Next Article in Journal
Use of Local Antibiogram Data and Antimicrobial Importance Ratings to Select Optimal Empirical Therapies for Urinary Tract Infections in Dogs and Cats
Next Article in Special Issue
Effect of Adding the Antimicrobial L-Carnitine to Growing Rabbits’ Drinking Water on Growth Efficiency, Hematological, Biochemical, and Carcass Aspects
Previous Article in Journal
Gram-Negative Bloodstream Infection: Implications of Antimicrobial Resistance on Clinical Outcomes and Therapy
Previous Article in Special Issue
Antimicrobial Secretions of Toads (Anura, Bufonidae): Bioactive Extracts and Isolated Compounds against Human Pathogens
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Antibacterial Activity of Volatile Organic Compounds Produced by the Octocoral-Associated Bacteria Bacillus sp. BO53 and Pseudoalteromonas sp. GA327

by
Anette Garrido
1,†,
Librada A. Atencio
1,†,
Rita Bethancourt
2,
Ariadna Bethancourt
2,
Héctor Guzmán
3,
Marcelino Gutiérrez
1,* and
Armando A. Durant-Archibold
1,4,*
1
Center for Biodiversity and Drug Discovery, Instituto de Investigaciones Científicas y Servicios de Alta Tecnología (INDICASAT AIP), Panama City 0843-01103, Panama
2
Department of Microbiology and Parasitology, College of Natural, Exact Sciences, and Technology, Universidad de Panama, Panama City 0824-03366, Panama
3
Smithsonian Tropical Research Institute, Panama City 0843-03092, Panama
4
Department of Biochemistry, College of Natural, Exact Sciences, and Technology, University of Panama, Panama City 0824-03366, Panama
*
Authors to whom correspondence should be addressed.
These authors contributed equally to this work.
Antibiotics 2020, 9(12), 923; https://doi.org/10.3390/antibiotics9120923
Submission received: 29 October 2020 / Revised: 10 December 2020 / Accepted: 16 December 2020 / Published: 18 December 2020
(This article belongs to the Special Issue Natural Compounds as Antimicrobial Agents, 2nd Edition)

Abstract

The present research aimed to evaluate the antibacterial activity of volatile organic compounds (VOCs) produced by octocoral-associated bacteria Bacillus sp. BO53 and Pseudoalteromonas sp. GA327. The volatilome bioactivity of both bacteria species was evaluated against human pathogenic antibiotic-resistant bacteria, methicillin-resistant Staphylococcus aureus, Acinetobacter baumanni, and Pseudomonas aeruginosa. In this regard, the in vitro tests showed that Bacillus sp. BO53 VOCs inhibited the growth of P. aeruginosa and reduced the growth of S. aureus and A. baumanni. Furthermore, Pseudoalteromonas sp. GA327 strongly inhibited the growth of A. baumanni, and P. aeruginosa. VOCs were analyzed by headspace solid-phase microextraction (HS-SPME) joined to gas chromatography-mass spectrometry (GC-MS) methodology. Nineteen VOCs were identified, where 5-acetyl-2-methylpyridine, 2-butanone, and 2-nonanone were the major compounds identified on Bacillus sp. BO53 VOCs; while 1-pentanol, 2-butanone, and butyl formate were the primary volatile compounds detected in Pseudoalteromonas sp. GA327. We proposed that the observed bioactivity is mainly due to the efficient inhibitory biochemical mechanisms of alcohols and ketones upon antibiotic-resistant bacteria. This is the first report which describes the antibacterial activity of VOCs emitted by octocoral-associated bacteria.

1. Introduction

For centuries, the fight against bacterial infections has been one the focus of attention of humanity. Although in the 20th century an important number of discovered antibacterial compounds have improved the quality of life of the people, it has been observed an increased antibiotic resistance prevalence among bacteria which represents the greatest challenge to human health. The main molecular mechanisms of bacteria resistance to antibiotics are due to mutations in bacterial genes; and due to the elevated number of multidrug resistance pumps (MDR pumps), which extrudes antibiotics out of the bacterial cells [1,2,3]. It is therefore imperative the discovery of new therapeutic compounds that overcome the bacterial resistance to antimicrobial agents. Among the major critical group of multidrug-resistant bacteria are Staphylococcus aureus, Pseudomonas aeruginosa, and Acinetobacter baumannii [4]. S. aureus is a commensal Gram-positive bacteria, which causes different types of diseases such as endocarditis, septic arthritis, necrotizing fasciitis, parotitis, pyomyositis, osteomyelitis, and skin infections [5]. P. aeruginosa is an opportunistic pathogen that is a leading cause of morbidity and mortality in cystic fibrosis patients and immunocompromised individuals. Moreover, it is one of the main risk factors for nosocomial infections and ventilator-associated pneumonia [6]. A. baumannii is a Gram-negative Bacillus, which is the main cause of hospital-acquired infections, leading to septicemia and pneumonia in immune-compromised hosts [7].
Natural antibacterial agents represent the main source of new drugs [8,9]. Most of the scientific investigations for the discovery of drugs with bioactivity against different illnesses have been focused on living organisms from the terrestrial ecosystem. However, in recent years an important number of researches undertaken for the discovery of new bioactive natural products have been performed on marine organisms [10,11]. In this sense, corals (Cnidaria) are aquatic invertebrates in which thousands of bacterial phylotypes coexist. Coral’s microbiome association mainly depends on the corals’ species on which they develop a relevant role in the biosynthesis of compounds with a high degree of bioactivities, for protection against pathogenic microorganisms. Thus, the coral microbiome is an important source of antibacterial natural products [11,12,13,14].
Many marine bacteria produce volatile organic compounds (VOCs) whose bioactivity against human pathogenic bacteria are at the early stages of investigation [15,16,17,18,19,20]. These VOCs are small molecules biosynthesized by primary and secondary metabolic pathways and include chemical classes such as alcohols, esters, aliphatic and aromatic hydrocarbons, terpenes, nitrogen, and sulfur compounds, among others. The bacteria volatile organic compounds (bVOCs), contribute to the intra- or inter-communication, and protection against other microorganisms [15,17]. Taking this into account, marine bacteria VOCs can be considered a highly potential source of drugs with antibacterial bioactivity. Despite bacterial symbionts of octocorals represent a source of potential antibiotic drugs [14], no investigation has been focused on the assessment of the antibacterial activity of bVOCs. Accordingly, the purpose of this research is to study the antibiotic activity of VOCs of bacteria isolated from two different octocoral species of the Caribbean Sea against human pathogenic bacteria P. aeruginosa, A. baumannii, and methicillin-resistant S. aureus.

2. Results

2.1. Identification of Marine Bacteria BO53 and GA327

The marine bacteria species BO53 and GA327, isolated in Panama from Pseudopterogorgia acerosa (Pallas, 1766) and Muriceopsis sulphurea (Donovan, 1825), respectively, were identified by 16S rRNA gene sequence analyses. In this sense, the 16S rRNA gene sequence of each species shows 99% sequence similarity with Bacillus sp. (BO53) and Pseudoalteromonas sp. (GA327) species, when compared to those in the GenBank database (https://www.ncbi.nlm.nih.gov/genbank), using the Basic Local Alignment Search Tool (BLAST). GeneBank accession numbers of the 16S rRNA sequence of BO53 and GA327 are MK291446 and KU213068, respectively.

2.2. Antibacterial Activity of VOCs Produced by Bacillus sp. BO53 and Pseudoalteromonas sp. GA327

The in vitro study to determine the antibacterial activity of volatile compounds produced by marine bacteria Bacillus sp. BO53 and Pseudoalteromonas sp. GA327 species revealed that both bacterial compounds had inhibitory activity towards A. baumannii, P. aeruginosa, and methicillin-resistant S. aureus growth (Table 1). The Gram-positive Bacillus sp. BO53 volatile organic compounds lead to significant growth inhibition of P. aeruginosa at 24 h, and to growth reduction of S. aureus and A. baumannii at 48 h. The volatiles released by the Gram-negative Pseudoalteromonas sp. GA327 lead to the growth inhibition of A. baumannii at 24 h, and P. aeruginosa at 48 h, and did not inhibit the growth of S. aureus. On the other hand, in the absence of bVOCs produced by marine bacteria, the growth of human pathogenic bacteria was not suppressed. The inhibition of Gram-negative pathogenic bacteria growth by marine bacteria VOCs was greater for Pseudoalteromonas sp. GA327, than Bacillus sp. BO53; while on the other hand, the bioactivity of VOCs on Gram-positive pathogenic bacteria, was higher for Bacillus sp. BO53 than Pseudoalteromonas sp. GA327.

2.3. Identification of VOCs from Bacillus sp. BO53 and Pseudoalteromonas sp. GA327

The analysis for identification of VOCs biosynthesized by octocoral-associated bacteria Bacillus sp. BO53 and Pseudoalteromonas sp. GA327 was performed by HS-SPME-GC-MS technique. Each marine bacteria sample was analyzed three times using the DVB/CAR/PDMS coating solid-phase microextraction fiber; 37 °C extraction temperature; and 40 min extraction time. DVB/CAR/PDMS fiber was selected due to its high capacity for the extraction of volatile and semi-volatile compounds present in samples [21,22,23].
In total, 19 bVOCs were identified, of which 11 were detected in Bacillus sp. BO53 and 13 in Pseudoalteromonas sp. GA327 (Table 2). Compounds that were present in the blank Luria Bertani (LB) broth, supplemented with seawater, were excluded. Ketone comprised the largest compounds detected in Bacillus sp. BO53, followed by alcohols, sesquiterpenes, monoterpenes, aromatics, and alkanes (Figure 1a). 5-Acetyl-2-methylpyridine (64.63%), 2-butanone (17.03%), and 2-nonanone (7.00%) were the major VOCs detected in Bacillus sp. BO53. In the case of Pseudoalteromonas sp. GA327, alcohols are the main compounds detected followed by ketones, ester, and monoterpene compounds (Figure 1b). 1-Pentanol (38.91%), 2-butanone (20.14%), and butyl formate (17.30%) were the primary VOCs detected in Pseudoalteromonas sp. GA327. 2,4-trimethylpentane, o-xylene, 5-acetyl-2-methylpyridine, α-cubebene, 1-undecanol, and α-longicyclene are the specific VOCs produced by Bacillus sp. BO53 (Figure 2b); while 1-butanol, 2-pentanone, butyl formate, 2-heptanone, 6-methyl-5-heptene-2-one, benzyl alcohol, 2-decanone, 2-undecanone were found only in Pseudoalteromonas sp. GA327 (Figure 2c).

3. Discussion

Human pathogenic bacteria, A. baumannii, methicillin-resistant S. aureus, and P. aeruginosa bacteria, are antibiotic-resistant microorganisms for which the development of research for the discovery of new antibacterial drugs have become crucial. To date, only a small number of marine bacteria have been studied for bioactive bVOCs [24].
This study aimed to determine the antibacterial activity of the volatilome produced by marine bacteria, Bacillus sp. BO53 and Pseudoalteromonas sp. GA327, isolated from octocorals. Overall, the VOCs produced by Pseudoalteromonas sp. GA327 lead to the inhibition of the two Gram-negative pathogenic bacteria investigated at early stages (24 h) when compared to the antibacterial activity of Bacillus sp. BO53. The antibacterial activity of Bacillus sp. BO53 VOCs against P. aeruginosa was higher than for A. baumannii and S. aureus, and lead to a total inhibition of P. aeruginosa growth within 48 h after exposure to the Bacillus sp. BO53 VOCs.
The HS-SPME-GC-MS analysis, lead to the identification of ketones, mainly 5-acetyl-2-methylpyridine, as the most abundant volatile compound produced by Bacillus sp. BO53. Among the main VOCs biosynthesized by bacteria are ketones and alcohols [25]. It is evident from this research that the volatile compound 5-acetyl-2-methylpyridine leads to the growth reduction of A. baumannii, S. aureus, and the inhibition of P. aeruginosa. In this sense, pyridine derivatives have shown relevant bioactivity against Gram-positive and Gram-negative bacteria [26]. The antibacterial activity of this volatile compound has to be performed to corroborate its bioactivity. On the other hand, studies have reported a relevant inhibitory activity of 2-butanone upon S. aureus, P. aeruginosa, and E. coli [27]. Furthermore, Arambula et al. [28] have reported an important growth inhibition of S. aureus and E. coli by 2-nonanone. The alcohol volatile compound 1-undecanol, which was determined as one of the main compounds produced by Bacillus sp. BO53 inhibits S. aureus by damaging the bacterial cell membrane [29]. This reported bioactivity also might contribute to the growth reduction of methicillin-resistant S. aureus observed in the current study. The lack of complete inhibition of S. aureus and A. baumannii strains can be attributed to the low amount of VOCs produced by Bacillus sp. BO53, which was due to its low growth rates.
The results of this investigation have revealed an effective antibacterial activity of Pseudoalteromonas sp. GA327 VOCs on A. baumannii and P. aeruginosa strains. These observations suggest that alcohol, ketone, and ester volatile compounds, which were the most abundant VOCs identified from Pseudoalteromonas sp. GA327, generate an efficient inhibitory biochemical mechanism on the Gram-negative bacteria studied. 1-Pentanol and benzyl alcohol, which were detected in high amounts in Pseudoalteromonas sp. GA327, affect the bacterial cell membrane, causing fluidization or interrupting the functions of the membrane proteins. The alteration of the bacterial membrane due to volatile alcohols allows other antimicrobial compounds to easily penetrate the cell membrane [30] 2-Butanone was the main antibacterial ketone identified from Pseudoalteromonas sp. GA327. On the other hand, it has been reported that 2-heptanone, 6-methyl-5-heptene-2-one, and 2-undecanone ketones, produced by Pseudoalteromonas sp. GA327, present antibacterial properties against pathogenic Gram-positive and Gram-negative bacteria [31,32,33,34,35]. Regarding the inhibitory activity of the volatile ester butyl formate, one of the VOCs detected in higher amounts in Pseudoalteromonas sp. GA327, Calvo et al. [36] reported the presence of this molecule within the antifungal VOCs produced by the bacteria B. velezensis. Therefore, the results of the present study suggest the potential antibacterial bioactivity of butyl formate.

4. Materials and Methods

4.1. Bacterial Isolation from Octocorals

Isolated bacteria GA327 and BO53 were obtained from two octocorals hosts located in coastal Caribbean Sea waters of Panama: GA327 from Pseudopterogorgia acerosa and Muriceopsis sulphurea. M. sulphurea was collected at Punta Galeta in Colon Province (9°24′16′ N 79°51′35″ W), and P. acerosa from San Cristobal Island in Bocas del Toro Province (9°15′31″ N 82°16′12″ W).
For isolation of the octocoral-associated bacteria, 0.5 mL of the coral mucus was inoculated on agar plates with seawater-based nutrient medium (500 mg of mannitol, 100 mg of peptone, 8 g of Noble agar, and rifampicin [5 µg/mL] in 1 L of seawater). The octocoral-associated bacteria, GA327 and BO53, were subsequently isolated from the collection plate and successively replated until the pure isolated bacteria was obtained.

4.2. Molecular Identification of Octocoral-Associated Bacteria Species

The genetic identification of the bacterial species GA237 and BO53 was performed based on the methodology described by Atencio et al. [13]. Briefly, for DNA extraction, one milliliter of the GA237 and BO53 species were cultured on Luria Bertani (LB) broth (Difco, Michigan, MI, USA), supplemented with seawater, and grown at 25 °C for 24 h. The samples were then centrifuged at 10,000 rpm for 2 min. The resulting pellet was resuspended in 500 µL of 5% Chelex-100. Each suspension was vortexed and incubated at 56 °C for 20 min, then boiled at 100 °C for 10 min, and placed on ice for 2 min. The samples were centrifuged at 13,000 rpm for 5 min. Subsequently, the supernatants containing the DNA were transferred to a new tube and stored at −20 °C.
The DNA fragment of the 16S rRNA gene was amplified by PCR using primers pairs 27F (5′-AGAGTTTGATCMTGGCTCAG-3′) and 1492R (5′-TACGGYTACCTTGTTACGACTT-3′), and sequenced using 518F (5′CCAGCAGCCGCGGTAATACG3′) and 800R (5′TACCAGGGTATCTAATCC3′) primers [37]. The obtained sequences were compared to 16S rRNA gene sequences, using the BLAST algorithm, deposited in the GenBank, keeping a maximum of 100 hits per query sequence. Moreover, 16S rRNA sequences were compared against RDP (Ribosomal Database Project) [38] and aligned against the SILVA reference database using SINA with a 98% similarity threshold [39]. The nucleotide sequence of the BO53 and GA327 species have been submitted to the GenBank database under the accession number MK291446 and KU213068, respectively.

4.3. Pathogenic Bacterial Strains

Pathogenic bacteria A. baumannii (ATCC 19606), P. aeruginosa (ATCC 10145), and S. aureus (ATCC 43300) were maintained on LB medium at 37 °C. Each pathogenic strain was transferred to LB broth and was grown at 37 °C overnight. These broths were used to prepare dilutions of 0.5 McFarland to use as inoculum for the antibacterial activity assays.

4.4. Antibacterial Activity of Marine bVOCs

The antibacterial activity of the VOCs of BO53 and GA327 species were determined by the double plate test method of Romoli et al. [40] with slight modifications. BO53 and GA327 species were cultured by triplicate on LB broth, supplemented with sterile seawater, and incubated at 37 °C for 24 h. A dilution of the cultured marine bacteria was made to achieve a turbidity of 0.5 McFarland, and then each dilution was inoculated on LB plates supplemented with sterile seawater (hereafter marine bacteria plate) and placed on an incubation chamber at 37 °C overnight. Afterward, the Petri dish lid was taken off and a plate with only LB medium (hereafter pathogenic bacteria plate) was placed over the marine bacteria plate. Both plates were sealed with parafilm and incubated at 37 °C for 24 h, to allow the VOCs generated by the marine bacteria to be absorbed in the pathogenic bacteria plate. Afterward, the 0.5 McFarland dilutions of each pathogenic strain were inoculated homogeneously on the pathogenic bacteria plate with a sterile cotton swab, and placed again over the marine bacteria plate, sealed with parafilm, and incubated at 37 °C for 48 h. The pathogen’s growth was evaluated every 24 h. Antibacterial activities were compared to negative controls. The pathogenic bacteria growth inhibition by the marine bVOCs was judged as “+” (complete inhibition), “±” (reduced growth), and “-“ (no detectable bioactivity). Each experiment was carried out in triplicate.

4.5. Marine Bacteria Volatolome Analysis

Pseudoalteromonas sp. GA327 and Bacillus sp. BO53 species were cultured in glass vials, by triplicate, on LB medium supplemented with sterile seawater and incubated at 37 °C for 24 h. The samples were subsequently analyzed after 48 h of incubation. Three vials containing LB medium supplemented with sterile seawater, but not inoculated, were incubated under the same conditions.
The VOCs of all samples were analyzed by headspace-solid phase microextraction-gas chromatography-mass spectrometry (HS-SPME-GC-MS) method [22,41]. A divinylbenzene-carboxen-polydimethylsiloxane (DVB/CAR/PDMS 50/30 µm) fiber (Supelco, Bellefonte, PA, USA) was exposed to the headspace of the samples for 40 min at 37 °C. The isolated VOCs were analyzed by GC-MS, on a GC 6890N coupled to a 5975C mass spectrometry detector (Agilent Technologies, Palo Alto, CA, USA). VOCs were desorbed by insertion of the SPME fiber into the GC injection port, in splitless mode, for 2 min at 250 °C. The compounds were separated on an HP-5MS capillary column (30 m length, 0.25 mm id, 0.25 µm), using He as carrier gas at 1 mL/min. The oven temperature was 50 °C for 2 min, then increased to 240 °C at 6 °C/min and held for 5 min. MS detector was operated in electron impact mode (EV = 70 eV); in scan mode from 30 to 550 m/z; with an ion source temperature of 250 °C.
VOCs were identified by comparing their MS spectra with Registry of Mass Spectral Data with Structures library (Wiley 7th edition, USA), and National Institute of Standards and Technology library (NIST) spectral databases, and by using authentic standards when available. Additional identification was performed by determination of the compounds Kovat’s retention index (RI) by using an alkane standard solution C8-C20 (Sigma- Aldrich, Saint Louis, MO, USA). VOCs compounds identified in vials not inoculated were excluded from the data analyses. The relative quantities of the volatile compounds are expressed as percent peak areas relative to the total peak area of identified compounds from the average of the three replicates [22,42].

5. Conclusions

The antibacterial activity of octocoral-associated bacteria Bacillus sp. BO53 and Pseudoalteromonas sp. GA327 VOCs were determined for the first time. Bacillus sp. BO53 volatile compounds lead to complete inhibition of P. aeruginosa and displayed growth reduction on A. baumannii and methicillin-resistant S. aureus; while Pseudoalteromonas sp. GA327 VOCs exhibited a high inhibition against both Gram-negative bacteria species and were inefficient against S. aureus growth. HS-SPME-GC-MS methodology allowed the identification of VOCs produced by both octocoral-associated bacteria. Alcohol and ketone volatile compounds were the most abundant VOCs detected. The bacterial emission of these VOCs might explain the antibacterial activity observed. The results of this study justified future research to determine the antibacterial activity of a few of the identified VOCs to evaluate their potential bioactivity against antibiotic-resistant bacteria.

Author Contributions

M.G. and A.A.D.-A. conceived the idea; H.G. identified and collected the octocoral from the Panamanian Caribbean Sea; L.A.A. and A.G. carried out the experiments under the supervision of R.B., A.B., M.G. and A.A.D.-A. All authors approved the manuscript. All authors of the present manuscript have read and agreed to the published version of the manuscript.

Funding

This research received no external funding.

Acknowledgments

The author acknowledges K.S. Rao, Director of INDICASAT AIP, for his support. M.G. and A.A.D.-A. acknowledge the financial support given by the National Research System of Panama (SNI).

Conflicts of Interest

The authors declare that they have no conflict of interest.

References

  1. Blair, J.M.A.; Webber, M.A.; Baylay, A.J.; Ogbolu, D.O.; Piddock, L.J.V. Molecular mechanisms of antibiotic resistance. Nat. Rev. Microbiol. 2015, 13, 42–51. [Google Scholar] [CrossRef] [Scilit]
  2. Friedman, N.D.; Temkin, E.; Carmeli, Y. The negative impact of antibiotic resistance. Clin. Microbiol. Infect. 2016, 22, 416–422. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  3. Patini, R.; Mangino, G.; Martellacci, L.; Quaranta, G.; Masucci, L.; Gallenzi, P. The Effect of Different Antibiotic Regimens on Bacterial Resistance: A Systematic Review. Antibiotics 2020, 9, 22. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  4. World Health Organization. Global Priority List of Antibiotic-Resistance Bacteria to Guide Research, Discovery, and Development of New Antibiotics. 2017. Available online: https://www.who.int/medicines/publications/global-priority-list-antibiotic-resistant-bacteria/en/ (accessed on 16 May 2020).
  5. Jenul, C.; Horswill, A.R. Regulation of Staphylococcus aureus virulence. Microbiol. Spectr. 2018, 6, 669–686. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  6. Moradali, M.F.; Ghods, S.; Rehm, B.H.A. Pseudomonas aeruginosa Lifestyle: A Paradigm for Adaptation, Survival, and Persistence. Front. Cell. Infect. Microbiol. 2017, 7, 39–68. [Google Scholar] [CrossRef] [Scilit]
  7. Asif, M.; Alvi, I.A. Insight into Acinetobacter baumannii: Pathogenesis, global resistance, mechanisms of resistance, treatment options, and alternative modalities. Infect. Drug Resist. 2018, 11, 1249–1260. [Google Scholar] [CrossRef] [Scilit]
  8. Singh, S.B. Confronting the challenges of discovery of novel antibacterial agents. Bioorg. Med. Chem. Lett. 2014, 24, 3683–3689. [Google Scholar] [CrossRef] [Scilit]
  9. Katz, L.; Baltz, R.H. Natural product discovery: Past, present, and future. J. Ind. Microbiol. Biotechnol. 2016, 43, 155–176. [Google Scholar] [CrossRef] [Scilit]
  10. Puglisi, M.P.; Sneed, J.M.; Ritson-Williams, R.; Young, R. Marine chemical ecology in benthic environments. Nat. Prod. Rep. 2019, 36, 410–429. [Google Scholar] [CrossRef] [Scilit]
  11. Sang, V.T.; Dat, T.T.H.; Vinh, L.B.; Cuong, L.C.V.; Oanh, P.T.T.; Ha, H.; Kim, Y.H.; Anh, H.L.T.; Yang, S.Y. Coral and Coral-Associated Microorganisms: A Prolific source of Potential Bioactive Natural Products. Mar. Drugs. 2019, 17, 468. [Google Scholar] [CrossRef] [Scilit]
  12. Hernandez-Agreda, A.; Gates, R.D.; Ainsworth, T.D. Defining the Core Microbiome in Corals’ Microbial Soup. Trends Microbiol. 2017, 25, 125–140. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  13. Atencio, L.A.; Dal Grande, F.; Young, G.O.; Gavilán, R.; Guzmán, H.M.; Schmitt, I.; Mejía, L.C.; Gutiérrez, M. Antimicrobial-producing Pseudoalteromonas from the marine environment of Panama shows a high phylogenetic diversity and clonal structure. J. Basic Microbiol. 2018, 58, 747–769. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  14. Raimundo, I.; Silva, S.G.; Costa, R.; Keller-Costa, T. Bioactive secondary metabolites from octocoral-Associated microbes—New chances for blue growth. Mar. Drugs 2018, 16, 485. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  15. Schulz, S.; Dickschat, J.S.; Kunze, B.; Wagner-Dobler, I.; Diestel, R.; Sasse, F. Biological activity of volatiles from marine and terrestrial bacteria. Mar. Drugs 2010, 8, 2976–2987. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  16. Papaleo, M.C.; Fondi, M.; Maida, I.; Perrin, E.; Lo Giudice, A.; Michaud, L.; Mangano, S.; Bartolucci, G.; Romoli, R.; Fani, R. Sponge-associated microbial Antarctic communities exhibiting antimicrobial activity against Burkholderia cepacia complex bacteria. Biotechnol. Adv. 2012, 30, 272–293. [Google Scholar] [CrossRef] [Scilit]
  17. Papaleo, M.C.; Romoli, R.; Bartolucci, G.; Maida, I.; Perrin, E.; Fondi, M.; Orlandini, V.; Mengoni, A.; Emiliani, G.; Tutino, M.L.; et al. Bioactive volatile organic compounds from Antarctic (sponges) bacteria. New Biotechnol. 2013, 30, 824–838. [Google Scholar] [CrossRef] [Scilit]
  18. Romoli, R.; Papaleo, M.C.; De Pascale, D.; Tutino, M.L.; Michaud, L.; LoGiudice, A.; Fani, R.; Bartolucci, G. GC-MS volatolomic approach to study the antimicrobial activity of the antarctic bacterium Pseudoalteromonas sp. TB41. Metabolomics 2014, 10, 42–51. [Google Scholar] [CrossRef] [Scilit]
  19. Orlandini, V.; Maida, I.; Fondi, M.; Perrin, E.; Papaleo, M.C.; Bosi, E.; de Pascale, D.; Tutino, M.L.; Michaud, L.; Lo Giudice, A.; et al. Genomic analysis of three sponge-associated Arthrobacter Antarctic speciess, inhibiting the growth of Burkholderia cepacia complex bacteria by synthesizing volatile organic compounds. Microbiol. Res. 2014, 169, 593–601. [Google Scholar] [CrossRef] [Scilit]
  20. Sannino, F.; Parrilli, E.; Apuzzo, G.A.; de Pascale, D.; Tedesco, P.; Maida, I.; Perrin, E.; Fondi, M.; Fani, R.; Marino, G.; et al. Pseudoalteromonas haloplanktis produces methylamine, a volatile compound active against Burkholderia cepacia complex strains. New Biotechnol. 2017, 35, 13–18. [Google Scholar] [CrossRef] [Scilit]
  21. Risticevic, S.; Lord, H.; Górecki, T.; Arthur, C.L.; Pawliszyn, J. Protocol for solid-phase microextraction method development. Nat. Protoc. 2010, 5, 122–139. [Google Scholar] [CrossRef] [Scilit]
  22. Durant, A.A.; Rodríguez, C.; Herrera, L.; Almanza, A.; Santana, A.I.; Spadafora, C.; Gupta, M.P. Anti-malarial activity and HS-SPME-GC-MS chemical profiling of Plinia cerrocampanensis leaf essential oil. Malar. J. 2014, 13, 18. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  23. Laukaleja, I.; Kruma, Z. Evaluation of a headspace solid-phase microextraction with different fibres for volatile compoun d determination in specialtycoffee brews. Res. Rural Dev. 2019, 1, 215–221. [Google Scholar] [CrossRef] [Scilit]
  24. Schmidt, R.; Cordovez, V.; De Boer, W.; Raaijmakers, J.; Garbeva, P. Volatile affairs in microbial interactions. ISME J. 2015, 9, 2329–2335. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  25. Schulz, S.; Dickschat, J.S. Bacterial volatiles: The smell of small organisms. Nat. Prod. Rep. 2007, 24, 814–842. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  26. Altaf, A.A.; Shahzad, A.; Gul, Z.; Rasool, N.; Badshah, A.; Lal, B.; Khan, E. A Review on the Medicinal Importance of Pyridine Derivatives. J. Drug Des. Med. Chem. 2015, 1, 1–11. [Google Scholar] [CrossRef]
  27. Mitchell, A.M.; Strobel, G.A.; Moore, E.; Robison, R.; Sears, J. Volatile antimicrobials from Muscodor crispans, a novel endophytic fungus. Microbiology 2010, 156, 270–277. [Google Scholar] [CrossRef] [Scilit]
  28. Arámbula, C.I.; Diaz, C.E.; Garcia, M.I. Performance, chemical composition and antibacterial activity of the essential oil of Ruta chalepensis and Origanum vulgare. J. Phys. Conf. Ser. 2019, 1386. [Google Scholar] [CrossRef] [Scilit]
  29. Togashi, N.; Shiraishi, A.; Nishizaka, M.; Matsuoka, K.; Endo, K.; Hamashima, H.; Inoue, Y. Antibacterial activity of long-chain fatty alcohols against Staphylococcus aureus. Molecules 2007, 12, 139–148. [Google Scholar] [CrossRef] [Scilit]
  30. Yano, T.; Miyahara, Y.; Morii, N.; Okano, T.; Kubota, H. Pentanol and benzyl alcohol attack bacterial surface structures differently. Appl. Environ. Microbiol. 2016, 82, 402–408. [Google Scholar] [CrossRef] [Scilit]
  31. Hanbali, E.L.F.; Mellouki, F.; Akssira, M.; Boira, H.; Blázquez, M.A. Composition and antimicrobial activity of essential oil of anthemis tenuisecta ball. J. Essent. Oil Bear. Plants 2007, 10, 499–503. [Google Scholar] [CrossRef] [Scilit]
  32. Arrebola, E.; Sivakumar, D.; Korsten, L. Effect of volatile compounds produced by Bacillus strains on postharvest decay in citrus. Biol. Control 2010, 53, 122–128. [Google Scholar] [CrossRef] [Scilit]
  33. Popova, A.A.; Koksharova, O.A.; Lipasova, V.A.; Zaitseva, J.V.; Katkova-Zhukotskaya, O.A.; Eremina, S.I.; Mironov, A.S.; Chernin, L.S.; Khmel, I.A. Inhibitory and toxic effects of volatiles emitted by strains of Pseudomonas and Serratia on growth and survival of selected microorganisms, Caenorhabditis elegans, and Drosophila melanogaster. Biomed. Res. Int. 2014, 2014. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  34. Ould Bellahcen, T.; Cherki, M.; Sánchez, J.A.C.; Cherif, A.; EL Amrani, A. Chemical Composition and Antibacterial Activity of the Essential Oil of Spirulina platensis from Morocco. J. Essent. Oil Bear. Plants 2019, 22, 1265–1276. [Google Scholar] [CrossRef] [Scilit]
  35. Benali, T.; Habbadi, K.; Khabbach, A.; Marmouzi, I. GC–MS Analysis, Antioxidant and Antimicrobial Activities of Achillea Odorata Subsp. Pectinata and Ruta Montana Essential Oils and Their Potential Use as Food Preservatives. Foods 2020, 9, 668. [Google Scholar] [CrossRef] [Scilit]
  36. Calvo, H.; Mendiara, I.; Arias, E.; Gracia, A.P.; Blanco, D.; Venturini, M.E. Antifungal activity of the volatile organic compounds produced by Bacillus velezensis strains against postharvest fungal pathogens. Postharvest Biol. Technol. 2020, 166, 111208. [Google Scholar] [CrossRef] [Scilit]
  37. Frank, J.A.; Reich, C.I.; Sharma, S.; Weisbaum, J.S.; Wilson, B.A.; Olsen, G.J. Critical evaluation of two primers commonly used for amplification of bacterial 16S rRNA genes. Appl. Environ. Microbiol. 2008, 74, 2461–2470. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  38. Wang, Q.; Garrity, G.M.; Tiedje, J.M.; Cole, J.R. Naïve Bayesian classifier for rapid assignment of rRNA sequences into the new bacterial taxonomy. Appl. Environ. Microbiol. 2007, 73, 5261–5267. [Google Scholar] [CrossRef] [Scilit]
  39. Pruesse, E.; Peplies, J.; Glöckner, F.O. SINA: Accurate high-throughput multiple sequence alignment of ribosomal RNA genes. Bioinformatics 2012, 28, 1823–1829. [Google Scholar] [CrossRef] [Scilit]
  40. Romoli, R.; Papaleo, M.C.; De Pascale, D.; Tutino, M.L.; Michaud, L.; Logiudice, A.; Fani, R.; Bartolucci, G. Characterization of the volatile profile of Antarctic bacteria by using solid-phase microextraction-gas chromatography-mass spectrometry. J. Mass Spectrom. 2011, 46, 1051–1059. [Google Scholar] [CrossRef] [Scilit]
  41. Correa, R.; Coronado, L.M.; Garrido, A.C.; Durant-Archibold, A.A.; Spadafora, C. Volatile organic compounds associated with Plasmodium falciparum infection in vitro. Parasites Vectors 2017, 10, 215. [Google Scholar] [CrossRef] [Scilit]
  42. Garrido, A.; Ledezma, J.G.; Durant-Archibold, A.A.; Allen, N.S.; Villarreal A, J.C.; Gupta, M.P. Chemical Profiling of Volatile Components of the Gametophyte and Sporophyte Stages of the Hornwort Leiosporoceros dussii (Leiosporocerotaceae) From Panama by HS-SPME-GC-MS. Nat. Prod. Commun. 2019, 14. [Google Scholar] [CrossRef] [Scilit]
Figure 1. The proportion of the chemical families of VOCs detected in octocoral-associated bacteria Bacillus sp. BO53 and Pseudoalteromonas sp. GA327.
Figure 1. The proportion of the chemical families of VOCs detected in octocoral-associated bacteria Bacillus sp. BO53 and Pseudoalteromonas sp. GA327.
Antibiotics 09 00923 g001
Figure 2. Molecular structure of Bacillus sp. BO53 and Pseudoalteromonas sp. GA327. detected volatile compounds. (a) VOCs detected on Bacillus sp. BO53 and Pseudoalteromonas sp. GA327: (1) 2-butanone, (2) 1-pentanol, (3) p-cymene, (4) 3-methylacetophenone, (5) 2-nonanone, (b) VOCs detected only on Bacillus sp. BO53: (6) 2,2,4-trimethylpentane, (7) o-xylene, (8) 5-acetyl-2-methylpyridine, (9) α-cubebene, (10) 1-decanol, (11) logicyclene, (c) VOCs detected only on Pseudoalteromonas sp. GA327: (12) 2-butanone, (13) 2-pentanone, (14) butyl formate, (15) 2-heptanone, (16) 6-methyl-5-heptene-2-one, (17) benzyl alcohol, (18) 2-decanone, (19) 2-undecanone.
Figure 2. Molecular structure of Bacillus sp. BO53 and Pseudoalteromonas sp. GA327. detected volatile compounds. (a) VOCs detected on Bacillus sp. BO53 and Pseudoalteromonas sp. GA327: (1) 2-butanone, (2) 1-pentanol, (3) p-cymene, (4) 3-methylacetophenone, (5) 2-nonanone, (b) VOCs detected only on Bacillus sp. BO53: (6) 2,2,4-trimethylpentane, (7) o-xylene, (8) 5-acetyl-2-methylpyridine, (9) α-cubebene, (10) 1-decanol, (11) logicyclene, (c) VOCs detected only on Pseudoalteromonas sp. GA327: (12) 2-butanone, (13) 2-pentanone, (14) butyl formate, (15) 2-heptanone, (16) 6-methyl-5-heptene-2-one, (17) benzyl alcohol, (18) 2-decanone, (19) 2-undecanone.
Antibiotics 09 00923 g002
Table 1. Antibacterial effect of Bacillus sp. and Pseudoalteromonas sp. volatile compounds against Acinetobacter baumanni, Staphylococcus aureus, and Pseudomonas aeruginosa pathogenic bacteria.
Table 1. Antibacterial effect of Bacillus sp. and Pseudoalteromonas sp. volatile compounds against Acinetobacter baumanni, Staphylococcus aureus, and Pseudomonas aeruginosa pathogenic bacteria.
SpeciesStrainBacillus sp. BO53Pseudoalteromonas sp. GA327
24 h48 h24 h48 h
A. baumanniATCC 19606-±++
S. aureusATCC 43300-±--
P. aeruginosaATCC 10145-+±+
(+) Growth inhibition; (±) Growth reduction; (-) No inhibition.
Table 2. Identified mVOCs produced by the marine bacteria Bacillus sp. BO53 and Pseudoalteromonas sp. GA327.
Table 2. Identified mVOCs produced by the marine bacteria Bacillus sp. BO53 and Pseudoalteromonas sp. GA327.
% Detected Compound on Each Species
CompoundTRIERIBacillus sp.
BO53
Pseudoalteromonas sp. GA327
2-Butanone60260917.0320.14
1-Butanol671676-4.55
2,2,4-Trimethylpentane6806870.46-
2-Pentanone687693-1.29
1-Pentanol7757801.3338.91
Butyl formate787793-17.30
o-Xylene8848910.47-
2-Heptanone889895-7.99
6-Methyl-5-heptene-2-one988995-0.37
p-Cymene102110270.500.98
Benzyl Alcohol10331040-3.32
2-Nonanone109611027.001.38
3-Methylacetophenone117611840.261.18
5-Acetyl-2-methylpyridine1189119364.63-
2-Decanone11901198-1.01
2-Undecanone12911300-1.58
α-Cubebene135413550.43-
1-Undecanol137013744.58-
α-Longicyclene137413803.30-
TRI: Theoretical Retention Index; ERI: Experimental Retention Index.
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Share and Cite

MDPI and ACS Style

Garrido, A.; Atencio, L.A.; Bethancourt, R.; Bethancourt, A.; Guzmán, H.; Gutiérrez, M.; Durant-Archibold, A.A. Antibacterial Activity of Volatile Organic Compounds Produced by the Octocoral-Associated Bacteria Bacillus sp. BO53 and Pseudoalteromonas sp. GA327. Antibiotics 2020, 9, 923. https://doi.org/10.3390/antibiotics9120923

AMA Style

Garrido A, Atencio LA, Bethancourt R, Bethancourt A, Guzmán H, Gutiérrez M, Durant-Archibold AA. Antibacterial Activity of Volatile Organic Compounds Produced by the Octocoral-Associated Bacteria Bacillus sp. BO53 and Pseudoalteromonas sp. GA327. Antibiotics. 2020; 9(12):923. https://doi.org/10.3390/antibiotics9120923

Chicago/Turabian Style

Garrido, Anette, Librada A. Atencio, Rita Bethancourt, Ariadna Bethancourt, Héctor Guzmán, Marcelino Gutiérrez, and Armando A. Durant-Archibold. 2020. "Antibacterial Activity of Volatile Organic Compounds Produced by the Octocoral-Associated Bacteria Bacillus sp. BO53 and Pseudoalteromonas sp. GA327" Antibiotics 9, no. 12: 923. https://doi.org/10.3390/antibiotics9120923

APA Style

Garrido, A., Atencio, L. A., Bethancourt, R., Bethancourt, A., Guzmán, H., Gutiérrez, M., & Durant-Archibold, A. A. (2020). Antibacterial Activity of Volatile Organic Compounds Produced by the Octocoral-Associated Bacteria Bacillus sp. BO53 and Pseudoalteromonas sp. GA327. Antibiotics, 9(12), 923. https://doi.org/10.3390/antibiotics9120923

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop