Inflammatory Response Modulation by Vitamin C in an MPTP Mouse Model of Parkinson’s Disease
Abstract
:Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Animals and Treatment Protocols
2.2. Immunohistochemistry
2.3. Open Field Test
2.4. Automated Treadmill Gait Test
2.5. Immunoblotting
2.6. Real-Time PCR
2.7. Statistical Analysis
3. Results
3.1. Effects of Vit C on TH Expression
3.2. Effects of Vit C on GFAP Expression
3.3. Effects of Vit C on Microglia
3.4. Exploratory Activity
3.5. Gait Dynamic Analysis
3.6. Effects of Vit C on the Expression of Pro- and Anti-Inflammatory Markers in MPTP-Treated Mice
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Padayatty, S.J.; Katz, A.; Wang, Y.; Eck, P.; Kwon, O.; Lee, J.-H.; Chen, S.; Corpe, C.; Dutta, A.; Dutta, S.K.; et al. Vitamin C as an antioxidant: Evaluation of its role in disease prevention. J. Am. Coll. Nutr. 2003, 22, 18–35. [Google Scholar] [CrossRef]
- Carr, A.C.; Rosengrave, P.C.; Bayer, S.; Chambers, S.; Mehrtens, J.; Shaw, G.M. Hypovitaminosis C and vitamin C deficiency in critically ill patients despite recommended enteral and parenteral intakes. Crit. Care 2017, 21, 300. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Drouin, G.; Godin, J.R.; Pagé, B. The genetics of vitamin C loss in vertebrates. Curr. Genom. 2011, 12, 371–378. [Google Scholar] [CrossRef]
- Daruwala, R.; Song, J.; Koh, W.S.; Rumsey, S.C.; Levine, M. Cloning and functional characterization of the human sodium-dependent vitamin C transporters HSVCT1 and HSVCT2. FEBS Lett. 1999, 460, 480–484. [Google Scholar] [CrossRef] [Green Version]
- Tsukaguchi, H.; Tokui, T.; Mackenzie, B.; Berger, U.V.; Chen, X.Z.; Wang, Y.; Brubaker, R.F.; Hediger, M.A. A family of mammalian Na+-dependent L-ascorbic acid transporters. Nature 1999, 399, 70–75. [Google Scholar] [CrossRef]
- Bürzle, M.; Hediger, M.A. Functional and Physiological Role of Vitamin C Transporter. In Current Topics in Membranes; Elsevier: Amsterdam, The Netherlands, 2012; Volume 70, pp. 357–375. ISBN 978-0-12-394316-3. [Google Scholar]
- Levine, M.; Padayatty, S.J.; Espey, M.G. Vitamin C: A concentration-function approach yields pharmacology and therapeutic discoveries. Adv. Nutr. 2011, 2, 78–88. [Google Scholar] [CrossRef] [Green Version]
- Lam, D.K.; Daniel, P.M. The influx of ascorbic acid into the rat’s brain. Q. J. Exp. Physiol. 1986, 71, 483–489. [Google Scholar] [CrossRef] [Green Version]
- Garcia, M.D.L.A.; Salazar, K.; Millan, C.; Rodriguez, F.; Montecinos, H.; Caprile, T.; Silva, C.; Cortes, C.; Reinicke, K.; Vera, J.C.; et al. Sodium vitamin C cotransporter SVCT2 is expressed in hypothalamic glial cells. Glia 2005, 50, 32–47. [Google Scholar] [CrossRef]
- Alle, H.; Roth, A.; Geiger, J.R. Energy-efficient action potentials in hippocampal mossy fibers. Science 2009, 325, 1405–1408. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Wilson, J.X. Antioxidant defense of the brain: A role for astrocytes. Can. J. Physiol. Pharmacol. 1997, 75, 1149–1163. [Google Scholar] [CrossRef]
- Halliwell, B. Oxidative stress and neurodegeneration: Where are we now? J. Neurochem. 2006, 97, 1634–1658. [Google Scholar] [CrossRef] [PubMed]
- Nualart, F.; Mack, L.; Garcia, A.; Cisternas, P.; Bongarzone, E.R.; Heitzer, M.; Jara, N.; Martinez, F.; Ferrada, L.; Espinoza, F.; et al. Vitamin C transporters, recycling and the bystander effect in the nervous system: SVCT2 versus gluts. J. Stem Cell Res. Ther. 2014, 4, 209. [Google Scholar] [CrossRef] [Green Version]
- Marik, P.E. Vitamin C for the treatment of sepsis: The scientific rationale. Pharmacol. Ther. 2018, 189, 63–70. [Google Scholar] [CrossRef] [PubMed]
- Yuan, H.; Zhang, Z.W.; Liang, L.W.; Shen, Q.; Wang, X.D.; Ren, S.M. Treatment strategies for Parkinson’s disease. Neurosci. Bull. 2010, 26, 66. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Panaro, M.A.; Cianciulli, A. Current opinions and perspectives on the role of immune system in the pathogenesis of Parkinson’s disease. Curr. Pharm. Des. 2012, 18, 200–208. [Google Scholar] [CrossRef]
- Dias, V.; Junn, E.; Mouradian, M.M. The role of oxidative stress in Parkinson’s disease. J. Parkinsons Dis. 2013, 3, 461–491. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Panaro, M.A.; Aloisi, A.; Nicolardi, G.; Lofrumento, D.D.; De Nuccio, F.; La Pesa, V.; Cianciulli, A.; Rinaldi, R.; Calvello, R. Radio Electric Asymmetric Conveyer Technology Modulates Neuroinflammation in a Mouse Model of Neurodegeneration. Neurosci. Bull. 2018, 34, 270–282. [Google Scholar] [CrossRef] [PubMed]
- Jackson-Lewis, V.; Przedborski, S. Protocol for the MPTP mouse model of Parkinson’s disease. Nat. Protoc. 2007, 2, 141–151. [Google Scholar] [CrossRef]
- Calvello, R.; Cianciulli, A.; Porro, C.; Moda, P.; De Nuccio, F.; Nicolardi, G.; Giannotti, L.; Panaro, M.A.; Lofrumento, D.D. Formyl Peptide Receptor (FPR)1 Modulation by Resveratrol in an LPS-InducedNeuroinflammatory Animal Model. Nutrients 2021, 13, 1418. [Google Scholar] [CrossRef]
- Amende, I.; Kale, A.; McCue, S.; Glazier, S.; Morgan, J.P.; Hampton, T.G. Gait dynamics in mouse models of Parkinson’s disease and Huntington’s disease. J. Neuroeng. Rehabil. 2005, 2, 20. [Google Scholar] [CrossRef] [Green Version]
- Akula, S.K.; McCullough, K.B.; Weichselbaum, C.; Dougherty, J.D.; Maloney, S.E. The trajectory of gait development in mice. Brain Behav. 2020, 10, e01636. [Google Scholar] [CrossRef] [Green Version]
- Massano, J.; Bhatia, K.P. Clinical approach to Parkinson’s disease: Features, diagnosis, and principles of management. Cold Spring Harb. Perspect. Med. 2012, 2, a008870. [Google Scholar] [CrossRef]
- Indrieri, A.; Pizzarelli, R.; Franco, B.; De Leonibus, E. Dopamine, Alpha-Synuclein, and Mitochondrial Dysfunctions in Parkinsonian Eyes. Front. Neurosci. 2020, 14, 567129. [Google Scholar] [CrossRef]
- Badanjak, K.; Fixemer, S.; Smajić, S.; Skupin, A.; Grünewald, A. The Contribution of Microglia to Neuroinflammation in Parkinson’s Disease. Int. J. Mol. Sci. 2021, 22, 4676. [Google Scholar] [CrossRef] [PubMed]
- Lee, S.Y.H.; Yates, N.J.; Tye, S.J. Inflammatory Mechanisms in Parkinson’s Disease: From Pathogenesis to Targeted Therapies. Neuroscientist 2021, 1073858421992265, In Press. [Google Scholar] [CrossRef]
- Joers, V.; Tansey, M.G.; Mulas, G.; Carta, A.R. Microglial phenotypes in Parkinson’s disease and animal models of the disease. Prog. Neurobiol. 2017, 155, 57–75. [Google Scholar] [CrossRef] [PubMed]
- Chen, L.; Xue, L.; Zheng, J.; Tian, X.; Zhang, Y.; Tong, Q. PPARß/δ agonist alleviates NLRP3 inflammasome-mediated neuroinflammation in the MPTP mouse model of Parkinson’s disease. Behav. Brain Res. 2019, 356, 483–489. [Google Scholar] [CrossRef] [PubMed]
- Koprich, J.B.; Reske-Nielsen, C.; Mithal, P.; Isacson, O. Neuroinflammation mediated by IL-1beta increases susceptibility of dopamine neurons to degeneration in an animal model of Parkinson’s disease. J. Neuroinflamm. 2008, 5, 8. [Google Scholar] [CrossRef] [Green Version]
- Zhou, K.; Shi, L.; Wang, Y.; Chen, S.; Zhang, J. Recent Advances of the NLRP3 Inflammasome in Central Nervous System Disorders. J. Immunol. Res. 2016, 2016, 9238290. [Google Scholar] [CrossRef]
- Bu, X.L.; Wang, X.; Xiang, Y.; Shen, L.L.; Wang, Q.H.; Liu, Y.H.; Jiao, S.S.; Wang, Y.R. The association between infectious burden and Parkinson’s disease: A case-control study. Parkinsonism Relat. Disord. 2015, 21, 877–881. [Google Scholar] [CrossRef]
- Heneka, M.T.; Kummer, M.P.; Stutz, A.; Delekate, A.; Schwartz, S.; Vieira-Saecker, A.; Griep, A.; Axt, D.; Remus, A. NLRP3 is activated in Alzheimer’s disease and contributes to pathology in APP/PS1 mice. Nature 2013, 493, 674–678. [Google Scholar] [CrossRef]
- He, C.L.; Zhao, Y.; Jiang, X.L.; Liang, X.X.; Yin, L.Z.; Yin, Z.Q.; Geng, Y.; Zhong, Z.J.; Song, X.; Zou, Y.F.; et al. Protective effect of Ketone musk on LPS/ATP-induced pyroptosis in J774A.1 cells through suppressing NLRP3/GSDMD pathway. Int. Immunopharmacol. 2019, 71, 328–335. [Google Scholar] [CrossRef]
- Roger, T.; David, J.; Glauser, M.P.; Calandra, T. MIF regulates innate immune responses through modulation of Toll-like receptor 4. Nature 2001, 414, 920–924. [Google Scholar] [CrossRef]
- De Nardo, D.; Latz, E. NLRP3 inflammasomes link inflammation and metabolic disease. Trends Immunol. 2011, 32, 373–379. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Marconi, G.D.; Fonticoli, L.; Guarnieri, S.; Cavalcanti, M.F.X.B.; Franchi, S.; Gatta, V.; Trubiani, O.; Pizzicannella, J.; Diomede, F. Ascorbic Acid: A New Player of Epigenetic Regulation in LPS-gingivalis Treated Human Periodontal Ligament Stem Cells. Oxid. Med. Cell. Longev. 2021, 2021, 6679708. [Google Scholar] [CrossRef] [PubMed]
- Pizzicannella, J.; Fonticoli, L.; Guarnieri, S.; Marconi, G.D.; Rajan, T.S.; Trubiani, O.; Diomede, F. Antioxidant Ascorbic Acid Modulates NLRP3 Inflammasome in LPS-G Treated Oral Stem Cells through NFκB/Caspase-1/IL-1β Pathway. Antioxidants 2021, 10, 797. [Google Scholar] [CrossRef]
- Li, T.; Li, F.; Liu, X.Y.; Liu, J.H.; Li, D.P. Synergistic anti-inflammatory effects of quercetin and catechin via inhibiting activation of TLR4-MyD88-mediated NF-kappa B and MAPK signaling pathways. Phytother. Res. 2019, 33, 756–767. [Google Scholar] [CrossRef]
- Ji, J.; Xiang, P.; Li, T.; Lan, L.; Xu, X.; Lu, G.; Ji, H.; Zhang, Y.; Li, Y. NOSH-NBP, a Novel Nitric Oxide and Hydrogen Sulfide-Releasing Hybrid, Attenuates Ischemic Stroke-Induced Neuroinflammatory Injury by Modulating Microglia Polarization. Front. Cell Neurosci. 2017, 11, 154. [Google Scholar] [CrossRef] [Green Version]
- Hu, X.; Li, P.; Guo, Y.; Wang, H.; Leak, R.K.; Chen, S.; Gao, Y.; Chen, J. Microglia/macrophage polarization dynamics reveal novel mechanism of injury expansion after focal cerebral ischemia. Stroke 2012, 43, 3063–3070. [Google Scholar] [CrossRef] [Green Version]
- Shao, X.; Lu, W.; Gao, F.; Li, D.; Hu, J.; Li, Y.; Zuo, Z.; Jie, H.; Zhao, Y.; Cen, X. Uric Acid Induces Cognitive Dysfunction through Hippocampal Inflammation in Rodents and Humans. J. Neurosci. 2016, 36, 10990–11005. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Girard, S.; Brough, D.; Lopez-Castejon, G.; Giles, J.; Rothwell, N.J.; Allan, S.M. Microglia and macrophages differentially modulate cell death after brain injury caused by oxygen-glucose deprivation in organotypic brain slices. Glia 2013, 61, 813–824. [Google Scholar] [CrossRef] [Green Version]
- Yang, F.; Wang, Z.; Wei, X.; Han, H.; Meng, X.; Zhang, Y.; Shi, W.; Li, F.; Xin, T.; Pang, Q.; et al. NLRP3 deficiency ameliorates neurovascular damage in experimental ischemic stroke. J. Cereb. Blood Flow Metab. 2014, 34, 660–667. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Bauernfeind, F.G.; Horvath, G.; Stutz, A.; Alnemri, E.S.; MacDonald, K.; Speert, D.; Fernandes-Alnemri, T.; Wu, J.; Monks, B.G. Cutting edge: NF-kappaB activating pattern recognition and cytokine receptors license NLRP3 inflammasome activation by regulating NLRP3 expression. J. Immunol. 2009, 183, 787–791. [Google Scholar] [CrossRef] [PubMed]
- Kohutnicka, M.; Lewandowska, E.; Kurkowska-Jastrzebska, I.; Czlonkowski, A.; Czlonkowska, A. Microglial and astrocytic involvement in a murine model of Parkinson’s disease induced by 1-methyl-4-phenyl-1,2,3,6-tetrahydropyridine (MPTP). Immunopharmacology 1998, 39, 167–180. [Google Scholar] [CrossRef]
- Yan, Y.; Jiang, W.; Liu, L.; Wang, X.; Ding, C.; Tian, Z.; Zhou, R. Dopamine controls systemic inflammation through inhibition of NLRP3 inflammasome. Cell 2015, 160, 62–73. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Fan, Z.; Liang, Z.; Yang, H.; Pan, Y.; Zheng, Y.; Wang, X. Tenuigenin protects dopaminergic neurons from inflammation via suppressing NLRP3 inflammasome activation in microglia. J. Neuroinflamm. 2017, 14, 256. [Google Scholar] [CrossRef]










| cDNA Target | Sequence (5′-->3′) | Sequencereferences |
|---|---|---|
| TH | FW: TACTTTGTGCGCTTCGAGGT RW: CGTGGCGTATACCTCCTTCC | NM_009377.2 |
| GFAP | FW: CACCTACAGGAAATTGCTGGAGG RW: CCACGATGTTCCTCTTGAGGTG | XM_030245571.2 |
| IBA1 | FW: TCTGCCGTCCAAACTTGAAGCC RW: CTCTTCAGCTCTAGGTGGGTCT | XM_006523503.5 |
| TLR4 | FW: TGCTTGGCGAATGTTTCTGC RW: TCTGTTCCTTGACCCACTGC | NM_021297.3 |
| TNF-α | FW: GGCAGGTCTACTTTGGAGTCATTGC RW: ACATTCGAGGCTCCAGTGAATTCGG | NM_013693.2 |
| IL-6 | FW: CTGGTGACAACCACGGCCTTCCCTA RW: ATGCTTAGGCATAACGCACTAGGTT | DQ_788722.1 |
| iNOS | FW: CACCTTGGAGTTCACCCAGT RW: ACCACTCGTACTTGGGATGC | NM_010927.4 |
| IL-10 | FW: TAACTGCACCCACTTCCCAG RW: AGGCTTGGCAACCCAAGTAA | NM_010548.2 |
| IL-4 | FW: ATCATCGGCATTTTGAACGAGGTC RW: ACCTTGGAAGCCCTACAGACGA | NM_021283.2 |
| CD40 | FW: TTGTTGACAGCGGTCCATCT RW: CTTGCTGGTGCAGTGTTGTC | XM_006499154.4 |
| TGF-β | FW: TGATACGCCTGAGTGGCTGTCT RW: CACAAGAGCAGTGAGCGCTGAA | AJ009862.1 |
| CD163 | FW: GGCTAGACGAAGTCATCTGCAC RW: CTTCGTTGGTCAGCCTCAGAGA | XM_006506800.5 |
| GAPDH | FW: ACCACAGTCCATGCCATCAC RW: TCCACCACCCTGTTGCTGTA | BC_085315.1 |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
De Nuccio, F.; Cianciulli, A.; Porro, C.; Kashyrina, M.; Ruggiero, M.; Calvello, R.; Miraglia, A.; Nicolardi, G.; Lofrumento, D.D.; Panaro, M.A. Inflammatory Response Modulation by Vitamin C in an MPTP Mouse Model of Parkinson’s Disease. Biology 2021, 10, 1155. https://doi.org/10.3390/biology10111155
De Nuccio F, Cianciulli A, Porro C, Kashyrina M, Ruggiero M, Calvello R, Miraglia A, Nicolardi G, Lofrumento DD, Panaro MA. Inflammatory Response Modulation by Vitamin C in an MPTP Mouse Model of Parkinson’s Disease. Biology. 2021; 10(11):1155. https://doi.org/10.3390/biology10111155
Chicago/Turabian StyleDe Nuccio, Francesco, Antonia Cianciulli, Chiara Porro, Marianna Kashyrina, Melania Ruggiero, Rosa Calvello, Alessandro Miraglia, Giuseppe Nicolardi, Dario Domenico Lofrumento, and Maria Antonietta Panaro. 2021. "Inflammatory Response Modulation by Vitamin C in an MPTP Mouse Model of Parkinson’s Disease" Biology 10, no. 11: 1155. https://doi.org/10.3390/biology10111155
APA StyleDe Nuccio, F., Cianciulli, A., Porro, C., Kashyrina, M., Ruggiero, M., Calvello, R., Miraglia, A., Nicolardi, G., Lofrumento, D. D., & Panaro, M. A. (2021). Inflammatory Response Modulation by Vitamin C in an MPTP Mouse Model of Parkinson’s Disease. Biology, 10(11), 1155. https://doi.org/10.3390/biology10111155

