 219 ± 21.2 | 9.7 |
| Seawater PE (SP1-SP3) | 554 ± 128.9 | 23.3 |
| Freshwater PE (FP1-FP3) | 256 ± 99 | 79.2 |
| Sample | S | Good’s Coverage | Chao1 | ACE | α | 1-D | H’ | e |
|---|---|---|---|---|---|---|---|---|
| SP1 | 146 | 0.96 | 285.32 | 281.79 | 4.05 | 0.05 | 4.04 | 0.81 |
| SP2 | 53 | 0.99 | 288.36 | 286.13 | 7.71 | 0.1 | 2.88 | 0.72 |
| SP3 | 119 | 0.97 | 202.39 | 205.51 | 5.53 | 0.07 | 3.46 | 0.72 |
| SW1 | 64 | 0.99 | 264.68 | 260.92 | 3.29 | 0.03 | 3.68 | 0.88 |
| SW2 | 64 | 0.99 | 274.20 | 269.82 | 3.25 | 0.04 | 3.59 | 0.86 |
| SW3 | 67 | 0.99 | 276.49 | 274.66 | 3 | 0.02 | 3.76 | 0.89 |
| SW4 | 75 | 0.96 | 288.09 | 284.83 | 2.20 | 0.04 | 3.81 | 0.88 |
| FP1 | 53 | 0.97 | 280.71 | 278.42 | 2.71 | 0.04 | 3.49 | 0.88 |
| FP2 | 81 | 0.99 | 180.05 | 189.58 | 4.08 | 0.06 | 3.49 | 0.79 |
| FP3 | 70 | 0.99 | 227.11 | 227.53 | 4.18 | 0.07 | 3.28 | 0.77 |
| FW1 | 69 | 0.99 | 237.77 | 236.87 | 2.96 | 0.04 | 3.63 | 0.85 |
| FW2 | 71 | 0.99 | 251.34 | 248.52 | 3.28 | 0.06 | 3.49 | 0.82 |
| FW3 | 13 | 0.90 | 129.16 | 137.30 | 1.07 | 0.02 | 2.41 | 0.95 |
| Source | DF | Adj SS | Adj MS | F-Value | p-Value |
|---|---|---|---|---|---|
| Sample | 3 | 303,233 | 101,078 | 11.00 | 0.002 |
| Error | 9 | 82,728 | 9192 | ||
| Total | 12 | 385,961 |
| Sample | blaTEM | blaCTXM | ermB | qnrS | sulII | tetA | tetW | int1 |
|---|---|---|---|---|---|---|---|---|
| Seawater (SW1-SW4) | + | − | − | − | − | − | − | + |
| Freshwater (FW1-FW3) | + | − | − | − | − | − | − | + |
| Seawater PE (SP1-SP3) | + | + | + | + | + | + | − | + |
| Freshwater PE (FP1-FP3) | + | − | + | + | + | + | + | + |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Sucato, A.; Vecchioni, L.; Savoca, D.; Presentato, A.; Arculeo, M.; Alduina, R. A Comparative Analysis of Aquatic and Polyethylene-Associated Antibiotic-Resistant Microbiota in the Mediterranean Sea. Biology 2021, 10, 200. https://doi.org/10.3390/biology10030200
Sucato A, Vecchioni L, Savoca D, Presentato A, Arculeo M, Alduina R. A Comparative Analysis of Aquatic and Polyethylene-Associated Antibiotic-Resistant Microbiota in the Mediterranean Sea. Biology. 2021; 10(3):200. https://doi.org/10.3390/biology10030200
Chicago/Turabian StyleSucato, Arianna, Luca Vecchioni, Dario Savoca, Alessandro Presentato, Marco Arculeo, and Rosa Alduina. 2021. "A Comparative Analysis of Aquatic and Polyethylene-Associated Antibiotic-Resistant Microbiota in the Mediterranean Sea" Biology 10, no. 3: 200. https://doi.org/10.3390/biology10030200
APA StyleSucato, A., Vecchioni, L., Savoca, D., Presentato, A., Arculeo, M., & Alduina, R. (2021). A Comparative Analysis of Aquatic and Polyethylene-Associated Antibiotic-Resistant Microbiota in the Mediterranean Sea. Biology, 10(3), 200. https://doi.org/10.3390/biology10030200

