Extended Spectrum Beta-Lactamase-Resistant Determinants among Carbapenem-Resistant Enterobacteriaceae from Beef Cattle in the North West Province, South Africa: A Critical Assessment of Their Possible Public Health Implications
Abstract
1. Introduction
2. Results
2.1. Enterobacteriaceae Isolated from Cattle Faeces
2.2. Carbapenem Resistance Isolates
2.3. Antimicrobial Resistance Profile of CRE
2.4. Molecular Identification of CRE Species
2.5. Detection of Genes Encoding Carbapenemases in CRE
2.6. Detection of ESBL Determinants in CRE
3. Discussion
4. Materials and Methods
4.1. Ethical Consideration
4.2. Study Area, Sample Collection and Processing
4.3. Culture-Based Methods for Identification of Carbapenem Resistance Enterobacteriaceae Colonies
4.4. Phenotypic Screening for Identification of ESBL-Producing Enterobacteriaceae
4.5. Antimicrobial Susceptibility Test
4.6. DNA Extraction from CRE Isolates
4.7. Genus-Specific Identification of CRE Isolates
4.8. Detection of Carbapenemase-Encoding Genes Using Multiplex PCR
4.9. Detection of Extended Spectrum Beta-Lactamase-Encoding Genes in CRE
4.10. Agarose Gel Electrophoresis and Visualization
4.11. Statistical Analysis
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Conflicts of Interest
References
- Pitout, J.D.D.; Nordmann, P.; Poirel, L. Carbapenemase-Producing Klebsiella pneumoniae, a Key Pathogen Set for Global Nosocomial Dominance. Antimicrob. Agents Chemother. 2015, 59, 5873–5884. [Google Scholar] [CrossRef] [PubMed]
- Suay-Garcia, B.; Pérez-Gracia, M.T. Present and Future of Carbapenem-resistant Enterobacteriaceae (CRE) Infections. Antibiotics 2019, 8, 122. [Google Scholar] [CrossRef] [PubMed]
- Bartsch, S.; McKinnell, J.; Mueller, L.; Miller, L.; Gohil, S.; Huang, S.; Lee, B.Y. Potential economic burden of carbapenem-resistant Enterobacteriaceae (CRE) in the United States. Clin. Microbiol. Infect. 2017, 23, 48.e9–48.e16. [Google Scholar] [CrossRef] [PubMed]
- Antibiotic Resistance Threats in the United States. 2013. Available online: https://www.cdc.gov/drugresistance/pdf/ar-threats-2013-508.pdf (accessed on 28 September 2020).
- Ballot, D.E.; Bandini, R.; Nana, T.; Bosman, N.; Thomas, T.; Davies, V.A.; Cooper, P.A.; Mer, M.; Lipman, J. A review of -multidrug-resistant Enterobacteriaceae in a neonatal unit in Johannesburg, South Africa. BMC Pediatr. 2019, 19, 320. [Google Scholar] [CrossRef]
- Ramsamy, Y.; Mlisana, K.; Allam, M.; Amoako, D.G.; Abia, A.L.K.; Ismail, A.; Singh, R.; Kisten, T.; Han, K.S.S.; Muckart, D.J.J.; et al. Genomic Analysis of Carbapenemase-Producing Extensively Drug-Resistant Klebsiella pneumoniae Isolates Reveals the Horizontal Spread of p18-43_01 Plasmid Encoding blaNDM-1 in South Africa. Microorganisms 2020, 8, 137. [Google Scholar] [CrossRef]
- Boutal, H.; Vogel, A.; Bernabeu, S.; Devilliers, K.; Creton, E.; Cotellon, G.; Plaisance, M.; Oueslati, S.; Dortet, L.; Jousset, A.; et al. A multiplex lateral flow immunoassay for the rapid identification of NDM-, KPC-, IMP- and VIM-type and OXA-48-like carbapenemase-producing Enterobacteriaceae. J. Antimicrob. Chemother. 2018, 73, 909–915. [Google Scholar] [CrossRef]
- Fernández, J.; Guerra, B.; Rodicio, M.R. Resistance to Carbapenems in Non-Typhoidal Salmonella enterica Serovars from Humans, Animals and Food. Vet. Sci. 2018, 5, 40. [Google Scholar] [CrossRef]
- Solgi, H.; Nematzadeh, S.; Giske, C.G.; Badmasti, F.; Westerlund, F.; Lin, Y.-L.; Goyal, G.; Nikbin, V.S.; Nemati, A.H.; Shahcheraghi, F. Molecular Epidemiology of OXA-48 and NDM-1 Producing Enterobacterales Species at a University Hospital in Tehran, Iran, Between 2015 and 2016. Front. Microbiol. 2020, 11, 936. [Google Scholar] [CrossRef]
- Teixeira, P.; Tacão, M.; Pureza, L.; Gonçalves, J.; Silva, A.; Cruz-Schneider, M.P.; Henriques, I. Occurrence of carbapenemase-producing Enterobacteriaceae in a Portuguese river: blaNDM, blaKPC and blaGES among the detected genes. Environ. Pollut. 2020, 260, 113913. [Google Scholar] [CrossRef]
- Li, M.; Guo, M.; Chen, L.; Zhu, C.; Xiao, Y.; Li, P.; Guo, H.; Chen, L.; Zhang, W.; Du, H. Isolation and Characterization of Novel Lytic Bacteriophages Infecting Epidemic Carbapenem-Resistant Klebsiella pneumoniae Strains. Front. Microbiol. 2020, 11, 1554. [Google Scholar] [CrossRef]
- Shrivastava, S.R.; Shrivastava, P.S.; Ramasamy, J. World health organization releases global priority list of antibiotic-resistant bacteria to guide research, discovery, and development of new antibiotics. J. Med Soc. 2018, 32, 76. [Google Scholar] [CrossRef]
- Zhen, X.; Lundborg, C.S.; Sun, X.; Hu, X.; Dong, H. Economic burden of antibiotic resistance in ESKAPE organisms: A systematic review. Antimicrob. Resist. Infect. Control. 2019, 8, 1–23. [Google Scholar] [CrossRef] [PubMed]
- Han, R.; Shi, Q.; Wu, S.; Yin, D.; Peng, M.; Dong, D.; Zheng, Y.; Guo, Y.; Zhang, R.; Hu, F.; et al. Dissemination of Carbapenemases (KPC, NDM, OXA-48, IMP, and VIM) Among Carbapenem-Resistant Enterobacteriaceae Isolated From Adult and Children Patients in China. Front. Cell. Infect. Microbiol. 2020, 10, 314. [Google Scholar] [CrossRef] [PubMed]
- Gazin, M.; Paasch, F.; Goossens, H.; Malhotra-Kumar, S. Current Trends in Culture-Based and Molecular Detection of Extended-Spectrum- -Lactamase-Harboring and Carbapenem-Resistant Enterobacteriaceae. J. Clin. Microbiol. 2012, 50, 1140–1146. [Google Scholar] [CrossRef]
- Ben Said, L.; Jouini, A.; Klibi, N.; Dziri, R.; Alonso, C.A.; Boudabous, A.; Ben Slama, K.; Torres, C. Detection of extended-spectrum beta-lactamase (ESBL)-producing Enterobacteriaceae in vegetables, soil and water of the farm environment in Tunisia. Int. J. Food Microbiol. 2015, 203, 86–92. [Google Scholar] [CrossRef]
- Köck, R.; Daniels-Haardt, I.; Becker, K.; Mellmann, A.; Friedrich, A.W.; Mevius, D.; Schwarz, S.; Jurke, A. Carbapenem-resistant Enterobacteriaceae in wildlife, food-producing, and companion animals: A systematic review. Clin. Microbiol. Infect. 2018, 24, 1241–1250. [Google Scholar] [CrossRef]
- Zhang, W.; Zhu, Y.; Wang, C.; Liu, W.; Li, R.; Chen, F.; Luan, T.; Zhang, Y.; Schwarz, S.; Liu, S. Characterization of a Multidrug-Resistant Porcine Klebsiella pneumoniae Sequence Type 11 Strain Coharboring blaKPC-2 and fosA3 on Two Novel Hybrid Plasmids. mSphere 2019, 4, 00590-19. [Google Scholar] [CrossRef]
- Gondal, A.J.; Saleem, S.; Jahan, S.; Choudhry, N.; Yasmin, N. Novel Carbapenem-Resistant Klebsiella pneumoniae ST147 Coharboring blaNDM-1, blaOXA-48 and Extended-Spectrum β-Lactamases from Pakistan. Infect. Drug Resist. 2020, 13, 2105–2115. [Google Scholar] [CrossRef]
- CLSI. Performance Standards for Antimicrobial Susceptibility Testing, 28th ed.; Supplement M100; Clinical and Laboratory Standards Institute: Wayne, PA, USA, 2018. [Google Scholar]
- Kanj, S.S.; Kanafani, Z.A. Current Concepts in Antimicrobial Therapy Against Resistant Gram-Negative Organisms: Extended-Spectrum β-Lactamase–Producing Enterobacteriaceae, Carbapenem-Resistant Enterobacteriaceae, and Multidrug-Resistant Pseudomonas aeruginosa. Mayo Clin. Proc 2011, 86, 250–259. [Google Scholar] [CrossRef]
- Potter, R.F.; D’Souza, A.W.; Dantas, G. The rapid spread of carbapenem-resistant Enterobacteriaceae. Drug Resist. Updates 2016, 29, 30–46. [Google Scholar] [CrossRef]
- Mills, M.C.; Lee, J. The threat of carbapenem-resistant bacteria in the environment: Evidence of widespread contamination of reservoirs at a global scale. Environ. Pollut. 2019, 255, 113143. [Google Scholar] [CrossRef] [PubMed]
- Ateba, C.N.; Bezuidenhout, C. Characterisation of Escherichia coli O157 strains from humans, cattle and pigs in the North-West Province, South Africa. Int. J. Food Microbiol. 2008, 128, 181–188. [Google Scholar] [CrossRef] [PubMed]
- Dlamini, B.S.; Montso, P.K.; Kumar, A.; Ateba, C.N. Distribution of virulence factors, determinants of antibiotic resistance and molecular fingerprinting of Salmonella species isolated from cattle and beef samples: Suggestive evidence of animal-to-meat contamination. Environ. Sci. Pollut. Res. 2018, 25, 32694–32708. [Google Scholar] [CrossRef] [PubMed]
- Montso, K.P.; Dlamini, S.B.; Kumar, A.; Ateba, C.N. Antimicrobial Resistance Factors of Extended-Spectrum Beta-Lactamases Producing Escherichia coli and Klebsiella pneumoniae Isolated from Cattle Farms and Raw Beef in North-West Province, South Africa. BioMed Res. Int. 2019, 2019, 1–13. [Google Scholar] [CrossRef] [PubMed]
- Richter, L.; Du Plessis, E.M.; Duvenage, S.; Korsten, L. Occurrence, Identification, and Antimicrobial Resistance Profiles of Extended-Spectrum and AmpC β-Lactamase-Producing Enterobacteriaceae from Fresh Vegetables Retailed in Gauteng Province, South Africa. Foodborne Pathog. Dis. 2019, 16, 421–427. [Google Scholar] [CrossRef]
- Magiorakos, A.-P.; Srinivasan, A.; Carey, R.; Carmeli, Y.; Falagas, M.; Giske, C.; Harbarth, S.J.; Hindler, J.; Kahlmeter, G.; Olsson-Liljequist, B.; et al. Multidrug-resistant, extensively drug-resistant and pandrug-resistant bacteria: An international expert proposal for interim standard definitions for acquired resistance. Clin. Microbiol. Infect. 2012, 18, 268–281. [Google Scholar] [CrossRef]
- Fadare, F.T.; Adefisoye, M.A.; Okoh, A.I. Occurrence, identification and antibiogram signatures of selected Enterobacteriaceae from Tsomo and Tyhume rivers in the Eastern Cape Province, Republic of South Africa. bioRxiv 2020, 2–46. [Google Scholar] [CrossRef]
- Krumperman, P.H. Multiple antibiotic resistance indexing of Escherichia coli to identify high-risk sources of faecal contamination of foods. Appl. Environ. Microbiol. 1983, 46, 165–170. [Google Scholar] [CrossRef]
- Ahmed, H.A.; El Bayomi, R.M.; Hussein, M.A.; Khedr, M.H.; Remela, E.M.A.; El-Ashram, A.M. Molecular characterization, antibiotic resistance pattern and biofilm formation of Vibrio parahaemolyticus and V. cholerae isolated from crustaceans and humans. Int. J. Food Microbiol. 2018, 274, 31–37. [Google Scholar] [CrossRef]
- Sheu, C.-C.; Chang, Y.-T.; Lin, S.-Y.; Chen, Y.-H.; Hsueh, P.-R. Infections Caused by Carbapenem-Resistant Enterobacteriaceae: An Update on Therapeutic Options. Front. Microbiol. 2019, 10, 80. [Google Scholar] [CrossRef]
- Liu, B.-T.; Zhang, X.-Y.; Wan, S.-W.; Hao, J.-J.; Jiang, R.-D.; Song, F.-J. Characteristics of Carbapenem-Resistant Enterobacteriaceae in Ready-to-Eat Vegetables in China. Front. Microbiol. 2018, 9, 1147. [Google Scholar] [CrossRef]
- Perovic, O.; Germs-Sa, F.; Ismail, H.; Quan, V.; Bamford, C.; Nana, T.; Chibabhai, V.; Bhola, P.; Ramjathan, P.; Swe-Han, K.S.; et al. Carbapenem-resistant Enterobacteriaceae in patients with bacteraemia at tertiary hospitals in South Africa, 2015 to 2018. Eur. J. Clin. Microbiol. Infect. Dis. 2020, 39, 1287–1294. [Google Scholar] [CrossRef]
- Grundmann, H.; Glasner, C.; Albiger, B.; Aanensen, D.M.; Tomlinson, C.T.; Andrasević, A.T.; Cantón, R.; Carmeli, Y.; Friedrich, A.W.; Giske, C.G.; et al. Occurrence of carbapenemase-producing Klebsiella pneumoniae and Escherichia coli in the European survey of carbapenemase-producing Enterobacteriaceae (EuSCAPE): A prospective, multinational study. Lancet Infect. Dis. 2017, 17, 153–163. [Google Scholar] [CrossRef]
- Bleichenbacher, S.; Stevens, M.J.; Zurfluh, K.; Perreten, V.; Endimiani, A.; Stephan, R.; Nüesch-Inderbinen, M. Environmental dissemination of carbapenemase-producing Enterobacteriaceae in rivers in Switzerland. Environ. Pollut. 2020, 265, 115081. [Google Scholar] [CrossRef] [PubMed]
- Braun, S.D.; Ahmed, M.F.E.; El-Adawy, H.; Hotzel, H.; Engelmann, I.; Weiß, D.; Monecke, S.; Ehricht, R. Surveillance of Extended-Spectrum Beta-Lactamase-Producing Escherichia coli in Dairy Cattle Farms in the Nile Delta, Egypt. Front. Microbiol. 2016, 7, 1020. [Google Scholar] [CrossRef] [PubMed]
- Bradford, P.A. Extended-Spectrum β-Lactamases in the 21st Century: Characterization, Epidemiology, and Detection of This Important Resistance Threat. Clin. Microbiol. Rev. 2001, 14, 933–951. [Google Scholar] [CrossRef] [PubMed]
- Peirano, G.; Pitout, J.D. Extended-Spectrum β-Lactamase-Producing Enterobacteriaceae: Update on Molecular Epidemiology and Treatment Options. Drugs 2019, 79, 1529–1541. [Google Scholar] [CrossRef]
- Ahmed, A.M.; Shimamoto, T. Molecular analysis of multidrug resistance in Shiga toxin-producing Escherichia coli O157:H7 isolated from meat and dairy products. Int. J. Food Microbiol. 2015, 193, 68–73. [Google Scholar] [CrossRef]
- Das, L.; Borah, P.; Sharma, R.; Malakar, D.; Saikia, G.K.; Tamuly, S.; Dutta, R.; Sharma, K. Phenotypic and molecular characterization of extended spectrum β-lactamase producing Escherichia coli and Klebsiella pneumoniae isolates from various samples of animal origin from Assam, India. bioRxiv 2020, 1–22. [Google Scholar] [CrossRef]
- Geser, N.; Stephan, R.; Hächler, H. Occurrence and characteristics of extended-spectrum β-lactamase (ESBL) producing Enterobacteriaceae in food producing animals, minced meat and raw milk. BMC Vet. Res. 2012, 8, 21. [Google Scholar] [CrossRef]
- Adator, E.H.; Narvaez-Bravo, C.; Zaheer, R.; Cook, S.R.; Tymensen, L.; Hannon, S.J.; Booker, C.W.; Church, D.L.; Read, R.R.; McAllister, T.A. A One Health Comparative Assessment of Antimicrobial Resistance in Generic and Extended-Spectrum Cephalosporin-Resistant Escherichia coli from Beef Production, Sewage and Clinical Settings. Microorganisms 2020, 8, 885. [Google Scholar] [CrossRef] [PubMed]
- Vasaikar, S.D.; Obi, L.; Morobe, I.; Bisi-Johnson, M. Molecular Characteristics and Antibiotic Resistance Profiles ofKlebsiellaIsolates in Mthatha, Eastern Cape Province, South Africa. Int. J. Microbiol. 2017, 2017, 1–7. [Google Scholar] [CrossRef] [PubMed]
- Richter, L.; Du Plessis, E.M.; Duvenage, S.; Korsten, L. Occurrence, Phenotypic and Molecular Characterization of Extended-Spectrum- and AmpC- β-Lactamase Producing Enterobacteriaceae Isolated From Selected Commercial Spinach Supply Chains in South Africa. Front. Microbiol. 2020, 11, 638. [Google Scholar] [CrossRef] [PubMed]
- Bauer, M.A.W.; Kirby, M.W.M.M.; Sherris, M.J.C.; Turck, M.M. Antibiotic Susceptibility Testing by a Standardized Single Disk Method. Am. J. Clin. Pathol. 1966, 45, 493–496. [Google Scholar] [CrossRef]
- EUCAST Guidelines for Detection of Resistance Mechanisms and Specific Resistance of Clinical and/or Epidemiological Importance. Available online: https://eucast.org/resistance_mechanisms/ (accessed on 13 November 2020).
- Amjad, A.; Mirza, I.; Abbasi, S.; Farwa, U.; Malik, N.; Zia, F. Modified Hodge test: A simple and effective test for detection of carbapenemase production. Iran. J. Microbiol. 2011, 3, 189–193. [Google Scholar]
- Korzeniewska, E.; Harnisz, M. Beta-lactamase-producing Enterobacteriaceae in hospital effluents. J. Environ. Manag. 2013, 123, 1–7. [Google Scholar] [CrossRef]
- Anbazhagan, D.; Mui, W.S.; Mansor, M.; Yan, G.O.S.; Yusof, M.Y.; Sekaran, S.D. Development of conventional and real-time multiplex PCR assays for the detection of nosocomial pathogens. Braz. J. Microbiol. 2011, 42, 448–458. [Google Scholar] [CrossRef]
- Anbazhagan, D.; Kathirvalu, G.G.; Mansor, M.; Yan, G.O.S.; Yusof, M.Y.; Sekaran, S.D. Multiplex polymerase chain reaction (PCR) assays for the detection of Enterobacteriaceae in clinical samples. Afr. J. Microbiol. Res. 2010, 4, 1186–1191. [Google Scholar]
- Salehi, T.Z.; Mahzounieh, M.; Saeedzadeh, A. Detection of InvA Gene in Isolated Salmonella from Broilers by PCR Method. Int. J. Poult. Sci. 2005, 4, 557–559. [Google Scholar] [CrossRef][Green Version]
- Poirel, L.; Walsh, T.R.; Cuvillier, V.; Nordmann, P. Multiplex PCR for detection of acquired carbapenemase genes. Diagn. Microbiol. Infect. Dis. 2011, 70, 119–123. [Google Scholar] [CrossRef]
- Al-Mayahie, S.M.G. Phenotypic and genotypic comparison of ESBL production by Vaginal Escherichia coli isolates from pregnant and non-pregnant women. Ann. Clin. Microbiol. Antimicrob. 2013, 12, 1–7. [Google Scholar] [CrossRef] [PubMed]






| CRE Species | No. of Isolates | Carbapenemase Encoding Genes (%) | ||||||||
|---|---|---|---|---|---|---|---|---|---|---|
| blaKPC | blaNDM | blaOXA-23 | blaVIM | blaOXA-48 | blaGES | blaKPC_blaOXA-23 | blaKPC_blaNDM | blaGES_blaOXA-48 | ||
| E. coli | 52 | 34.6 | 32.7 | 3.8 | 1.9 | 13.5 | 9.6 | 0.0 | 3.8 | 0.0 |
| K. pneumoniae | 66 | 42.4 | 12.1 | 1.5 | 3.0 | 6.1 | 27.3 | 6.1 | 0.0 | 1.5 |
| P. mirabilis | 2 | 0.0 | 0.0 | 50.0 | 0.0 | 50.0 | 0.0 | 0.0 | 0.0 | 0.0 |
| Salmonella species | 7 | 28.6 | 42.9 | 14.3 | 0.0 | 14.3 | 0.0 | 0.0 | 0.0 | 0.0 |
| Unspecified CRE species | 24 | 25.0 | 12.5 | 0.0 | 29.2 | 12.5 | 16.7 | 0.0 | 0.0 | 4.2 |
| Total | 151 | 35.8 | 20.5 | 3.3 | 6.6 | 10.6 | 17.9 | 2.6 | 1.3 | 1.3 |
| CRE Species | No. of Isolates | ESBL Encoding Genes (%) | |||||
|---|---|---|---|---|---|---|---|
| blaSHV | blaTEM | blaCTX-M | blaOXA | blaOXA_blaCTX-M | blaSHV_blaTEM | ||
| E. coli | 52 | 23.1 | 26.9 | 34.6 | 1.9 | 3.8 | 9.6 |
| K. pneumoniae | 66 | 45.5 | 16.7 | 9.1 | 13.6 | 12.1 | 3.0 |
| P. mirabilis | 2 | 0.0 | 50.0 | 0.0 | 50.0 | 9.1 | 0.0 |
| Salmonella species | 7 | 0.0 | 28.6 | 57.1 | 0.0 | 14.3 | 0.0 |
| Unspecified CRE species | 24 | 33.3 | 25.0 | 12.5 | 25.0 | 0.0 | 4.2 |
| Total | 151 | 33.1 | 22.5 | 20.5 | 11.3 | 7.3 | 5.3 |
| Primers | Oligonucleotide Sequence (5′–3′) | Genes | Amplicon Size (bp) | Annealing Tm (°C) | References |
|---|---|---|---|---|---|
| 16S rRNA | |||||
| 27F | AGAGTTTGATCATGGCTCAG | 16S rRNA | 1420 | 55 | [49] |
| 1492R | GGTACCTTGTTACGACTT | ||||
| Genus Specific Genes | |||||
| ntrA-F | CATCTCGATCTGCTGGCCAA | ntrA | 90 | 52 | [50] |
| ntrA-R | GCGCGGATCCAGCGATTGGA | ||||
| uidA-F | CTGGTATCAGCGCGAAGTC | uidA | 556 | 52 | |
| uidA-R | AGCGGGTAGATATCACACTC | ||||
| Tuf-F | TCTACTTCACACGTAG | tuf | 240 | 58 | [51] |
| Tuf-R | TTCTAACAGCTCTTCA | ||||
| invA-F | GTGAAATTATCGCCACGTGGCAA | invA | 284 | 64 | [52] |
| invA-R | TCATCGCACCGTCAAAGGAACC | ||||
| Primers | Oligonucleotide Sequence (5′–3′) | Genes | Amplicon Size (bp) | Annealing Tm (°C) | References |
|---|---|---|---|---|---|
| CRE Genes | |||||
| KPC-F | CGTCTAGTTCTGCTGTCTTG | blaKPC | 798 | 52 | [53] |
| KPC-R | CTTGTCATCCTTGTTAGGCG | ||||
| NDM-F | GGTTTGGCGATCTGGTTTTC | blaNDM | 621 | ||
| NDM-R | CGGAATGGCTCATCACGATC | ||||
| OXA-23-F | ATGAGTTATCTATTTTTGTC | blaOXA-23 | 501 | ||
| OXA-23-R | TGTCAAGCTCTTAAATAATA | ||||
| GES-C-F | GTTTTGCAATGTGCTCAACG | blaGES | 371 | ||
| GES-D-R | TGCCATAGCAATAGGCGTAG | ||||
| VIM-F | GATGGTGTTTGGTCGCATA | blaVIM | 390 | ||
| VIM-R | CGAATGCGCAGCACCAG | ||||
| OXA-48-F | TTCGGCCACGGAGCAAATCAG | blaOXA-48 | 438 | ||
| OXA-48-R | GATGTGGGCATATCCATATTCATCGCA | ||||
| ESBL Genes | |||||
| blaTEM-F | AAACGCTGGTGAAAGTA | blaTEM | 822 | 45 | [54] |
| blaTEM-R | AGCGATCTGTCTAT | ||||
| blaSHV-F | ATGCGTTATATCGCCTGTG | blaSHV | 753 | ||
| blaSHV-R | TGCTTTGTTATTCGGGCCAA | ||||
| blaCTX-M-F | CGCTTTGCGATGTGCAG | blaCTX-M | 550 | ||
| blaCTX-M-R | ACCGCGATATCGTTGGT | ||||
| blaOXA-F | ATATCTCTACTGTTGCATCTCC | blaOXA | 619 | ||
| blaOXA-R | AAACCCTTCAAACCATCC | ||||
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2020 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Tshitshi, L.; Manganyi, M.C.; Montso, P.K.; Mbewe, M.; Ateba, C.N. Extended Spectrum Beta-Lactamase-Resistant Determinants among Carbapenem-Resistant Enterobacteriaceae from Beef Cattle in the North West Province, South Africa: A Critical Assessment of Their Possible Public Health Implications. Antibiotics 2020, 9, 820. https://doi.org/10.3390/antibiotics9110820
Tshitshi L, Manganyi MC, Montso PK, Mbewe M, Ateba CN. Extended Spectrum Beta-Lactamase-Resistant Determinants among Carbapenem-Resistant Enterobacteriaceae from Beef Cattle in the North West Province, South Africa: A Critical Assessment of Their Possible Public Health Implications. Antibiotics. 2020; 9(11):820. https://doi.org/10.3390/antibiotics9110820
Chicago/Turabian StyleTshitshi, Lungisile, Madira Coutlyne Manganyi, Peter Kotsoana Montso, Moses Mbewe, and Collins Njie Ateba. 2020. "Extended Spectrum Beta-Lactamase-Resistant Determinants among Carbapenem-Resistant Enterobacteriaceae from Beef Cattle in the North West Province, South Africa: A Critical Assessment of Their Possible Public Health Implications" Antibiotics 9, no. 11: 820. https://doi.org/10.3390/antibiotics9110820
APA StyleTshitshi, L., Manganyi, M. C., Montso, P. K., Mbewe, M., & Ateba, C. N. (2020). Extended Spectrum Beta-Lactamase-Resistant Determinants among Carbapenem-Resistant Enterobacteriaceae from Beef Cattle in the North West Province, South Africa: A Critical Assessment of Their Possible Public Health Implications. Antibiotics, 9(11), 820. https://doi.org/10.3390/antibiotics9110820

