Next Article in Journal
Antibacterial and Anti-Inflammatory Activity of an Antimicrobial Peptide Synthesized with D Amino Acids
Next Article in Special Issue
Escherichia coli of Ready-to-Eat (RTE) Meats Origin Showed Resistance to Antibiotics Used by Farmers
Previous Article in Journal
Assessment of Drivers of Antimicrobial Use and Resistance in Poultry and Domestic Pig Farming in the Msimbazi River Basin in Tanzania
Previous Article in Special Issue
Genetic Profiles and Antimicrobial Resistance Patterns of Salmonella Infantis Strains Isolated in Italy in the Food Chain of Broiler Meat Production
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Genotypic Characteristics and Correlation of Epidemiology of Staphylococcus aureus in Healthy Pigs, Diseased Pigs, and Environment

1
School of Food Science and Engineering, South China University of Technology, Guangzhou 510000, China
2
Department of Microbiology, University of Wisconsin-La Crosse, 1725 State Street, La Crosse, WI 54601, USA
3
Research Institute for Food Nutrition and Human Health, Guangzhou 510000, China
*
Author to whom correspondence should be addressed.
Antibiotics 2020, 9(12), 839; https://doi.org/10.3390/antibiotics9120839
Submission received: 30 September 2020 / Revised: 1 November 2020 / Accepted: 17 November 2020 / Published: 24 November 2020
(This article belongs to the Special Issue Antimicrobial-Resistance of Food-Borne Pathogens)

Abstract

:
China is one of the largest producers of pigs and pork in the world. However, large-scale studies on pig-associated Staphylococcus aureus in relation to healthy pigs, diseased pigs and environment are scarce. The objective of the present study was to characterize and compare S. aureus isolates from healthy pigs, diseased pigs and environment through antimicrobial susceptibility testing, multiple locus sequence typing, spa typing, and antimicrobial resistance gene screening. Results showed all isolates were susceptible to linezolid and vancomycin. However, 66.7% (104/156) isolates were multidrug-resistant by displaying resistance to three or more antibiotics and high rates of resistance to penicillin, tetracycline, clindamycin, and clarithromycin were observed. Of the 20 multilocus sequence types (STs) identified among the isolates, ST9, ST188, and ST7 were most commonly isolated from healthy pigs and environment, while ST1 was most commonly isolated from diseased pigs. In total, 17 spa types were represented among the isolates, while t4792 was most commonly isolated from diseased pigs and t899, t189 were most commonly isolated from healthy pigs and environment. In conclusion, the genotypic and epidemiology characteristics observed among the isolates suggest pigs and pork could be important players in S. aureus dissemination.

1. Introduction

Staphylococcus aureus is an important opportunistic foodborne pathogen that can cause serious infections of the bloodstream, skin, and soft tissue in humans and animals [1]. According to reports, it can cause various suppurative infections and foodborne diseases in humans and animals, such as sepsis, pneumonia, mastitis, pericarditis, vomiting and diarrhea [2,3]. Human infections caused by pig-associated methicillin-resistant Staphylococcus aureus (MRSA) sequence type (ST) 398 indicate that pigs are a key reservoir of MRSA and these bacteria are transmitted to human through occupational contact with pigs [4]. Therefore, S. aureus is an important food safety hazard that requires special attention.
China is one of the largest pork producers in the world and houses more than 463 million pigs, accounting for 51.6% of all pigs worldwide [5]. In June 2015, the Chinese Academy of Sciences published a list of antibiotic use and final emissions in China and the report pointed out that of the 162,000 tons of antibiotics used in China in 2013, veterinary antibiotics accounted for 52%, while florfenicol, lincomycin, tylosin, and enrofloxacin are widely used in pig [6]. The frequent use of antibiotics and high feeding density on pig farms have facilitated the emergence and spread of S. aureus and livestock-associated methicillin-resistant Staphylococcus aureus (LA-MRSA) [7]. Antibiotics-resistant S. aureus have been isolated from pigs in farms, abattoirs, and markets in China. One study collected nasal swabs from 590 pigs in two abattoirs in Harbin and found 33.9% samples were S. aureus-positive, 38 samples were MRSA-positive, and ST398-t034 and ST9-t899 were most commonly isolated [7]. Another epidemiological survey of S. aureus in Danish retail meats found that the prevalence of S. aureus in turkey, pork and chicken was 86.96%, 75% and 78.43%, respectively [8], while ST398-t034 was the main type. Previous studies showed that raw and processed meat and food animals like pig as well as contaminated surfaces or tools could serve as vehicles for the transfer of S. aureus to foods in China [9,10], especially pig-associated ST9-t899-MRSA, which is the major strain [10].
In China, the prevalence of S. aureus has been paid attention to in different pig production chain, but there are few reports on the genotypic and epidemiology characteristics of S. aureus of the entire pork production chain. Therefore, the objective of this study was to characterize the prevalence of S. aureus colonization of healthy pigs, diseased pigs and environment and the antimicrobial resistance-associated phenotypes and genotypes and molecular characteristics of isolated S. aureus.

2. Results

2.1. Prevalence of S. aureus and MRSA

Among the 666 samples, 156 (23.4%) yielded S. aureus and 24 (3.6%) tested positive for MRSA (Table 1). Within the 156 S. aureus isolates, 121 (28.1%, 121/430) were from healthy pigs, 28 (17.0%, 28/165) were from diseased pigs, and 7 (9.9%, 7/71) were from environment. Among all types of samples, S. aureus had the highest prevalence in the abattoir (35.8%, 62/173), followed by the markets (23.1%, 37/160). MRSA prevalence ranged from 0% (0/97) from farm to 6.3% (10/160) from markets. Among the 28 S. aureus isolates of samples from diseased pigs, only three isolates (1.8%, 3/165) were MRSA.

2.2. Antimicrobial Susceptibility Profiles

All 128 S. aureus isolates, except those from diseased pigs, were susceptible to quinupristin-dalfopristin, linezolid, and vancomycin. Overall, as shown in Figure 1, isolates from pig farms, abattoirs, and markets were predominantly resistant to penicillin (98% to 100%), tetracycline (40–97%), and clindamycin (34–100%) and clarithromycin (40% to 93%). Many isolates were also resistant to gentamycin, ciprofloxacin, moxifloxacin), chloramphenicol, and other antibiotics. Resistance to a second-generation tetracycline, minocycline, was less prevalent than resistance to a first-generation tetracycline, tetracycline in general.
More than 90% of isolates from the farms were resistant to penicillin, gentamycin, tetracycline, clindamycin, and clarithromycin, as well as the fluoroquinolones ciprofloxacin and moxifloxacin (Figure 1). In addition, a large proportion of isolates from farms were resistant to levofloxacin (55.2%). higher resistance rates to the remaining antibiotics, with the exception of oxacillin, cefoxitin, chloramphenicol, minocycline and rifampin, were observed in farm isolates compared to the abattoir and market isolates. A high percentage of isolates from the abattoir were resistant to penicillin. Interestingly, the overall resistance prevalence was lower in abattoir isolates than market isolates for all tested antibiotics except gentamycin.
As indicated in Figure 1, isolates from diseased pigs displayed a high frequency of resistance to penicillin (100%), tetracycline (92.9%), clindamycin (96.4%), clarithromycin (96.4%), ciprofloxacin (96.4%), gentamycin (57.1%), and trimethoprim-sulfamethoxazole (42.9%). Resistance was found at low frequencies for cephalothin, oxacillin, cefoxitin, chloramphenicol, and rifampin. Notably, three isolates were resistant to quinupristin-dalfopristin.
As shown in Table A2 (Appendix A), only one S. aureus isolate was susceptible to all antimicrobial agents tested. The remaining isolates exhibited resistance to at least one of the antimicrobials. In total, 56 patterns of resistance for 9 categories of antimicrobials were found for these isolates, where the most common resistance pattern was PEN (28/156), followed by PEN-TET (11/156), PEN-GEN-TET-CLA-SXT-CLI-CIP-LEV-MXF (10/156), PEN-GEN-TET-CLA-SXT-CLI-CIP-MXF (9/156), PEN-GEN-TET-CLA-CLI-CIP (9/156), and Multidrug resistance was observed in 104 (66.7%) of the S. aureus isolates. Of the abattoir isolates, 30.6% (19/62) were multidrug-resistant (MDR), which is significantly fewer than farm isolates (22/22, 100%) and market isolates (32/37, 86.5%). Moreover, 85.7% (24/28) of the isolates from diseased pigs were MDR.

2.3. Prevalence of Resistance Genes

To evaluate the role of certain genes in the development of antimicrobial resistance, resistance-associated genes were amplified from the S. aureus isolates based on individual antibiotic resistance profiles. The results are presented in Table 2.
The gene mecA confers resistance to β-lactams and was present in 24 S. aureus isolates. Meanwhile, no mecC carriers were detected and blaZ was present in all isolates. The aminoglycoside resistance genes ant(4′)-Ia, aadE, aacA-aphD, and aac(6′)/aph(2”) were highly percentages among the isolates. Among the three genes associated with chloramphenicol resistance, cmlA was only detected in isolates from diseased pigs. A large proportion of isolates from diseased pigs carried the tetM gene, in contrast to isolates from other sources.
The lsa(E) gene, which is associated with pleuromutilin/lincosamide/streptogramin A resistance, has a high prevalence in farm isolates (100%, 22/22), abattoir isolates (93.5%, 58/62), market isolates (89.2%, 33/37) and diseased-pig isolates (96.4%, 27/28). Meanwhile, none of the isolates contained the multi-resistance gene variant of cfr(B). The linA gene, which confers resistance to clindamycin, was highly represented among the isolates from retail pork, while lnu(B) was detected at high frequencies in farm (100%, 22/22) and abattoir (62.9%, 39/62) isolates. Three genes associated with clarithromycin resistance, ermA, ermB, and ermC, were also detected. Only isolates from diseased pigs displayed a high prevalence of ermA and ermB, while ermC was detected in only three isolates, which were from farms and abattoir. The dfrG gene was frequently present, while sulI, sulII, and dfrA were rarely found.

2.4. Molecular Characteristics of S. aureus

Isolates were analyzed by multiple locus sequence typing (MLST) and spa typing (Figure 2). A total of 20 STs and 17 spa-types were identified. For farm isolates, the main MLST type was ST9 (77.3%, 17/22). And ST4292 was a newly discovered ST type in S. aureus. And there were 15 different ST types of isolates from the abattoirs, while the main types were ST188 (29.0%, 18/62), ST9 (21.0%, 13/62) and ST3387 (12.9%, 8/62). Meanwhile, nine different ST types have been identified in the market isolated, among them ST7 (40.5%, 15/37) and ST188 (18.9%, 7/37), were the main popular types.
Only one spa types, t899 (100%, 22/22) isolated from the farm. It can be seen that the types are relatively concentrated and single. In the environment, only one isolate with the spa type of t189 was observed and the others were all t899 type. The spa types of S. aureus isolated from the abattoirs were rich and diverse, including 13 types, mainly t189 (29.0%, 18/62) and t899 (32.3%, 20/62). There are seven spa types of S. aureus from the markets, mainly t091 (43.3%, 16/37) and t189 (24.3%, 9/37). The remaining types were t037, t899, t437, t1852 and t6675.

2.5. Genetic Relatedness

Based on the presence or absence of phenotypic resistance data and selected resistance genes, a dendrogram of similarity was established (Figure 2), which separated the 128 isolates in four main clusters. As determined by the dendrogram, the vast majority of S. aureus isolates clustered at the top of the dendrogram were abattoir isolates, and ten were market isolates. This cluster of isolates had diverse STs and spa types. In contrast, the remaining of the market isolates form two clusters towards the middle and the bottom of the dendrogram, respectively. Only seven abattoir isolates and the farm isolates clustered by dendrogram had identical STs and spa types, ST9 and t899, while the other abattoir isolates in this cluster had different STs and spa types.

3. Discussion

In order to monitor changes in the epidemiology and characteristics of S. aureus, some effective approaches like molecular typing were used in this study to analyze S. aureus isolates originating from healthy pigs, diseased pigs and environment. S. aureus was present in 9.9% to 35.8% of samples, where the most frequent contamination was observed in the abattoir (35.8%). MRSA prevalence ranged from 0% of samples from farms to 6.3% from markets. The overall prevalence of S. aureus and MRSA in our study was 23.4% and 3.6%, respectively. The average prevalence of S. aureus in this study was lower than that described in a study conducted in food and food animals in the Shaanxi province, China [11]. Similar results were obtained in a study in Hong Kong, where the prevalence of S. aureus in pigs was estimated to be 24.9% [12]. However, the results of our study appear higher (p ≤ 0.001) than another study for other pork samples or swine carcasses in the Shandong province, China (19.6%) [13]. Due to the complex environment of farms, markets and diseased pigs, S. aureus carrying rate of samples is high and relatively close, therefore we pay more attention to the genotype and phenotypic characteristics of strains from different sources.
Of the samples from the abattoir, 35.8% (62/173) were positive for S. aureus. The increased prevalence of S. aureus in samples after slaughtering compared to pigs on farms and retail meat suggest pig slaughtering process may play an important role in the transmission of S. aureus. During slaughtering, S. aureus can get transmitted via direct or indirect contact with the environment or meat products, including through processing machinery, refrigerators, meat containers, and staff. A study by Beneke estimated the occurrence of MRSA in abattoir environments was 12% in slaughterhouse samples [14]. One study also highlighted the role of the environment as a source of MRSA in the commercial pig production chain, where MRSA was detected in the pork production shower facilities of two commercial swine systems [15]. Another study found MRSA carriage by abattoir workers was caused by cross-contamination between workers and carcasses [16]. All of these elements acted as reservoirs and sources of pathogens and, consequently, lead to higher contamination levels. However, because the terminal samples did not all originate from the abattoir tested in this study, it was difficult to track contamination between transportation from the abattoir to the markets.
A total of 20 STs and 17 spa types were present in isolates from different sources. Abattoir isolates were notably diverse in MLST (n = 16) and spa type (n = 9) in, while market pork samples (n = 12 and 7, respectively) and farms (n = 3 and 1, respectively) displayed less diversity. LA-MRSA ST9 is currently the most prevalent sequence type in most Asian countries, but these strains are composed of different spa types, such as t899 in China, Hong Kong, and Taiwan [10,17,18], t4358 in Malaysia, and t337 in Thailand [19,20]. ST9-t899 was the most commonly detected type in our study and was especially prevalent on farms as it was identified in 17 and 9 isolates from the farms and abattoir, respectively, while most ST9 isolates are LA-MRSA, ST9 strains have been found to spread in both the presence and absence of direct livestock contact and even cause disease in humans [17,21].
Three major S. aureus sequence types ST188, ST9, and ST3387 were detected in the abattoir, while ST188-t189 accounted for 17.7% of the isolates and, similarly, was the most common lineage isolated from adults and adolescents with atopic dermatitis colonized by S. aureus in South Korea [22]. In another epidemiological study in Malaysia, ST188, ST7, and ST1 were all detected among the MRSA isolates from a public hospital [23]. ST7-t091 was the dominant type among isolates from the markets. ST7 has been found among MSSA isolates from slaughter pigs [7] and has been associated with skin and soft tissue infections in China [24]. While ST398 is the most prevalent LA-MRSA type in European countries and North America [25], its prevalence in our study was relatively low. ST239 is identified among hospital-acquired MRSA isolates [26], but was found in our market meat samples and in another study sampling pig farms [27]. Moreover, the ST5 lineage is believed to be the result of a human-to-poultry host jump followed by adaptation and then pandemic spread [28]. However, ST5 was isolated from slaughtered and diseased pigs in our study. In addition, the newly discovered ST types in pig source ST4292, ST4293, ST4294, ST4295, and ST4297 were confirmed to be present at the farm and abattoir stages. Therefore, these results indicate probable cross-contamination between humans and pork, indicating the need for more attention in further studies.
The isolates from diseased pigs were mainly resistant to six to seven classes of antimicrobials with the common resistance pattern being PEN-GEN-TET-CLA-SXT-CLI-CIP. Notably, the diseased pig isolates had a high rate of resistance to penicillin (100%), tetracycline (92.9%), clindamycin (96.4%), clarithromycin (96.4%), and ciprofloxacin (96.4%). Of the isolates from diseased pigs, 85.7% were MDR, which may be the result of intensive and frequent exposure of the pathogens to antibiotics. This high prevalence of MDR isolates may lead to a reduction in the effectiveness of antimicrobial agents used in clinical treatments of humans, including for food-borne diseases. However, different farm sources may explain differences in MLST and spa types in isolates from healthy and diseased pigs. While the ST9-t899 clone was most frequently found in healthy pigs, ST1-t4792 was the most common one in diseased pigs. ST1 isolates are generally community-acquired MRSA [29] and also associated with staphylococcal food poisoning in South Korea and China [30,31]. Therefore, it is essential to continuously monitor the prevalence and resistance of S. aureus in livestock healthy and diseased pigs. Compared with isolates from other sources, isolates from diseased pigs have a higher gene carrying rate of aadE, cmlA, tetM, ermA, ermB, sulI and sulII (p ≤ 0.001) and cmlA was only detected in isolates from diseased pigs. However, we only focused on the characteristics of S. aureus in these samples in the current study. Therefore, we cannot draw a direct conclusion from our research that S. aureus causes clinical disease. To determine which pathogen caused the disease, high-throughput sequencing and clinical experiments are required, like histopathology immunohistochemistry [32] and metagenomics [33,34]. Future research should also elucidate the relationships among phylogenetic and clinical disease of S. aureus and expanding the sample size and sampling range is also necessary.
In our study, we found that cmlA, sulII and dfrA were only detected in diseased pig. The carrying rates were 32.1%, 42.9%, and 10.7%. However, ermC was only detected in healthy pigs. The most common detected gene combinations of the diseased pigs were cmlA + tetM + sulI (23/28), and all the strains that conform to this gene combination are ST1-t4792. However, due to the limited sample size, whether there is a direct link between typing and gene combination requires further study.
It is worth noting that the detection rate of lsa(E) gene in S. aureus isolated from this study was 94.2% (147/156), however in 2014, Yan et al. screened for lsa(E) gene from pigs’ isolates of two abattoirs in Harbin with a detection rate of only 22.0% (44/200). Among the strains isolated from the farm, the positive rate of the multidrug resistance gene cluster (aadE-spc-lsa(E)-lnu(B)-tnp) was 95.5%, and only one strain contained only the lsa(E) gene instead of the gene cluster. The multidrug resistance gene cluster is relatively conservative and is not susceptible to structural changes, which is an important reason for exacerbating the mutual transmission of resistance genes among different species.

4. Materials and Methods

4.1. Sampling

The 666 samples used in the present study were collected from the environment (n = 71), healthy pigs (n = 430) and diseased pigs (n = 165). All samples were collected in Fujian and Guangdong, China between December 2014 and June 2017.
Specifically, for the healthy pig samples, 173 samples were from abattoirs including 133 pork and 40 intestines, 160 were from markets and 97 were nasal swabs from 3 commercial swine farms. In addition, market samples were pork (n = 85), ribs (n = 24) and haslets (n = 51). As for environmental samples, there were pigpen gates (n = 18), soil (n = 20) and ground (n = 33) samples. Healthy pig samples and environmental samples are the same as our previous research [35]. All 165 samples were collected from pork (n = 60), brain (n = 23), and internal organs (n = 82) of diseased pigs. These samples of diseased pigs come from two different farms with symptomatic disease, including diarrhea and respiratory disease. The pork samples were about 250 g, and intestine samples were about 100 g. Sterile swabs were used to collect and preserve the environment and pig nose samples.
However, these terminal samples of meat from the markets did not all originate from the abattoir tested in the present study.

4.2. Bacterial Isolation and Identification

Isolation and identification of S. aureus were performed according to China’s National Technical Standard GB 4789.10-2016. Briefly, the samples were transferred to 7.5% NaCl broth and incubated at 37 °C for 24 h. The broth was then streaked onto Baird-Parker agar plates containing 5% potassium tellurite egg-yolk reagent (Huankai, Guangzhou, China) and incubated at 37 °C for 24–48 h. Presumptive S. aureus colonies were confirmed using plasma coagulase assays and were further screened by PCR amplification of the nuc gene [36]. One S. aureus isolate per sample was further analyzed. MRSA were determined by antibiotic phenotype and confirmed by PCR amplification of mecA using the primers listed in Table A1 (Appendix A).

4.3. Antimicrobial Susceptibility Testing

Antimicrobial susceptibility profile for each isolate was examined using broth microdilution for vancomycin and the disk diffusion method on Mueller-Hinton agar plates for the remaining antibiotics in accordance with current guidelines from the Clinical and Laboratory Standards Institute [37]. The following antimicrobial agents were tested, β-lactams antibiotics, penicillin (PEN, 10 μg), cefalotin (CEP, 30 μg), oxacillin (OXA, 1 μg), cefoxitin (FOX, 30 μg); aminoglycoside antibiotics, gentamicin (GEN, 10 μg); macrolide antibiotics, Clarithromycin (CLA, 15 μg); tetracycline antibiotics, tetracycline (TET, 30 μg), minocycline (MIN, 30 μg); lincosamides antibiotics, clindamycin (CLI, 2 μg); sulfonamides antibiotics, trimethoprim-sulfamethoxazole (SXT, 1.25/23.75 μg, respectively), ansamycin antibiotics, rifampin (RIF, 5 μg), fluoroquinolone antibiotics, ciprofloxacin (CIP, 5 μg), levofloxacin (LEV, 5 μg), moxifloxacin (MXF, 5 μg), gatifloxacin (GAT, 5 μg); oxazolidinone antibiotics, linezolid (LZD, 15 μg), and streptogramin antibiotics, quinupristin-dalfopristin (QDA, 15 μg). S. aureus strain ATCC 29,213 was used as a control. Isolates with intermediate levels of susceptibility were classified as resistant. MDR isolates were defined as having non-susceptibility to at least one agent in three or more antimicrobial categories.

4.4. Screening of Antimicrobial Resistance Genes

Bacterial genomic DNA was extracted from the isolates using a DNA extraction kit (Biomed, Beijing, China). The presence of potential antimicrobial resistance genes were selected according to the tested antimicrobials, and included mecA, mecC, blaZ, aac(6′)/aph(2″), aph(3′)-IIIa, ant(4′)-Ia, aadE, tetK, tetL, tetM, ermA, ermB, emrC, msrA, msrB, catI, cmlA, fexA, dfrG, linA, lnu(B), lsa(E), cfr(B), sulI, sulII. They were assessed by PCR and sequencing using primers listed in Table A1 (Appendix A) for all isolates.

4.5. Molecular Typing

All S. aureus isolates were characterized by multiple locus sequence typing (MLST) and spa typing, where fragments of seven housekeeping genes (arcC, aroE, glpF, gmk, pta, tpi, and yqiL) and the variable repeat region of the spa gene, were amplified by PCR and sequenced [38]. MLST were assigned using the default parameters listed on the MLST home page (http://www.mlst.net/) and spa type were assigned using the Ridom SeqSphere+ software [39].

4.6. Statistical Analyses

The dendrogram of similarity was established by using Jaccard’s coefficient of similarity and the unweighted-pair group method with arithmetic averages (UPMGA), which based on the presence or absence of phenotypic resistance data and selected resistance genes.
All statistical analyses were performed using SPSS 22.0 software. Rates of bacterial antimicrobial resistance were compared among different groups using the chi-squared test, where a p value of < 0.05 was considered statistically significant.

5. Conclusions

In conclusion, 156 S. aureus isolated from 666 samples have been analyzed for genotypic and epidemiology characteristics. The multidrug resistance and diverse resistance patterns observed among the isolates suggest pigs and pork could be important players in S. aureus dissemination. In addition, S. aureus ST9-t899 was found colonizing pigs on the farms. Contamination of a downstream abattoir and retail market with these two types, respectively, revealed S. aureus clones were diverse across the pork production. Further studies are needed to examine additional risk factors for S. aureus colonization or infection that may be attributable to meat slaughtering and handling. This may indicate whether control strategies in the animal production process are feasible and could significantly reduce rates of S. aureus infections and carriage.

Author Contributions

H.Y. designed and supervised the study, received the grants, and responsible for the overall manuscript preparation. X.L. reviewed and revised drafts of the manuscript, and approved the final draft. Y.Z. conducted the experiment, conducted data analysis and wrote the draft of the manuscript. All authors have read and agreed to the published version of the manuscript.

Funding

This research was funded by the National Key Basic Research Program: 2016YFD0500606; Science and Technology Planning Project of Guangdong Province: 2016A020219001; the Central Universities construct the world first-class university (discipline) and Characteristic Development Guidance Special Fund: K5174960 and the 111 Project (B17018).

Conflicts of Interest

The authors declare no conflict of interest.

Appendix A

Table A1. Primers used PCR.
Table A1. Primers used PCR.
GeneForward Primer Sequence (5′-3′)Reverse Primer Sequence (5′-3′)References
mecAGTAGAAATGACTGAACGTCCGATAACCAATTCCACATTGTTTCGGTCTAA[40]
mecCGAAAAAAAGGCTTAGAACGCCTCGAAGATCTTTTCCGTTTTCAGC[41]
aac(6′)/aph(2″)ACATGGCAAGCTCTAGGAGAAGTACGCAGAAGAGA[42]
aph(3′)-IIIaCTTTAAAAAATCATACAGCTCGCGGGCTAAAATGAGAATATCACCGG
ant(4′)-IaGGAAAGTTGACCAGACATTACGAACTCAAACTGCTAAATCGGTAGAAGCC
tetKGTAGCGACAATAGGTAATAGTGTAGTGACAATAAACCTCCTA[43]
tetLTCGTTAGCGTGCTGTCATTCGTATCCCACCAATGTAGCCG[44]
ermAAAGCGGTAAACCCCTCTGATTCGCAAATCCCTTCTCAAC[45]
ermBCATTTAACGACGAAACTGGCGGAACATCTGTGGTATGGCG
emrCATCTTTGAAATCGGCTCAGGCAAACCCGTATTCCACGATT
msrATCCAATCATTGCACAAAATCAATTCCCTCTATTTGGTGGT[46]
msrBTATGATATCCATAATAATTATCCAATCAAGTTATATCATGAATAGATTGTCCTGTT[47]
sulICTTCGATGAGAGCCGGCGGCGCAAGGCGGAAACCCGCGCC[48]
cmlATGTCATTTACGGCATACTCGATCAGGCATCCCATTCCCAT
fexAGTACTTGTAGGTGCAATTACGGCTGACGCATCTGAGTAGGACATAGCGTC[49]
dfrGTGCTGCGATGGATAAGAATGGGCAAATACCTCATTCC[50]
linAGGTGGCTGGGGGGTAGATGTATTAACTGGGCTTCTTTTGAAATACATGGATTTTTCGATC[47]
lnu(B)CCTACCTATTGTTTGTGGAAATAACGTTACTCTCCTATTC[51]
cfr(B)AAAAGCACAACAATCTACACAATCACATGATACAAGTTCCCACT[52]
sulIICGGCATCGTCAACATAACCGTGTGCGGATGAAGTCAG[53]
catIAGTTGCTCAATGTACCTATAACCTTGTAATTCATTAAGCATTCTGCC
blaZACTTCAACACCTGCTGCTTTCTGACCACTTTTATCAGCAACC[54]
tetMAGT GGA GCG ATT ACA GAACAT ATG TCC TGG CGT GTC TA
lsa(E)TTGTACGGAATGTATGGTTCGCTTCTATTAAGCACTCTT[55]
aadEGCAGAACAGGATGAACGTATTCGTTATCCCAACCTTCCACGAC
PCR 1GCAGAACAGGATGAACGTATTCGCCTTTGGTCCCAAAAGGTTA
PCR 2TTGGATTGCAGCATTATTGGATTTGGTCGAAGCCTTGTTG
PCR 3TTCCATAGCTTCGATCTCACCACGTTTTGTTCTCCCACCAA
PCR 4TCCCAAGGAGAAACGAGAACAGTGAGTCAAGACATCAGGAAGCC
Table A2. Multidrug resistance patterns among 156 S. aureus isolates.
Table A2. Multidrug resistance patterns among 156 S. aureus isolates.
Resistance Pattern aNo. of Antimicrobial ClassesNo. of AntimicrobialsNo. of Isolates
Environment (n = 7)Healthy Pigs (n = 121)Disease Pigs
(n = 28)
All
(n = 156)
Farm (n = 22)Abattoir
(n = 62)
Market
(n = 37)
-00001001
PEN1100225128
PEN-TET220092011
PEN-CLA22006006
PEN-CHL22000202
PEN-CLI22003003
PEN-CIP22001001
PEN-CIP-LEV-MXF24000101
PEN-GEN-CLA33001001
PEN-TET-CLA33000202
PEN-TET-CLI33001001
PEN-CLA-CLI-LEV-MXF35001001
PEN-GEN-TET-CLA44000101
PEN-TET-CLA-CLI44000202
PEN-CLA-SXT-CLI44001001
PEN-GEN-CLA-SXT-CLI55002002
PEN-GEN-CLA-CLI-CIP55000011
PEN-TET-CHL-RIF-CLI55000101
PEN-TET-CLA-CHL-CLI55000202
PEN-TET-CLA-CLI-CIP55000404
PEN-FOX-TET-CLA-CHL-CLI56000101
PEN-FOX-TET-CLA-CLI-CIP56000022
PEN-CLA-SXT-CLI-CIP-MXF56100001
PEN-OXA-FOX-TET-CLA-SXT-RIF57000101
PEN-GEN-TET-CHL-RIF-CLI66000101
PEN-GEN-TET-CHL-RIF-CLI66001001
PEN-GEN-TET-CLA-CLI-CIP66000099
PEN-GEN-TET-CLA-SXT-CLI66003003
PEN-TET-CLA-CHL-RIF-CLI66000101
PEN-TET-CLA-SXT-CLI-CIP66000022
PEN-FOX-TET-CHL-RIF-CLI-CIP67000101
PEN-FOX-GEN-TET-CLA-CHL-CLI67000101
PEN-GEN-TET-SXT-CLI-CIP-MXF67010001
PEN-GEN-TET-SXT-CLI-CIP-LEV-MXF68100001
PEN-TET-CLA-CHL-CLI-CIP-LEV-MXF68000101
PEN-TET-CHL-RIF-CLI-CIP-LEV-MXF68000101
PEN-OXA-FOX-GEN-CHL-SXT-CLI-CIP-LEV-MXF610000101
PEN-TET-CLA-CHL-SXT-RIF-CLI77000011
PEN-GEN-TET-CLA-SXT-CLI-CIP77010168
PEN-GEN-TET-CLA-SXT-CLI-CIP-MXF78270009
PEN-OXA-TET-CLA-CHL-SXT-RIF-CLI78000202
PEN-GEN-TET-CLA-SXT-CLI-CIP-LEV-MXF7901000010
PEN-OXA-CEP-TET-CLA-CHL-SXT-RIF-CLI79000202
PEN-CEP-GEN-TET-CLA-SXT-CLI-CIP-LEV-MXF710020002
PEN-FOX-GEN-TET-CLA-SXT-CLI-CIP-LEV-MXF710100001
PEN-GEN-TET-CLA-CHL-SXT-CLI-CIP88002103
PEN-GEN-TET-CLA-SXT-RIF-CLI-CIP-MXF89010001
PEN-FOX-GEN-TET-CLA-CHL-SXT-CLI-CIP89002002
PEN-GEN-TET-CLA-CHL-SXT-CLI-CIP-MXF89001001
PEN-TET-CLA-CHL-SXT-RIF-CLI-CIP-MXF89000101
PEN-GEN-TET-CLA-CHL-SXT-CLI-CIP-LEV-MXF810203005
PEN-FOX-TET-CLA-CHL-SXT-RIF-CLI-CIP-LEV-MXF811001001
PEN-OXA-FOX-GEN-TET-CHL-SXT-RIF-CLI-CIP-MXF811000101
PEN-GEN-TET-CLA-CHL-SXT-RIF-CLI-CIP-LEV-MXF911000101
PEN-OXA-FOX-TET-CLA-CHL-SXT-RIF-CLI-CIP-QDA911000022
PEN-OXA-FOX-TET-CLA-CHL-SXT-RIF-CLI-CIP-MXF-QDA912000011
PEN-OXA-FOX-CEP-GEN-TET-CLA-CHL-SXT-RIF-CLI-CIP-MXF913000101
Combined all above≥3-722193224104
a See the text for abbreviations.

References

  1. Crombé, F.; Argudín, M.A.; Vanderhaeghen, W.; Hermans, K.; Haesebrouck, F.; Butaye, P. Transmission dynamics of methicillin-resistant Staphylococcus aureus in pigs. Front Microbiol. 2013, 4, 57. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  2. Van Belkum, A.; Durand, G.; Peyret, M.; Chatellier, S.; Zambardi, G.; Schrenzel, J.; Shortridge, D.; Engelhardt, A.; Dunne, W.M., Jr. Rapid clinical bacteriology and its future impact. Ann. Lab. Med. 2013, 33, 14–27. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  3. Thammavongsa, V.; Missiakas, D.M.; Schneewind, O. Staphylococcus aureus degrades neutrophil extracellular traps to promote immune cell death. Science 2013, 342, 863–866. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  4. Li, J.; Jiang, N.S.; Ke, Y.B.; Fessler, A.T.; Wang, Y.; Schwarz, S.; Wu, C.M. Characterization of pig-associated methicillin-resistant Staphylococcus aureus. Vet. Microbiol. 2017, 201, 183–187. [Google Scholar] [CrossRef] [PubMed]
  5. Zhou, L.J.; Ying, G.G.; Liu, S.; Zhang, R.Q.; Lai, H.J.; Chen, Z.F.; Pan, C.G. Excretion masses and environmental occurrence of antibiotics in typical swine and dairy cattle farms in China. Sci. Total Environ. 2013, 444, 183–195. [Google Scholar] [CrossRef]
  6. Zhang, Q.Q.; Ying, G.G.; Pan, C.G.; Liu, Y.S.; Zhao, J.L. Comprehensive evaluation of antibiotics emission and fate in the river basins of China: Source analysis, Multimedia modeling, and linkage to bacterial resistance. Environ. Sci. Technol. 2015, 49, 6772–6782. [Google Scholar] [CrossRef] [PubMed]
  7. Yan, X.; Yu, X.; Tao, X.; Zhang, J.; Zhang, B.; Dong, R.; Xue, C.; Grundmann, H.; Zhang, J. Staphylococcus aureus ST398 from slaughter pigs in northeast China. Int. J. Med. Microbiol. IJMM 2014, 304, 379–383. [Google Scholar] [CrossRef]
  8. Tang, Y.; Larsen, J.; Kjeldgaard, J.; Andersen, P.S.; Skov, R.; Ingmer, H. Methicillin-resistant and -susceptible Staphylococcus aureus from retail meat in Denmark. Int. J. Food Microbiol. 2017, 249, 72–76. [Google Scholar] [CrossRef]
  9. Chao, G.; Bao, G.; Jiao, X. Molecular epidemiological characteristics and clonal genetic diversity of Staphylococcus aureus with different origins in China. Foodborne Pathog. Dis. 2014, 11, 503–510. [Google Scholar] [CrossRef]
  10. Cui, S.; Li, J.; Hu, C.; Jin, S.; Li, F.; Guo, Y.; Ran, L.; Ma, Y. Isolation and characterization of methicillin-resistant Staphylococcus aureus from swine and workers in China. J. Antimicrob. Chemother. 2009, 64, 680–683. [Google Scholar] [CrossRef] [Green Version]
  11. Wang, X.; Meng, J.; Zhou, T.; Zhang, Y.; Yang, B.; Xi, M.; Sheng, J.; Zhi, S.; Xia, X. Antimicrobial susceptibility testing and genotypic characterization of Staphylococcus aureus from food and food animals. Foodborne Pathog. Dis. 2012, 9, 95–101. [Google Scholar] [CrossRef] [PubMed]
  12. Ho, P.L.; Chow, K.H.; Lai, E.L.; Law, P.Y.; Chan, P.Y.; Ho, A.Y.; Ng, T.K.; Yam, W.C. Clonality and antimicrobial susceptibility of Staphylococcus aureus and methicillin-resistant S. aureus isolates from food animals and other animals. J. Clin. Microbiol. 2012, 50, 3735–3737. [Google Scholar] [CrossRef] [Green Version]
  13. He, W.; Liu, Y.; Qi, J.; Chen, H.; Zhao, C.; Zhang, F.; Li, H.; Wang, H. Food-animal related Staphylococcus aureus multidrug-resistant ST9 strains with toxin genes. Foodborne Pathog. Dis. 2013, 10, 782–788. [Google Scholar] [CrossRef] [PubMed]
  14. Beneke, B.; Klees, S.; Stührenberg, B.; Fetsch, A.; Kraushaar, B.; Tenhagen, B.A. Prevalence of methicillin-resistant Staphylococcus aureus in a fresh meat pork production chain. J. Food Prot. 2011, 74, 126–129. [Google Scholar] [CrossRef]
  15. Leedom Larson, K.R.; Harper, A.L.; Hanson, B.M.; Male, M.J.; Wardyn, S.E.; Dressler, A.E.; Wagstrom, E.A.; Tendolkar, S.; Diekema, D.J.; Donham, K.J.; et al. Methicillin-resistant Staphylococcus aureus in pork production shower facilities. Appl. Environ. Microbiol. 2011, 77, 696–698. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  16. Normanno, G.; Dambrosio, A.; Lorusso, V.; Samoilis, G.; Di Taranto, P.; Parisi, A. Methicillin-resistant Staphylococcus aureus (MRSA) in slaughtered pigs and abattoir workers in Italy. Food Microbiol. 2015, 51, 51–56. [Google Scholar] [CrossRef]
  17. Fang, H.W.; Chiang, P.H.; Huang, Y.C. Livestock-associated methicillin-resistant Staphylococcus aureus ST9 in pigs and related personnel in Taiwan. PLoS ONE 2014, 9, e88826. [Google Scholar] [CrossRef] [Green Version]
  18. Guardabassi, L.; O’Donoghue, M.; Moodley, A.; Ho, J.; Boost, M. Novel lineage of methicillin-resistant Staphylococcus aureus, Hong Kong. Emerg. Infect. Dis. 2009, 15, 1998–2000. [Google Scholar] [CrossRef]
  19. Neela, V.; Mohd Zafrul, A.; Mariana, N.S.; van Belkum, A.; Liew, Y.K.; Rad, E.G. Prevalence of ST9 methicillin-resistant Staphylococcus aureus among pigs and pig handlers in Malaysia. J. Clin. Microbiol. 2009, 47, 4138–4140. [Google Scholar] [CrossRef] [Green Version]
  20. Vestergaard, M.; Cavaco, L.M.; Sirichote, P.; Unahalekhaka, A.; Dangsakul, W.; Svendsen, C.A.; Aarestrup, F.M.; Hendriksen, R.S. SCCmec type IX element in methicillin resistant Staphylococcus aureus spa type t337 (CC9) isolated from pigs and pork in Thailand. Front Microbiol. 2012, 3, 103. [Google Scholar] [CrossRef] [Green Version]
  21. Liu, Y.; Wang, H.; Du, N.; Shen, E.; Chen, H.; Niu, J.; Ye, H.; Chen, M. Molecular evidence for spread of two major methicillin-resistant Staphylococcus aureus clones with a unique geographic distribution in Chinese hospitals. Antimicrob. Agents Chemother. 2009, 53, 512–518. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  22. Kim, D.W.; Park, J.Y.; Park, K.D.; Kim, T.H.; Lee, W.J.; Lee, S.J.; Kim, J. Are there predominant strains and toxins of Staphylococcus aureus in atopic dermatitis patients? Genotypic characterization and toxin determination of S. aureus isolated in adolescent and adult patients with atopic dermatitis. J. Dermatol. 2009, 36, 75–81. [Google Scholar] [CrossRef] [PubMed]
  23. Ghaznavi-Rad, E.; Goering, R.V.; Nor Shamsudin, M.; Weng, P.L.; Sekawi, Z.; Tavakol, M.; van Belkum, A.; Neela, V. Mec-associated dru typing in the epidemiological analysis of ST239 MRSA in Malaysia. Eur. J. Clin. Microbiol. Infect. Dis. Off. Publ. Eur. Soc. Clin. Microbiol. 2011, 30, 1365–1369. [Google Scholar] [CrossRef] [PubMed]
  24. Yao, D.; Yu, F.Y.; Qin, Z.Q.; Chen, C.; He, S.S.; Chen, Z.Q.; Zhang, X.Q.; Wang, L.X. Molecular characterization of Staphylococcus aureus isolates causing skin and soft tissue infections (SSTIs). BMC Infect. Dis. 2010, 10, 133. [Google Scholar] [CrossRef] [Green Version]
  25. Chuang, Y.Y.; Huang, Y.C. Livestock-associated meticillin-resistant Staphylococcus aureus in Asia. An emerging issue? Int. J. Antimicrob. Agents 2015, 45, 334–340. [Google Scholar] [CrossRef]
  26. Lakhundi, S.; Zhang, K. Methicillin-resistant Staphylococcus aureus. molecular characterization, evolution, and epidemiology. Clin. Microbiol. Rev. 2018, 31, e00020-18. [Google Scholar] [CrossRef] [Green Version]
  27. Peeters, L.E.; Argudín, M.A.; Azadikhah, S.; Butaye, P. Antimicrobial resistance and population structure of Staphylococcus aureus recovered from pigs farms. Vet. Microbiol. 2015, 180, 151–156. [Google Scholar] [CrossRef]
  28. Lowder, B.V.; Guinane, C.M.; Ben Zakour, N.L.; Weinert, L.A.; Conway-Morris, A.; Cartwright, R.A.; Simpson, A.J.; Rambaut, A.; Nübel, U.; Fitzgerald, J.R. Recent human-to-poultry host jump, adaptation, and pandemic spread of Staphylococcus aureus. Proc. Natl. Acad. Sci. USA 2009, 106, 19545–19550. [Google Scholar] [CrossRef] [Green Version]
  29. David, M.Z.; Daum, R.S. Community-associated methicillin-resistant Staphylococcus aureus epidemiology and clinical consequences of an emerging epidemic. Clin. Microbiol. Rev. 2010, 23, 616–687. [Google Scholar] [CrossRef] [Green Version]
  30. Cha, J.O.; Lee, J.K.; Jung, Y.H.; Yoo, J.I.; Park, Y.K.; Kim, B.S.; Lee, Y.S. Molecular analysis of Staphylococcus aureus isolates associated with staphylococcal food poisoning in South Korea. J. Appl. Microbiol. 2006, 101, 864–871. [Google Scholar] [CrossRef]
  31. Yan, X.; Wang, B.; Tao, X.; Hu, Q.; Cui, Z.; Zhang, J.; Lin, Y.; You, Y.; Shi, X.; Grundmann, H. Characterization of Staphylococcus aureus strains associated with food poisoning in Shenzhen, China. Appl. Environ. Microbiol. 2012, 78, 6637–6642. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  32. Guedes, R.M.C.; Gebhart, C.J. Comparison of intestinal mucosa homogenate and pure culture of the homologous Lawsonia intracellularis isolate in reproducing proliferative enteropathy in swine. Vet. Microbiol. 2003, 93, 159–166. [Google Scholar] [CrossRef]
  33. Zhang, B.; Tang, C.; Yue, H.; Ren, Y.; Song, Z. Viral metagenomics analysis demonstrates the diversity of viral flora in piglet diarrhoeic faeces in China. J. Gen. Virol. 2014, 95, 1603–1611. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  34. Qin, S.N.; Ruan, W.Q.; Yue, H.; Tang, C.; Zhou, K.L.; Zhang, B. Viral communities associated with porcine respiratory disease complex in intensive commercial farms in Sichuan province, China. Sci. Rep. 2018, 8, 13341. [Google Scholar] [CrossRef] [PubMed]
  35. Zhang, Y.; Wang, Y.; Cai, R.; Shi, L.; Li, C.; Yan, H. Prevalence of enterotoxin genes in Staphylococcus aureus isolates from pork production. Foodborne Pathog. Dis. 2018, 15, 437–443. [Google Scholar] [CrossRef]
  36. Brakstad, O.G.; Aasbakk, K.; Maeland, J.A. Detection of Staphylococcus aureus by polymerase chain reaction amplification of the nuc gene. J. Clin. Microbiol. 1992, 30, 1654–1660. [Google Scholar] [CrossRef] [Green Version]
  37. Zhou, W.; Li, X.; Shi, L.; Wang, H.H.; Yan, H. Novel SCCmec type XII methicillin-resistant Staphylococcus aureus isolates identified from a swine production and processing chain. Vet. Microbiol. 2018, 225, 105–113. [Google Scholar] [CrossRef]
  38. Chen, X.; Wang, W.K.; Han, L.Z.; Liu, Y.; Zhang, H.; Tang, J.; Liu, Q.Z.; Huangfu, Y.C.; Ni, Y.X. Epidemiological and genetic diversity of Staphylococcus aureus causing bloodstream infection in Shanghai, 2009–2011. PLoS ONE 2013, 8, e72811. [Google Scholar] [CrossRef]
  39. Harmsen, D.; Claus, H.; Witte, W.; Rothganger, J.; Claus, H.; Turnwald, D.; Vogel, U. Typing of methicillin-resistant Staphylococcus aureus in a university hospital setting by using novel software for spa repeat determination and database management. J. Clin. Microbiol. 2003, 41, 5442–5448. [Google Scholar] [CrossRef] [Green Version]
  40. Zhang, K.; Sparling, J.; Chow, B.L.; Elsayed, S.; Hussain, Z.; Church, D.L.; Gregson, D.B.; Louie, T.; Conly, J.M. New quadriplex PCR assay for detection of methicillin and mupirocin resistance and simultaneous discrimination of Staphylococcus aureus from coagulase-negative Staphylococci. J. Clin. Microbiol. 2004, 42, 4947–4955. [Google Scholar] [CrossRef] [Green Version]
  41. Stegger, M.; Andersen, P.S.; Kearns, A.; Pichon, B.; Holmes, M.A.; Edwards, G.; Laurent, F.; Teale, C.; Skov, R.; Larsen, A.R. Rapid detection, differentiation and typing of methicillin-resistant Staphylococcus aureus harbouring either mecA or the new mecA homologue mecA(LGA251). Clin. Microbiol. Infect. Off. Publ. Eur. Soc. Clin. Microbiol. Infect. Dis. 2012, 18, 395–400. [Google Scholar]
  42. Vakulenko, S.B.; Donabedian, S.M.; Voskresenskiy, A.M.; Zervos, M.J.; Lerner, S.A.; Chow, J.W. Multiplex PCR for detection of aminoglycoside resistance genes in Enterococci. Antimicrob. Agents Chemother. 2003, 47, 1423–1426. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  43. Strommenger, B.; Kettlitz, C.; Werner, G.; Witte, W. Multiplex PCR assay for simultaneous detection of nine clinically relevant antibiotic resistance genes in Staphylococcus aureus. J. Clin. Microbiol. 2003, 41, 4089–4094. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  44. Ng, L.K.; Martin, I.; Alfa, M.; Mulvey, M. Multiplex PCR for the detection of tetracycline resistant genes. Mol. Cell. Probes 2001, 15, 209–215. [Google Scholar] [CrossRef] [PubMed]
  45. Sutcliffe, J.; Grebe, T.; Tait-Kamradt, A.; Wondrack, L. Detection of erythromycin-resistant determinants by PCR. Antimicrob. Agents Chemother. 1996, 40, 2562–2566. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  46. Martineau, F.; Picard, F.J.; Lansac, N.; Ménard, C.; Roy, P.H.; Ouellette, M.; Bergeron, M.G. Correlation between the resistance genotype determined by multiplex PCR assays and the antibiotic susceptibility patterns of Staphylococcus aureus and Staphylococcus epidermidis. Antimicrob. Agents Chemother. 2000, 44, 231–238. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  47. Lina, G.; Quaglia, A.; Reverdy, M.E.; Leclercq, R.; Vandenesch, F.; Etienne, J. Distribution of genes encoding resistance to macrolides, lincosamides, and streptogramins among Staphylococci. Antimicrob. Agents Chemother. 1999, 43, 1062–1066. [Google Scholar] [CrossRef] [Green Version]
  48. Guerra, B.; Soto, S.M.; Argüelles, J.M.; Mendoza, M.C. Multidrug resistance is mediated by large plasmids carrying a class 1 integron in the emergent Salmonella enterica serotype [4,5,12.i.-]. Antimicrob Agents Chemother. 2001, 45, 1305–1308. [Google Scholar] [CrossRef] [Green Version]
  49. Kehrenberg, C.; Schwarz, S. Florfenicol-chloramphenicol exporter gene fexA is part of the novel transposon Tn558. Antimicrob. Agents Chemother. 2005, 49, 813–815. [Google Scholar] [CrossRef] [Green Version]
  50. Argudín, M.A.; Tenhagen, B.A.; Fetsch, A.; Sachsenröder, J.; Käsbohrer, A.; Schroeter, A.; Hammerl, J.A.; Hertwig, S.; Helmuth, R.; Bräunig, J.; et al. Virulence and resistance determinants of German Staphylococcus aureus ST398 isolates from nonhuman sources. Appl. Environ. Microbiol. 2011, 77, 3052–3060. [Google Scholar] [CrossRef] [Green Version]
  51. Bozdogan, B.; Berrezouga, L.; Kuo, M.S.; Yurek, D.A.; Farley, K.A.; Stockman, B.J.; Leclercq, R. A new resistance gene, linB, conferring resistance to lincosamides by nucleotidylation in Enterococcus faecium HM1025. Antimicrob. Agents Chemother. 1999, 43, 925–929. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  52. Deshpande, L.M.; Ashcraft, D.S.; Kahn, H.P.; Pankey, G.; Jones, R.N.; Farrell, D.J.; Mendes, R.E. Detection of a New cfr-Like Gene, cfr(B), in Enterococcus faecium isolates recovered from human specimens in the United States as part of the sentry antimicrobial surveillance program. Antimicrob. Agents Chemother. 2015, 59, 6256–6261. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  53. Liu, Z.B.; Zhang, Z.G.; Yan, H.; Li, J.R.; Shi, L. Isolation and Molecular Characterization of Multidrug-Resistant Enterobacteriaceae Strains from Pork and Environmental Samples in Xiamen, China. J. Food Prot. 2015, 78, 78–88. [Google Scholar] [CrossRef] [PubMed]
  54. Duran, N.; Ozer, B.; Duran, G.G.; Onlen, Y.; Demir, C. Antibiotic resistance genes & susceptibility patterns in staphylococci. Indian J. Med. Res. 2012, 135, 389–396. [Google Scholar]
  55. Li, B.; Wendlandt, S.; Yao, J.; Liu, Y.; Zhang, Q.; Shi, Z.; Wei, J.; Shao, D.; Schwarz, S.; Wang, S.; et al. Detection and new genetic environment of the pleuromutilin-lincosamide-streptogramin A resistance gene lsa(E) in methicillin-resistant Staphylococcus aureus of swine origin. J. Antimicrob. Chemother. 2013, 68, 1251–1255. [Google Scholar] [CrossRef] [Green Version]
Figure 1. Occurrence of S. aureus isolate resistance to antimicrobials based on isolate source. *** p < 0.001; PEN, penicillin, CEP, cephalothin, OXA, oxacillin, FOX, efoxitin, GEN, gentamicin, CHL, chloramphenicol, TET, tetracycline, MIN, minocycline, CLI, clindamycin, CLA, clarithromycin, SXT, trimethoprim-sulfamethoxazole, RIF, rifampicin, CIP, ciprofloxacin, LEV, levofloxacin, MXF, moxifloxacin and QDA, quinupristin-dalfopristin.
Figure 1. Occurrence of S. aureus isolate resistance to antimicrobials based on isolate source. *** p < 0.001; PEN, penicillin, CEP, cephalothin, OXA, oxacillin, FOX, efoxitin, GEN, gentamicin, CHL, chloramphenicol, TET, tetracycline, MIN, minocycline, CLI, clindamycin, CLA, clarithromycin, SXT, trimethoprim-sulfamethoxazole, RIF, rifampicin, CIP, ciprofloxacin, LEV, levofloxacin, MXF, moxifloxacin and QDA, quinupristin-dalfopristin.
Antibiotics 09 00839 g001
Figure 2. Dendrogram showing the resistance phenotypes and genotypes of S. aureus isolated from the pork production. The dendrogram was established based on the presence and absence of selected determinants or phenotypes using Jaccard’s coefficient of similarity and the unweighted-pair group method with arithmetic averages (UPMGA).
Figure 2. Dendrogram showing the resistance phenotypes and genotypes of S. aureus isolated from the pork production. The dendrogram was established based on the presence and absence of selected determinants or phenotypes using Jaccard’s coefficient of similarity and the unweighted-pair group method with arithmetic averages (UPMGA).
Antibiotics 09 00839 g002
Table 1. Occurrence of S. aureus and MRSA in pork production.
Table 1. Occurrence of S. aureus and MRSA in pork production.
SourceNo. of SamplesNo. (%) of Positive Samples
S. aureus Including MRSA ***MRSA *
Healthy pigsFarm9722 (22.7)0 (0)
Abattoir17362 (35.8)9 (5.2)
Market16037 (23.1)10 (6.3)
Environment717 (9.9)2 (2.8)
Diseased pigs16528 (17.0)3 (1.8)
All666156 (23.4)24 (3.6)
Rates of positive samples were compared among different groups using the chi-squared test, * p < 0.05 and *** p < 0.001.
Table 2. Prevalence of antibiotic resistance associated genes among S. aureus isolates.
Table 2. Prevalence of antibiotic resistance associated genes among S. aureus isolates.
AntibioticsResistance
Genes
No. (%) of Positive Isolates
Environment
(n = 7)
Healthy Pigs (n = 121)Disease Pigs
(n = 28)
All
(n = 156)
Farm
(n = 22)
Abattoir
(n = 62)
Market
(n = 37)
PenicillinmecA2 (28.6)0 (0)9 (14.5)10 (27.0)3 (10.7)24 (15.4)
blaZ7 (100)22 (100)62 (100)37 (100)28 (100)156 (100)
Gentamycinant(4′)-Ia7 (100)22 (100)53 (85.5)28 (75.7)9 (32.1)119 (76.3)
aadE6 (85.7)21 (95.5)48 (77.4)14 (37.8)27 (96.4)116 (74.4)
aacA-aphD7 (100)22 (100)58 (93.5)28 (75.7)28 (100)143 (91.7)
aac(6′)/aph(2”)5 (71.4)21 (95.5)35 (56.5)22 (59.5)3 (10.7)86 (55.1)
ChloramphenicolfexA0 (0)1 (4.5)25 (40.3)9 (24.3)4 (14.3)39 (25.0)
catI3 (42.9)18 (81.8)51 (82.3)32 (86.5)13 (46.4)117 (75.0)
cmlA0 (0)0 (0)0(0)0 (0)9 (32.1)9 (5.8)
TetracyclinetetK6 (85.7)21 (95.5)51 (82.3)32 (86.5)13 (46.4)123 (78.8)
TetracyclinetetM0 (0)0 (0)1 (1.6)6 (16.2)19 (67.9)26 (16.7)
tetL6 (85.7)22 (100)53 (85.5)19 (51.4)27 (96.4)127 (81.4)
ClindamycinlinA0 (0)0 (0)2 (3.2)17 (45.9)0 (0)19 (12.2)
lnu(B)7 (100)22 (100)39 (62.9)5 (13.5)28 (100)101 (64.7)
quinupristin-dalfopristinlsa(E)7 (100)22 (100)58(93.5)33 (89.2)27(96.4)147 (94.2)
ClarithromycinermA0 (0)0 (0)1 (1.6)2 (5.4)24 (85.7)27 (17.3)
ermB1 (14.3)4 (18.2)5 (8.1)5 (13.5)24 (85.7)39 (25.0)
ermC0 (0)2 (9.1)1 (1.6)0 (0)0 (0)3 (1.9)
Trimethoprim-sulfamethoxazolesulI0(0)2 (9.1)4 (6.5)5 (13.5)25 (89.3)36 (23.1)
sulII0 (0)0 (0)0 (0)1 (2.7)12 (42.9)13 (8.3)
dfrA0 (0)0 (0)0 (0)10 (27.0)3 (10.7)13 (8.3)
dfrG6 (85.7)22 (100)42 (67.7)17 (45.9)7 (25.0)94 (60.3)
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Share and Cite

MDPI and ACS Style

Zhou, Y.; Li, X.; Yan, H. Genotypic Characteristics and Correlation of Epidemiology of Staphylococcus aureus in Healthy Pigs, Diseased Pigs, and Environment. Antibiotics 2020, 9, 839. https://doi.org/10.3390/antibiotics9120839

AMA Style

Zhou Y, Li X, Yan H. Genotypic Characteristics and Correlation of Epidemiology of Staphylococcus aureus in Healthy Pigs, Diseased Pigs, and Environment. Antibiotics. 2020; 9(12):839. https://doi.org/10.3390/antibiotics9120839

Chicago/Turabian Style

Zhou, Yuanyuan, Xinhui Li, and He Yan. 2020. "Genotypic Characteristics and Correlation of Epidemiology of Staphylococcus aureus in Healthy Pigs, Diseased Pigs, and Environment" Antibiotics 9, no. 12: 839. https://doi.org/10.3390/antibiotics9120839

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop