Next Article in Journal
Direct Disk Diffusion Testing and Antimicrobial Stewardship for Gram-Negative Bacteremia in the Context of High Multidrug Resistance
Next Article in Special Issue
Antimicrobial Activity of Lacticaseibacillus rhamnosus CRL 2244 Extracts Against Community- and Hospital-Acquired Staphylococcus aureus
Previous Article in Journal
Exploring the Microbiome of Diabetic Foot Ulcers: A Focus on Cases with a Clinical Worse Outcome
Previous Article in Special Issue
Antimicrobial Resistance Patterns of Staphylococcus aureus Cultured from the Healthy Horses’ Nostrils Sampled in Distant Regions of Brazil
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Antibiotics
Volume 14
Issue 7
10.3390/antibiotics14070725
antibiotics-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Antimicrobial-Resistant Staphylococcus spp. Harbored by Hedgehogs (Erinaceus europaeus) in Central Italy

by
Fabrizio Bertelloni
1,
Francesca Pauselli
1,
Giulia Cagnoli
1,
Roberto Biscontri
1,
Renato Ceccherelli
2 and
Valentina Virginia Ebani
1,3,*
1
Department of Veterinary Science, University of Pisa, Viale delle Piagge 2, 56124 Pisa, Italy
2
CRUMA-LIPU, Via delle Sorgenti 430, 57121 Livorno, Italy
3
Centre for Climate Change Impact, University of Pisa, Via del Borghetto 80, 56124 Pisa, Italy
*
Author to whom correspondence should be addressed.
Antibiotics 2025, 14(7), 725; https://doi.org/10.3390/antibiotics14070725
Submission received: 13 June 2025 / Revised: 7 July 2025 / Accepted: 16 July 2025 / Published: 18 July 2025
(This article belongs to the Collection Staphylococcus— Molecular Pathogenesis, Virulence Regulation and Antibiotics Resistance)
Versions Notes

Abstract

Background/Objectives: European hedgehogs (Erinaceus europaeus) are present in areas where there is human activity; therefore, they can be a source of pathogens for other animals and humans. Methods: Eighteen hedgehog carcasses were collected and analyzed for Staphylococcus spp. Isolated strains were typed and analyzed for exfoliative toxins genes and the phenotypic and genotypic characteristics of antimicrobial resistance. Results: A total of 54 strains were isolated and typed as S. aureus, S. xylosus, S. sciuri, S. pseudintermedius, S. simulans, S. chromogenes, S. epidermidis, S. hyicus, and S. lentus. No strains had the eta and etb genes coding for exfoliative toxins. Overall, 39/54 (72.20%) isolates showed phenotypic resistance to at least one antimicrobial and 21/54 (38.80%) showed more than one resistance. The lowest efficacy was observed for erythromycin, with 40/54 (74.08%) strains classified as intermediate and 6/54 (11.11%) classified as resistant. Among the 29 isolates shown to be penicillin-resistant, 11 (37.93%) were oxacillin-resistant, with a minimum inhibitory concentration (MIC). Among the 54 staphylococcal strains, 2 (3.70%) were resistant to vancomycin, both with an MIC value equal to the maximum concentration of the antibiotic tested (256 μg/mL) and 2 (3.70%) had an intermediate resistance profile with an 8 μg/mL MIC value. No strains had the genes vanA and vanB. Two of the 29 (6.90%) penicillin-resistant strains had the blaZ gene; 8 (27.13%) strains had the mecA gene. Overall, 2/54 (3.70%) isolates were classified as extensively drug-resistant (XDR) and 9/54 (16.66%) were classified as multidrug-resistant (MDR). Conclusions: Hedgehogs can harbor antimicrobial-resistant staphylococci and can be sources of these bacteria for other animals and humans. They can also serve as bioindicators of the pathogens and antimicrobial-resistant bacteria circulating in a given habitat.

1. Introduction

Human population growth, increased urban waste, and the destruction of natural habitats are leading wildlife to increasingly interact, both directly and indirectly, with humans [1]. Therefore, wild animals, particularly small mammals, such as hedgehogs, may have an important role in the epidemiology of zoonotic pathogens [2].
The western European hedgehog (Erinaceus europaeus) is a small, spiny mammal widespread throughout western Europe. Hedgehogs are increasingly present in areas with human activity, such as gardens in residential areas and rural villages [3], where they easily find food and water [4]. Hedgehogs are known to be sources of pathogens, such as Leptospira spp., Salmonella spp. and other Enterobacteriaceae, for humans and other animals [5]. Their role as a source of antimicrobial-resistant bacteria is particularly interesting from a One Health perspective. The inappropriate use of antibiotics in human and veterinary medicine, environmental contamination by antimicrobial residues, and ineffective infection control measures are responsible for the spread of antimicrobial-resistant bacteria among domestic and wild animals [6].
Some studies have focused on antimicrobial-resistant Staphylococcus aureus infection in hedgehogs. In 1964, Smith and Marples reported the first description of penicillin-resistant S. aureus in hedgehogs in New Zealand [7]. Subsequently, other investigations found methicillin-resistant S. aureus (MRSA) with variable prevalence rates. Similar prevalences (64% and 60%) were found in two different surveys in Sweden [8,9]; a similar result was obtained in Denmark (61%) [4]. Very low rates were detected in other investigations: only two (2/199) hedgehogs carrying mecC-MRSAs were detected in Sweden and two (2/199) in Germany [10,11]. In a study carried out in Austria, 40 different wild animal species were sampled, with 3 European brown hares, 1 European otter, and 1 hedgehog carrying mecC-MRSA [12]. A prevalence of 1% (2/200) of hedgehogs harboring MRSA was found in Hungary [13]. Recently, among 139 hedgehogs analyzed in France, 128 were S. aureus carriers and 25 (18%) presented with an MRSA isolate [14].
Conversely, data about the occurrence and characteristics of virulence and antimicrobial resistance of staphylococci belonging to other species in hedgehogs are scanty. In addition, to the best of our knowledge, surveys on staphylococcal infections in hedgehogs have not been conducted in Italy.
The aim of the present study was to verify the occurrence of Staphylococcus species in European hedgehogs living in central Italy and to analyze the isolates, evaluating their virulence genes, particularly those involved in the production of exfoliative toxins, and their phenotypic and genotypic characteristics of antimicrobial resistance.

2. Results

2.1. Animals

A total of 18 hedgehogs (9 males and 9 females) were included in the study. Three animals were classified as juvenile, with bodyweights ranging between 65.97 g to 92.13 g; the remaining 15 animals were adults with bodyweights ranging from 345 g to 750.68 g. Table 1 summarizes the morphometric data of the analyzed hedgehogs.

2.2. Bacteriological Analyses

2.2.1. Staphylococcus Isolation

A total of 54 Staphylococcus strains were isolated from the 54 samples collected and analyzed. The strains were cultured from all samples except the intestine of H13; two strains were isolated from the intestine of H6. The isolates were confirmed to belong to the Staphylococcus genus by PCR. Among the 54 strains, 9 (16.6%) were identified as S. aureus by species-specific PCR. Forty-five strains were identified by API Staph ® (bioMérieux SA, REF 20 500, Marcy l’Etoile, France) as: S. xylosus (16/54, 29.62%); S. sciuri (8/54, 14.81%); S. pseudintermedius (6/54, 11.11%); S. simulans (5/54, 9.25%); S. chromogenes (5/54, 9.25%); S. epidermidis (2/54, 3.70%); S. hyicus (2/54, 3.70%); and S. lentus (1/54, 1.85%). Overall, 17/54 (31.48%) isolates were coagulase-positive staphylococci (CoPS) of the following species: S. aureus; S. pseudintermedius; and S. hyicus. The remaining 37/54 (68.52%) were coagulase-negative staphylococci (CoNS) of the following species: S. xylosus; S. sciuri; S. simulans; S. chromogenes; S. epidermidis; and S. lentus (1/54, 1.85%). Both S. aureus and S. hyicus were isolated from the intestine of H6. In most cases, two or three staphylococcal species were found in each tested hedgehog, as summarized in Table 2.
No statistically significant differences emerged in the distribution of staphylococcal species in relation to animal sex and site of isolation (p > 0.05). S. epidermidis and S. sciuri were more frequently detected in juvenile than in adult animals (p < 0.05).
CoPS and CoNS were equally distributed in relation to sex, age, and site of isolation, without statistical differences (p > 0.05).

2.2.2. Antimicrobial Sensitivity Tests

Disk Diffusion Method
The results of the disk diffusion test are reported in Table 3. Overall, 39/54 (72.20%) isolates showed phenotypic resistance to at least one antimicrobial and 21/54 (38.80%) showed more than one resistance. On the other hand, 15/54 (27.78%) isolates were resistant to none of the tested antimicrobials. Briefly, high percentages of susceptible isolates were detected to many antimicrobials: 96.30% to amikacin, 94.44% to trimethoprim–sulfamethoxazole, and 90.74% to gentamycin and amoxicillin–clavulanate. Even though no very high resistance rates were observed, significant percentages of intermediate strains were found. A high prevalence (29/54, 53.70%) of resistant isolates was found for penicillin. Erythromycin showed the lowest efficacy, with most of the strains (40/54, 74.08%) classified as intermediate and 6/54 (11.11%) as resistant. A high percentage (22/54, 40.74%) of intermediate strains was also observed for enrofloxacin; 5/54 (9.26%) isolates were resistant to this antimicrobial. A high percentage of resistant strains (18/54, 33.34%) was found for rifampicin. A relevant percentage (12/54, 22.22%) of intermediate isolates was found for ciprofloxacin.
Staphylococcus spp. strains isolated from oral swabs showed high levels of resistance to penicillin (11/18, 61.11%) and rifampicin (9/18, 50.00%) and many strains presented intermediate resistance to enrofloxacin (9/18, 50.00%) and erythromycin (15/18, 83.33%). Similarly, Staphylococcus spp. strains isolated from nasal swabs showed higher resistance to penicillin (10/18, 55.55%) and rifampicin (5/18, 27.77%) than average; a high percentage of intermediate strains was also observed for enrofloxacin and ciprofloxacin (6/18, 33.33%). The highest percentages of resistant strains, among those isolated from the intestines, were found for penicillin (8/18, 44.44%) and rifampicin (4/18, 22.22%); 66.66% (12/18), 38.88% (7/18), and 22.22% (4/18) of the isolates were intermediate for erythromycin, enrofloxacin, and ciprofloxacin, respectively.
No statistical differences (p > 0.05) emerged in relation to animal sex, age, and sample type (oral swab/nasal swab/intestine) when considering the resistances to the various antimicrobials tested.
Resistance to amoxicillin–clavulanate was higher in CoPS than CoNS (p < 0.05), and, similarly, intermediate resistance to erythromycin was higher in CoPS than CoNS (p < 0.05). Coagulase-positive and coagulase-negative staphylococci did not show other differences in the resistance/intermediate/susceptibility distribution in relation to the other antimicrobials evaluated (p > 0.05).
Finally, considering the species of staphylococci: S. xylosus was more resistant to penicillin than the other species (p < 0.05); S. aureus was more resistant to amoxicillin/clavulanate and cefoxitin than the other species (p < 0.05); S. pseudintermedius showed an intermediate result for enrofloxacin more often than other species (p < 0.05); S. epidermidis was more resistant to gentamicin and SXT than other species (p < 0.05). No statistical differences emerged in relation to the remaining antimicrobials and bacterial species (p > 0.05).
Minimum Inhibitory Concentration (MIC)
Among the 54 Staphylococcus spp. strains, 2 (3.70%) (H2A, H6A) were resistant to vancomycin, both with an MIC value equal to the maximum concentration of antibiotic tested (256 μg/mL). Two (3.70%) (H9C, H12B) had an intermediate resistance profile, with an 8 μg/mL MIC value. The remaining 50 (92.60%) isolates were found to be sensitive, with the following MIC values: ≤0.5 μg/mL (17/54, 31.48%); 1 μg/mL (10/54, 18.52%); 2 μg/mL (16/54, 29.60%); and 4 μg/mL (7/54, 12.96%).
Among the 29 Staphylococcus spp. isolates (11/18 from oral swabs, 10/18 from nasal swabs, and 8/18 from intestines) found to be resistant to penicillin by the disk diffusion method, 11 (37.93%) were oxacillin-resistant, with MIC values of 1 μg/mL for non-S. aureus strains (8/29, 27.58%), and values of 4 μg/mL (H8A), 8 μg/mL (H16A), and 16 μg/mL (H16B) for S. aureus isolates. The remaining strains (18/29, 62.07%) were found to be oxacillin-susceptible, with MIC values of 0.5 μg/mL (10/29, 34.48%), 0.25 μg/mL (4/29, 13.79%) and ≤0.125 (3/29, 10.34%) for non-S. aureus strains, while one S. aureus strain (H8B) had an 0.5 μg/mL MIC.
Resistance Profiles
Seventeen different antimicrobial resistance profiles were identified in the analyzed strains. In detail, 15 isolates did not show resistance to the tested antimicrobials, whereas the other isolates were resistant to between one and nine antimicrobials. Based on the resistance profiles, 2/54 strains (3.70%) were classified as extensively drug-resistant (XDR) and 9/54 (16.66%) were classified as multidrug-resistant (MDR), whereas 43/54 (79.62%) did not fall into any resistance class (Table 2). No strain was pandrug-resistant (PDR).
No statistical differences emerged in the distribution of multi-drug resistant (MDR + XDR) strains in relation to animal sex, age, sample type (oral swab/nasal swab/intestine), CoPS or CoNS, or bacterial species (p > 0.05).

2.3. Molecular Analyses

Out of the 29 penicillin-resistant Staphylococcus spp. strains, 2 (6.90%) had the blaZ gene, 1 S. epidermidis was isolated from a nasal swab (H1B) and 1 S. epidermidis was isolated from the intestine (H1C) of the same animal. Eight (27.13%) strains had the mecA gene: four from oral swabs (H1A, H2A, H14A, H17A); two from nasal swabs (H1B, H18B); and two from the intestines (H1C, H18C). No strain presented the mecC gene (Table 2). It was not possible to assign an SCCmec type to the mecA-positive strains; they showed the best homology with SCCmec type V or VII, being positive for the ccrC1 but negative for the mec class C2 or C1.
All vancomycin-resistant and intermediate strains were negative for the genes vanA and vanB. PCR carried out in all staphylococcal strains to detect the virulence genes eta and etb coding to produce the exfoliative toxins; no positive isolates were detected.

3. Discussion

The isolation of numerous strains of Staphylococcus belonging to distinct species indicates the large diffusion of these bacteria in the analyzed hedgehogs. The distribution of species varies considerably in relation to the anatomical sites, with some hedgehogs hosting the same staphylococcus at multiple sites (e.g., S. epidermidis in H1 and S. intermedius in H15) and others showing a higher diversity of species; however, no correlation between a given staphylococcal species and anatomical site of isolation emerged, even though the small number of tested animals was not statistically significant.
Overall, we found a predominance of coagulase-negative (CoNS) strains (72.22%), compared to coagulase-positive (CoPS) strains (27.77%). CoNS are usually considered commensal bacteria that can act as opportunistic pathogens. Among these, S. xylosus was the species most frequently encountered (29.62%); it is known as a commensal bacterium that generally occurs on the skin and mucous membranes of several animals. It is ubiquitous in nature, persisting in soils and sediments [15].
The other CoNS most frequently isolated were S. sciuri (14.81%), S. simulans (9.25%), and S. chromogenes (9.25%). S. sciuri has been commonly considered commensal in the oral cavity in rodent species and is sometimes associated with serious infections in humans [16,17,18,19]. Martel et al. found S. sciuri, as well as S. aureus, S. simulans, S. xylosus, S. microti, S. fleurettii, S. pettenkoferi, in association with Corynebacterium ulcerans, in deceased hedgehogs in Belgium [20]. S. simulans can cause several diseases in humans and animals; in addition, a report described a case of dermatosis characterized by broad, well-circumscribed hyperkeratosis and alopecia on the back of a household pygmy hedgehog (Erinaceous albiventris) [21]. S. chromogenes is recognized as one of the most frequent staphylococcal species causing subclinical intramammary infections in dairy cattle [22]; however, no data are available about its occurrence in hedgehogs.
Few strains of S. epidermidis and S. lentus were isolated; these CoNS are rarely associated with infections in humans and animals. S. lentus was previously isolated in Portugal from a hedgehog as the causative agent of pyometra [23].
Among CoPS, S. aureus, S. pseudintermedius and S. hyicus were cultured in 16.6%, 11.11%, and 3.70% of the analyzed samples, respectively. S. aureus has been found in hedgehogs in some previous investigations, whereas bacteria of the Staphylococcus intermedius group (SIG) have been related to infection in these animals living in urban areas of Finland only by Rautio et al. in 2016 [24]. The same authors reported the isolation of S. hyicus, the causative agent of exudative epidermitis of pigs [25], from sick hedgehogs.
Overall, 72.20% (39/54) of the strains isolated in this study showed phenotypic resistance to at least one antimicrobial and 38.80% (21/54) showed more than one resistance. The presence of XDR (3.70%) and MDR (16%) strains, and the variability of resistance profiles among the analyzed isolates, highlighted the diffusion in the antimicrobial resistance issue within the staphylococcal population. The nine MDR isolates belonged to distinct species, although S. xylosus was the most frequent, whereas both XDR strains were S. epidermidis. Most of these isolates were oxacillin-resistant, although not all had the investigated resistance genes. In particular, the two XDR strains had both blaZ and mecA genes but only one MDR had the gene mecA.
The relevant MIC values for vancomycin found in two strains (one S. aureus and one S. sciuri) and intermediate resistance values (one S. pseudintermedius and one S. xylosus) suggested the presence of strains potentially resistant to this antibiotic, which is considered as a last-line treatment for infections caused by resistant staphylococci. A thickening of the cell wall due to the overlapping of peptidoglycan has been reported in both S. aureus and CoNS resistant to glycopeptides [26]. Recent studies suggest that S. aureus may acquire genes for vancomycin resistance from enterococci [27]. However, vancomycin-resistant and intermediate strains tested in our study were negative for both vanA and vanB genes. Intermediate resistance to vancomycin in staphylococci, especially S. aureus, can also be due to the accumulation of multiple mutations in several chromosomal genes involved in peptidoglycan synthesis; the same non-transferable mechanism could also be related to the development of vancomycin resistance [28].
The frequent detection of blaZ and mecA genes in methicillin/oxacillin-resistant strains confirmed the involvement of these genes in this antimicrobial resistance. In particular, mecA was the most frequently found gene in isolates with an equal distribution between the oral, nasal, and intestinal sites. Conversely, the absence of the mecC gene in all staphylococcal strains indicates its minor relevance in the resistance of these bacteria. However, mecC has been previously found in MRSA strains isolated from hedgehogs in Hungary [13] and in Sweden [10]. Furthermore, one study found mecC-MRSA in river water in an area where mecC-MRSA had been isolated from wild boars and fallow deer, suggesting that water may be a shared site of exposure or transmission between various animal species and the environment [29].
Other studies supported the fact that carriage of the penicillin-producing dermatophyte Trichophyton erinacei in hedgehogs may impose a selective pressure that could facilitate the emergence of resistant variants of bacteria, such as mecC-MRSA, but also that the blaZ gene, which produces beta-lactamase and is in close proximity to the mecC gene on mecXI of SCC, could influence the selection of mecC-MRSA in hedgehogs [9].
Methicillin-resistant CoNS isolates are, in general, more often multi-resistant than isolates susceptible to this antimicrobial molecule [26]. However, the results of the present study showed that not all methicillin-resistant strains present beta-lactam resistance genes, indicating a phenotypic resistance, associated with alternative mechanisms for these strains by other authors, such as changes in bacterial membrane permeability; the presence of active efflux pumps; mutations in penicillin-binding proteins (PBPs) (i.e., target proteins that reduce the affinity of the drug without the need for the mecA gene); and adaptive mechanisms such as the ability to form biofilms and regulatory mechanisms related to the contact of bacteria with chemicals present in the environment, including antibiotics [30]. In addition, there are variants of beta-lactamases, other than those encoded by the gene blaZ, that may be less common or undetectable by standard genetic testing methods [30]. No S. aureus strains in this study presented beta-lactam resistance genes; therefore, the antibiotic resistance found in S. aureus strains does not appear to be mediated by the blaZ or mecA genes, highlighting the need for further investigations to understand the mechanisms of antibiotic resistance. Indeed, there are very few studies detecting the presence of MRSA strains in hedgehogs; less information is available on CoNS. However, the detection of blaZ and mecA genes in XDR and MDR S. epidermidis, S. sciuri, and S. chromogenes strains, is noteworthy. The alleles of mecA associated with resistance are located on mobile genetic elements known as staphylococcal cassette chromosome mec (SCC mec) elements and can be found in S. aureus as well as in other staphylococcal species such as S. epidermidis and S. sciuri [10]. Several SCCmec variants exist; nowadays, 15 different SCCmec types are recognized. Some of these are associated with S. aureus strains circulating and acquired within hospital settings, called hospital-associated MRSA (HA-MRSA), while other types are more often detected in community-associated MRSA (CA-MRSA)—S. aureus strains circulating and acquired outside hospitals. Recently, some SCCmec types seem to be particularly associated with strains circulating among farm animals; these are called livestock-associated MRSA (LA-MRSA) [31]. Isolates analyzed in this study were not typable in relation to the SCCmec. Most of these could be potentially assigned to type V, associated with HA-MRSA and CA-MRSA, or to type VII, which is not associable to a specific epidemiological niche [31]. The SCCmec typing method was set up to investigate S. aureus mecA-positive strains; it is possible that it is not applicable to CoNS in the same manner, or, more probably, that different genes circulate among coagulase-negative staphylococci, mainly among non-clinical strains. Other authors reported a high frequency of detection of not-typable strains among CoNS isolated from the environment [32,33]. Similar to our results, they found that most of the not-typeable strains showed the most similarity with type V SCCmec [32]. As proposed by some authors, whole-genome sequencing is probably the best method to classify these strains [34].
According to some studies, species, such as S. sciuri, taxonomically considered the most primitive among staphylococci found mainly in rodents and primitive mammals, frequently harbor mecA alleles, suggesting the role of this staphylococcal species as a possible ancestor of the methicillin-resistance determinant for MRSA strains. However, it seems that the presence of the mecA gene in this species is not associated with beta-lactam resistance, suggesting that mecA may be a native genetic element with a physiological function not yet identified in this staphylococcal species [35]. The blaZ gene has also been identified as a cause of penicillin resistance among coagulase-negative staphylococci (CoNS), as well as in porcine S. hyicus. Resistance gene transfer between CoNS and S. aureus has also been reported, indicating that CoNS may act as a reservoir of resistance genes for S. aureus. It is therefore possible that different staphylococcal species present in the same microenvironment may exchange blaZ genes if the appropriate bacterial factors occur [36].
The predominance of CoNS isolates in exhibiting multidrug and antiseptic resistance, as well as their biofilm-forming capacity, is strongly indicative of selection processes facilitated mainly by the excessive use of antibiotics [26]. A high prevalence of species, such as S. sciuri, S. xylosus and S. chromogenes, were isolated from the nasal swabs of wild boars in a study conducted in Spain [37]. Another study detected the presence of multidrug- and methicillin-resistant S. sciuri strains isolated from wild ungulates [38]. These data support the assertion that the spread of methicillin-resistant and multidrug-resistant CoNS has increased over the years, becoming a worrying threat for both human and veterinary medicine [39].
With the exclusion of β-lactams, several strains showed non-susceptibility to fluoroquinolones (both enrofloxacin 50.00% and ciprofloxacin 29.63%), erythromycin (85.19%) and rifampicin (48.15%).
Regarding fluoroquinolones specifically, recent attention has been paid to their environmental contamination [40]. Enrofloxacin, in particular, is extensively used in veterinary medicine and is excreted through the urine and feces of treated animals [41]. This excretion results in the release of enrofloxacin and its metabolites into the environment, where they can be readily absorbed by various organisms—including bacteria, plants, invertebrates, and wild animals. The environmental presence of fluoroquinolones may contribute to the development of antimicrobial resistance, which could explain the elevated resistance levels observed in hedgehogs, a species with a broad and human-interconnected habitat.
Generally, lower percentages of staphylococci non-susceptible to these antimicrobials were reported by other authors. In particular, Monecke and colleagues detected two mecC-positive S. aureus in two hedgehogs in Sweden; both isolates were susceptible to erythromycin and rifampicin [10]. In another investigation carried out in Sweden in 2017, the authors found 5/35 erythromycin-resistant isolates and no ciprofloxacin-resistant isolates in staphylococci isolated from hedgehogs [8]. In Hungary, Sahin-Tóth and collaborators isolated 13 S. aureus strains form hedgehogs. All the isolates showed intermediate resistance to ciprofloxacin and 8% showed intermediate resistance to erythromycin [13]. Recently, in a large survey carried out in France, 128 S. aureus strains isolated from hedgehogs were analyzed; all were susceptible to enrofloxacin and three were resistant to erythromycin [14]. Finally, all 11 MRSA strains isolated from hedgehogs in Finland were susceptible to erythromycin and rifampicin [42]. However, it is important to note that all the studies reported above focused only on S. aureus or MRSA strains—this could be a possible explanation for the dissimilarity to our results.
The absence of the virulence genes eta and etb, encoding exfoliative toxins, in all the analyzed strains suggested the limited pathogenic potential of our isolates, although further characterizations would be necessary. In fact, we isolated species, such as S. aureus, S. hyicus, and S. chromogenes, that are known to cause skin infections in humans and animals by producing exfoliative toxins [43,44]. A relatively new exfoliative toxin gene homologue named etE [45], previously called etD2 [10], was detected in an MRSA isolated from one hedgehog in Hungary [13].
Hedgehogs have been proven to be potential source of pathogens; however, they can also be used as sentinels to monitor the spread of microorganisms in a given environment. In fact, hedgehogs often become accidental victims of human activity; their carcasses can serve as a valuable source of data for epidemiological studies [5]. These animals often live in urban and peri-urban areas, where they come into contact with the feces and urines of pets, mainly dogs and cats, as well as with urban waste; furthermore, hedgehogs are frequently present, in rural areas, in proximity to livestock. In all cases, they can contract different pathogens, including antimicrobial-resistant bacteria.
The present study has some limitations. First, the survey was carried out on a small number of animals; therefore, the results do not allow for correlations between staphylococcal data and animal parameters (age, sex, site) to be defined even though statistical analyses were carried out. The findings of our study confirmed that hedgehogs often harbor different staphylococcal species; further analyses on additional virulence and antimicrobial genes could better define the potential pathogenic role of these bacteria. We focused on eta and etb genes because they are responsible for the production of the principal exfoliative toxins implicated in human skin damage [46]. Veterinarians, wildlife center staff, or others who manipulate hedgehogs for treatments are at risk of being infected by the staphylococci producing these toxins.
The genes related to resistance to beta-lactams and vancomycin were investigated because currently, resistance to these antimicrobials represent the most significant concern in the treatment of staphylococcal infections. Penicillin resistance, and, in particular, methicillin resistance, is a global threat to public health. Vancomycin is one of the first-line drugs for the treatment of MRSA infections; however, staphylococcal isolates with complete resistance to vancomycin have emerged in recent years [47]. Even though these resistances are the most significant concern, studies to evaluate additional antimicrobial resistance are necessary to obtain a more exhaustive overview of this threat.

4. Materials and Methods

4.1. Sampling

From February to July 2024, 18 hedgehogs (E. europaeus), found dead due to trauma, were collected at a wildlife recovery center located in central Italy. Only carcasses in good conservation condition were collected and stored in freezers at −20 °C; they were thawed before the necropsies, during which gender and body measurements were noted and tissue samples were collected. In particular, the body length, the hindfoot length, and jaw length were recorded for age determination. Animals with a body length of <16 cm, a hindfoot length of less than 3.6 cm, and a jaw length lower than 4.5 cm were considered as juveniles (before first hibernation), while the others were considered as adults (after first hibernation) [48]. Different specimens were sampled for successive bacteriological analyses. In detail, oral and nasal swabs, and a portion of the intestine, were collected from each animal.

4.2. Staphylococcus spp. Isolation and Characterization

All samples were placed in brain heart infusion (BHI) broth (Thermo Fisher Diagnostics, Milan, Italy), to which 6.5% of NaCl was added, and incubated at 37 °C for 24 h. Each broth culture was streaked onto mannitol salt agar (MSA) (Thermo Fisher Diagnostics) and the plates were incubated at 37 °C for 24 h. One or two colonies were selected from each sample, in relation to mannitol fermentation, and sub-cultured on tryptic soy agar (TSA) (Thermo Fisher Diagnostics). The isolates were initially confirmed as Staphylococcus spp. with Gram staining and catalase testing. Successively, they were analyzed by polymerase chain reaction (PCR) to confirm the genus and to identify S. aureus, using primers (Table 4) and protocols previously described [49]. Isolates that were found not to belong to this species were analyzed using the kit API Staph ® (bioMérieux SA, REF 20 500, Marcy l’Etoile, France). All typed isolates were cultured in brain heart infusion broth (BHI) (Thermo Fisher Diagnostics) and stored at −80 °C, with the addition of 20% glycerol as a cryoprotectant.

4.3. Antimicrobial Susceptibility Tests

All Staphylococcus spp. isolates were tested for antimicrobial susceptibility using the disk diffusion method, as reported by CLSI [50]. The following antimicrobial disks (Thermo Fisher Diagnostics) were employed: penicillin (10 U); amoxicillin–clavulanate (20/10 µg); cefoxitin (30 µg); ceftiofur (30 µg); chloramphenicol (30 µg); tetracycline (30 µg); enrofloxacin (5 µg); ciprofloxacin (5 µg); gentamicin (10 µg); amikacin (30 µg); trimethoprim–sulfamethoxazole (1.25/23.75 µg); erythromycin (15 µg); and rifampicin (5 µg). S. aureus ATCC 25923 and S. aureus ATCC 29213 were included as internal quality controls.
Additionally, for vancomycin resistance, MIC was evaluated with the broth microdilution method [51].
Staphylococcal strains that showed resistance or intermediate resistance to cefoxitin or penicillin by the disk diffusion assay were tested for methicillin resistance by assessing the MIC to oxacillin [51]. Staphylococcus aureus isolates showing an MIC ≥ 4 μg/mL were considered resistant, whereas S. pseudintermedius and CoNS isolates showing an MIC ≥ 1 μg/mL were classified as resistant [52].
All results were interpreted in accordance with CLSI guidelines [52,53] and EUCAST guidelines for Amikacin and Rifampicin [54].
The antimicrobial resistance profiles were evaluated to categorize the staphylococcal isolates as multidrug-resistant (MDR), extensively drug-resistant (XDR), and pandrug-resistant (PDR) [55].

4.4. Molecular Analyses

All Staphylococcus spp. strains were analyzed by a multiplex PCR to detect the genes eta and etb coding for the production of the exfoliative toxin [56].
Staphylococcus spp. strains found to be phenotypically non-susceptible to penicillin were analyzed by three uniplex PCRs to detect the genes blaZ, mecA, and mecC coding for resistance to beta-lactams [57,58,59]. The isolates testing positive for one mec gene were subjected to staphylococcal cassette chromosome mec (SCCmec) typing, as previously described [60].
Strains not susceptible to vancomycin were analyzed by the PCR method to detect the genes vanA and vanB [61].
For this purpose, DNA was extracted from overnight cultures of each isolate using the Quick-DNA Miniprep Plus Kit (Zymo Research, Irvine, CA, USA), according to the manufacturer’s instructions. DNA was promptly employed in PCR assays carried out in an automated thermal cycler (SimpliAmp™ Thermal Cycler, Applied Biosystems, Waltham, MA, USA). PCR reactions were assessed in a 25 µL final volume, containing 12.5 µL DreamTaq Hot Start Green Master Mix (Life Technologies Italia, Milan, Italy); 0.1 µM of each primer; 3 µL of extracted DNA; and ultrapure water to reach the final volume. Sterile distilled water was added as a negative control, whereas DNA extracted from previously characterized strains were employed as positive controls.
Each protocol had an initial denaturation at 95 °C for 5 min, followed by 40 cycles at 95 °C for 1 min, annealing (temperatures reported in Table 4) for 1 min, and 72 °C for 2 min; a final extension at 72 °C for 10 min completed the reaction. Primers and PCR conditions are summarized in Table 4. PCR products were run in 1.5% agarose gel at 100 V for 45 min, using 100 bp DNA Ladder Ready to Load (Solis BioDyne, Tartu, Estonia) as the DNA marker; the gel was stained with ethidium bromide and then observed under UV light.
Table 4. Primers and PCR conditions used for the molecular analyses of the Staphylococcus spp. isolates.
Table 4. Primers and PCR conditions used for the molecular analyses of the Staphylococcus spp. isolates.
Target
Gene		PrimersOligonucleotide Sequence
(5′–3′)		Annealing
Temperature (°C)		Amplicon
Size (bp)		Ref.
16S
rRNA		Staph756F
Staph750R		AACTCTGTTATTAGGGAAGAACA
CCACCTTCCTCCGGTTTGTCACC		58756[49]
nucNuc1
Nuc2		GCGATTGATGGTGATACGGTT
AGCCAAGCCTTGACGAACTAAAGC		58279[49]
etaetaF
etaR		ATATCAACGTGAGGGCTCTAGTAC
ATGCAGTCAGCTTCTTACTGCTA		521155[56]
etbetbF
etbR		CACACATTACGGATAATGCAAG
TCAACCGAATAGAGTGAACTTATCT		52604[56]
blaZbla-Z F
bla-Z R		CAGTTCACATGCCAAAGAG
TACACTCTTGGCGGTTTC		50772[57]
mecAMecA147F
MecA147R		GTGAAGATATACCAAGTGATT
ATGCGCTATAGATTGAAAGGAT		50147[58]
mecCmecLGA251F
mecLGA251R		GCTCCTAATGCTAATGCA
TAAGCAATAATGACTACC		50304[59]
vanAvanAF
vanAR		GGGAAAACGACAATTGC
GTACAATGCGGCCGTTA		54732[61]
vanBvanBF
vanBR		ATGGGAAGCCGATAGTC
GATTTCGTTCCTCGACC		54635[61]

4.5. Statistical Analysis

The chi-squared test was used to evaluate correlations among bacterial species, the anatomical site of isolation, sex, age, and antimicrobial resistance. A p-value < 0.05 was considered significant.

5. Conclusions

The hedgehog is a synanthropic wild species that can act as a possible source of pathogens, including antimicrobial-resistant bacteria, for humans and domestic animals. Furthermore, these animals, as well as other wild animals, can serve as bioindicators and sentinels of pathogens and antimicrobial-resistant bacteria circulating in a given habitat. Data in this study highlight the need to implement microbiological surveillance programs in wild and synanthropic animals to better monitor the evolution of antimicrobial resistance and consequently promote One Health policies. Such interventions must be based on the prudent use of antibiotics, in human and veterinary medicine, to limit the selection of resistant bacterial strains. Antimicrobial resistance must also be studied by identifying the genes coding for the various resistances, including the less frequent ones, since this genetic material can pass, more or less easily, from one bacterial strain to another.
In addition, the present findings confirmed wild animals as potential sources of zoonotic agents for wildlife rescue center staff. Anybody who intends to treat sick, injured, and/or orphaned wild animals may be at risk of infection. In particular, wildlife workers should be aware of this concern when manipulating live or dead hedgehogs; they should wear gloves made of sting-resistant material and avoid contamination from oral, respiratory, and conjunctival mucosae.

Author Contributions

Conceptualization, F.B. and V.V.E.; methodology, F.B. and V.V.E.; investigation, F.B., F.P., G.C., R.B. and R.C.; data curation, F.B., F.P., G.C. and V.V.E.; writing—original draft preparation, F.P. and V.V.E.; writing—review and editing, F.B. and V.V.E.; funding acquisition, V.V.E. All authors have read and agreed to the published version of the manuscript.

Funding

This research was funded by the University of Pisa, “Fondi Ateneo 2023”.

Institutional Review Board Statement

Ethical review and approval were waived for this study because no live animals were treated or sacrificed for the study. All analyses were carried out on animals found dead.

Informed Consent Statement

Not applicable.

Data Availability Statement

All data obtained during this study are reported in the present manuscript.

Conflicts of Interest

The authors declare no conflicts of interest.

References

  1. Arnold, K.E.; Williams, N.J.; Bennett, M. Disperse abroad in the land’: The role of wildlife in the dissemination of antimicrobial resistance. Biol. Lett. 2016, 12, 20160137. [Google Scholar] [CrossRef]
  2. Davoust, B.; Laidoudi, Y. Wildlife, Reservoir of Zoonotic Agents: Moving beyond Denial and Fear. Pathogens 2023, 12, 1081. [Google Scholar] [CrossRef]
  3. Hubert, P.; Julliard, R.; Biagianti, S.; Poulle, M.L. Ecological factors driving the higher hedgehog (Erinaceus europeaus) density in an urban area compared to the adjacent rural area. Landsc. Urban Plan. 2011, 103, 34–43. [Google Scholar] [CrossRef]
  4. Rasmussen, S.L.; Larsen, J.; Van Wijk, R.E.; Jones, O.R.; Berg, T.B.; Angen, O.; Larsen, A.R. European hedgehogs (Erinaceus europaeus) as a natural reservoir of methicillin-resistant Staphylococcus aureus carrying mecC in Denmark. PLoS ONE 2019, 14, e0222031. [Google Scholar] [CrossRef] [PubMed]
  5. Ruszkowski, J.J.; Hetman, M.; Turlewicz-Podbielska, H.; Pomorska-Mól, M. Hedgehogs as a Potential Source of Zoonotic Pathogens—A Review and an Update of Knowledge. Animals 2021, 11, 1754. [Google Scholar] [CrossRef]
  6. Aslam, B.; Khurshid, M.; Arshad, M.I.; Muzammil, S.; Rasool, M.; Yasmeen, N.; Shah, T.; Chaudhry, T.H.; Rasool, M.H.; Shahid, A.; et al. Antibiotic Resistance: One Health One World Outlook. Front. Cell. Infect. Microbiol. 2021, 11, 771510. [Google Scholar] [CrossRef]
  7. Smith, J.M.B.; Marples, M.J. A natural reservoir of penicillin-resistant strains of Staphylococcus aureus. Nature 1964, 201, 844. [Google Scholar] [CrossRef]
  8. Bengtsson, B.; Persson, L.; Ekström, K.; Unnerstad, H.E.; Uhlhorn, H.; Börjesson, S. High occurrence of mecC-MRSA in wild hedgehogs (Erinaceus europaeus) in Sweden. Vet. Microbiol. 2017, 207, 103–107. [Google Scholar] [CrossRef]
  9. Dube, F.; Söderlund, R.; Lampinen Salomonsson, M.; Troell, K.; Börjesson, S. Benzylpenicillin-producing Trichophyton erinacei and methicillin resistant Staphylococcus aureus carrying the mecC gene on European hedgehogs—A pilot-study. BMC Microbiol. 2021, 21, 212. [Google Scholar] [CrossRef]
  10. Monecke, S.; Gavier-Widen, D.; Mattsson, R.; Rangstrup-Christensen, L.; Lazaris, A.; Coleman, D.C.; Shore, A.C.; Ehricht, R. Detection of mecC-Positive Staphylococcus aureus (CC130-MRSA-XI) in Diseased European Hedgehogs (Erinaceus europaeus) in Sweden. PLoS ONE 2013, 8, e66166. [Google Scholar] [CrossRef]
  11. Monecke, S.; Gavier-Widén, D.; Hotzel, H.; Peters, M.; Guenther, S.; Lazaris, A.; Loncaric, I.; Müller, E.; Reissig, A.; Ruppelt-Lorz, A.; et al. Diversity of Staphylococcus aureus Isolates in European Wildlife. PLoS ONE 2016, 11, 168433. [Google Scholar] [CrossRef] [PubMed]
  12. Loncaric, I.; Kübber-Heiss, A.; Posautz, A.; Ruppitsch, W.; Lepuschitz, S.; Schauer, B.; Feßler, A.T.; Krametter-Frötscher, R.; Harrison, E.M.; Holmes, M.A.; et al. Characterization of mecC gene-carrying coagulase-negative Staphylococcus spp. isolated from various animals. Vet. Microbiol. 2019, 230, 138–144. [Google Scholar] [CrossRef] [PubMed]
  13. Sahin-Tóth, J.; Albert, E.; Juhász, A.; Ghidán, Á.; Juhász, J.; Horváth, A.; Steward, M.C.; Dobay, O. Prevalence of Staphylococcus aureus in wild hedgehogs (Erinaceus europaeus) and first report of mecC-MRSA in Hungary. Sci. Total Environ. 2022, 815, 152858. [Google Scholar] [CrossRef] [PubMed]
  14. Haenni, M.; Murri, S.; Lefrère, C.; Larsen, J.; Drapeau, A.; Botman, J.; François, P.; Gourlay, P.; Meurens, F.; Madec, J.Y. Methicillin-resistant and methicillin-susceptible Staphylococcus aureus in French hedgehogs admitted to a wildlife health center. One Health 2024, 19, 100938. [Google Scholar] [CrossRef]
  15. Dordet-Frisoni, E.; Dorchies, G.; De Araujo, C.; Talon, R.; Leroy, S. Genomic Diversity in Staphylococcus xylosus. Appl. Environ. Microbiol. 2007, 73, 7199. [Google Scholar] [CrossRef]
  16. Hedin, G.; Widerström, M. Endocarditis due to Staphylococcus sciuri. Eur. J. Clin. Microbiol. Infect. Dis. 1998, 17, 673–675. [Google Scholar] [CrossRef]
  17. Stepanović, S.; Ježek, P.; Dakić, I.; Vuković, D.; Seifert, L. Staphylococcus sciuri: An unusual cause of pelvic inflammatory disease. Int. J. STD AIDS 2005, 16, 452–453. [Google Scholar] [CrossRef]
  18. Wallet, F.; Stuit, L.; Boulanger, E.; Roussel-Del Vallez, M.; Dequiedt, P.; Courcol, R.J. Peritonitis due to Staphylococcus sciuri in a patient on continuous ambulatory peritoneal dialysis. Scand. J. Infect. Dis. 2000, 32, 697–698. [Google Scholar] [CrossRef]
  19. Horii, T.; Suzuki, Y.; Kimura, T.; Kanno, T.; Maekawa, M. Intravenous catheter-related septic shock caused by Staphylococcus sciuri and Escherichia vulneris. Scand. J. Infect. Dis. 2001, 33, 930–932. [Google Scholar] [CrossRef]
  20. Martel, A.; Boyen, F.; Rau, J.; Eisenberg, T.; Sing, A.; Berger, A.; Chiers, K.; Van Praet, S.; Verbanck, S.; Vervaeke, M.; et al. Widespread Disease in Hedgehogs (Erinaceus europaeus) Caused by Toxigenic Corynebacterium ulcerans. Emerg. Infect. Dis. 2021, 27, 2686. [Google Scholar] [CrossRef]
  21. Han, J.I.; Lee, S.J.; Jang, H.J.; Kim, J.H.; Na, K.J. Isolation of Staphylococcus simulans from Dermatitis in a Captive African Pygmy Hedgehog. J. Zoo Wildl. Med. 2011, 42, 277–280. [Google Scholar] [CrossRef]
  22. Mørk, T.; Jørgensen, H.J.; Sunde, M.; Kvitle, B.; Sviland, S.; Waage, S.; Tollersrud, T. Persistence of staphylococcal species and genotypes in the bovine udder. Vet. Microbiol. 2012, 159, 171–180. [Google Scholar] [CrossRef] [PubMed]
  23. Garcês, A.; Poeta, P.; Soeiro, V.; Lóio, S.; Cardoso-Gomes, A.; Torres, C.; Pires, I. Pyometra Caused by Staphylococcus lentus in a Wild European Hedgehog (Erinaceus europaeus). J. Wildl. Dis. 2019, 55, 724–727. [Google Scholar] [CrossRef] [PubMed]
  24. Rautio, A.; Isomursu, M.; Valtonen, A.; Hirvelä-Koski, V.; Kunnasranta, M. Mortality, diseases and diet of European hedgehogs (Erinaceus europaeus) in an urban environment in Finland. Mammal Res. 2016, 61, 161–169. [Google Scholar] [CrossRef]
  25. Aarestrup, F.M.; Jensen, L.B. Trends in antimicrobial susceptibility in relation to antimicrobial usage and presence of resistance genes in Staphylococcus hyicus isolated from exudative epidermitis in pigs. Vet. Microbiol. 2002, 89, 83–94. [Google Scholar] [CrossRef]
  26. Becker, K.; Heilmann, C.; Peters, G. Coagulase-negative staphylococci. Clin. Microbiol. Rev. 2014, 27, 870–926. [Google Scholar] [CrossRef]
  27. Malachowa, N.; Deleo, F.R. Mobile genetic elements of Staphylococcus aureus. Cell. Mol. Life Sci. 2010, 67, 3057–3071. [Google Scholar] [CrossRef]
  28. Brdová, D.; Ruml, T.; Viktorová, J. Mechanism of staphylococcal resistance to clinically relevant antibiotics. Drug Resist. Updat. 2024, 77, 101147. [Google Scholar] [CrossRef]
  29. Concepción Porrero, M.; Valverde, A.; Fernández-Llario, P.; Díez-Guerrier, A.; Mateos, A.; Lavín, S.; Cantón, R.; Fernández-Garayzabal, J.F.; Domínguez, L. Staphylococcus aureus Carrying mecC Gene in Animals and Urban Wastewater, Spain. Emerg. Infect. Dis. 2014, 20, 899. [Google Scholar] [CrossRef]
  30. Lade, H.; Kim, J.S. Molecular Determinants of β-Lactam Resistance in Methicillin-Resistant Staphylococcus aureus (MRSA): An Updated Review. Antibiotics 2023, 12, 1362. [Google Scholar] [CrossRef]
  31. Yamaguchi, T.; Ono, D.; Sato, A. Staphylococcal cassette chromosome mec (SCCmec) analysis of MRSA. Methods Mol. Biol. 2020, 2069, 59–78. [Google Scholar]
  32. Røken, M.; Iakhno, S.; Haaland, A.H.; Bjelland, A.M.; Wasteson, Y. The Home Environment Is a Reservoir for Methicillin-Resistant Coagulase-Negative Staphylococci and Mammaliicocci. Antibiotics 2024, 13, 279. [Google Scholar] [CrossRef]
  33. Abdullahi, I.N.; Lozano, C.; González-Azcona, C.; Zarazaga, M.; Torres, C. Genetic Diversification and Resistome of Coagulase-Negative Staphylococci from Nostrils of Healthy Dogs and Dog-Owners in La Rioja, Spain. Pathogens 2024, 13, 229. [Google Scholar] [CrossRef] [PubMed]
  34. Wolska-Gębarzewska, M.; Międzobrodzki, J.; Kosecka-Strojek, M. Current types of staphylococcal cassette chromosome mec (SCCmec) in clinically relevant coagulase-negative staphylococcal (CoNS) species. Crit. Rev. Microbiol. 2023, 50, 1020–1036. [Google Scholar] [CrossRef] [PubMed]
  35. Couto, I.; De Lencastre, H.; Severina, E.; Kloos, W.; Webster, J.A.; Hubner, R.J.; Sanches, I.S.; Tomasz, A. Ubiquitous presence of a mecA homologue in natural isolates of Staphylococcus sciuri. Microb. Drug Resist. 1996, 2, 377–391. [Google Scholar] [CrossRef] [PubMed]
  36. Olsen, J.E.; Christensen, H.; Aarestrup, F.M. Diversity and evolution of blaZ from Staphylococcus aureus and coagulase-negative staphylococci. J. Antimicrob. Chemother. 2006, 57, 450–460. [Google Scholar] [CrossRef]
  37. Mama, O.M.; Ruiz-Ripa, L.; Lozano, C.; González-Barrio, D.; Ruiz-Fons, J.F.; Torres, C. High diversity of coagulase negative staphylococci species in wild boars, with low antimicrobial resistance rates but detection of relevant resistance genes. Comp. Immunol. Microbiol. Infect. Dis. 2019, 64, 125–129. [Google Scholar] [CrossRef]
  38. Rey Pérez, J.; Zálama Rosa, L.; García Sánchez, A.; Hermoso de Mendoza Salcedo, J.; Alonso Rodríguez, J.M.; Cerrato Horrillo, R.; Zurita, S.G.; Gil Molino, M. Multiple Antimicrobial Resistance in Methicillin-Resistant Staphylococcus sciuri Group Isolates from Wild Ungulates in Spain. Antibiotics 2021, 10, 920. [Google Scholar] [CrossRef]
  39. Ruiz-Ripa, L.; Gómez, P.; Alonso, C.A.; Camacho, M.C.; Ramiro, Y.; de la Puente, J.; Fernández-Fernández, R.; Quevedo, M.Á.; Blanco, J.M.; Báguena, G.; et al. Frequency and Characterization of Antimicrobial Resistance and Virulence Genes of Coagulase-Negative Staphylococci from Wild Birds in Spain. Detection of tst-Carrying S. sciuri Isolates. Microorganisms 2020, 8, 1317. [Google Scholar] [CrossRef]
  40. Du, J.; Liu, Q.; Pan, Y.; Xu, S.; Li, H.; Tang, J. The Research Status, Potential Hazards and Toxicological Mechanisms of Fluoroquinolone Antibiotics in the Environment. Antibiotics 2023, 12, 1058. [Google Scholar] [CrossRef]
  41. Zhou, X.; Chen, C.; Yue, L.; Sun, Y.; Ding, H.; Liu, Y. Excretion of enrofloxacin in pigs and its effect on ecological environment. Environ. Toxicol. Pharmacol. 2008, 26, 272–277. [Google Scholar] [CrossRef]
  42. Venla, J.; Ahmad, A.M.; Viivi, H.; Laura, L.; Saara, S.; Sanna, S.; Annamari, H. Clonal dissemination of successful emerging clone mecA-MRSA t304/ST6 among humans and hedgehogs in the Helsinki metropolitan area in Finland. One Health 2023, 16, 100516. [Google Scholar] [CrossRef] [PubMed]
  43. Futagawa-Saito, K.; Makino, S.; Sunaga, F.; Kato, Y.; Sakurai-Komada, N.; Ba-Thein, W.; Fukuyasu, T. Identification of first exfoliative toxin in Staphylococcus pseudintermedius. FEMS Microbiol. Lett. 2009, 301, 176–180. [Google Scholar] [CrossRef] [PubMed]
  44. Fazal, M.A.; Rana, E.A.; Akter, S.; Alim, M.A.; Barua, H.; Ahad, A. Molecular identification, antimicrobial resistance and virulence gene profiling of Staphylococcus spp. associated with bovine sub-clinical mastitis in Bangladesh. Vet. Anim. Sci. 2023, 21, 100297. [Google Scholar] [CrossRef] [PubMed]
  45. Imanishi, I.; Nicolas, A.; Barbosa Caetano, A.C.; de Paula Castro, T.L.; Tartaglia, N.R.; Mariutti, R.; Guédon, E.; Even, S.; Berkova, N.; Arni, R.K.; et al. Author Correction: Exfoliative toxin E, a new Staphylococcus aureus virulence factor with host-specific activity. Sci Rep. 2020, 10, 2460, Erratum in Sci. Rep. 2019, 9, 16336. https://doi.org/10.1038/s41598-019-52777-3. [Google Scholar] [CrossRef]
  46. Mariutti, R.B.; Tartaglia, N.R.; Seyffert, N.; de Paula Castro, T.L.; Arni, R.K.; Azevedo, V.A.; Le Loir, Y.; Nishifuji, K. Exfoliative Toxins of Staphylococcus aureus. In The Rise of Virulence and Antibiotic Resistance in Staphylococcus aureus; InTech: London, UK, 2017. [Google Scholar] [CrossRef]
  47. Cong, Y.; Yang, S.; Rao, X. Vancomycin resistant Staphylococcus aureus infections: A review of case updating and clinical features. J Adv. Res. 2019, 21, 169–176. [Google Scholar] [CrossRef]
  48. Haigh, A.; Kelly, M.; Butler, F.; O’Riordan, R.M. Non-invasive methods of separating hedgehog (Erinaceus europaeus) age classes and an investigation into the age structure of road kill. Acta Theriol. 2014, 59, 165–171. [Google Scholar] [CrossRef]
  49. Zhang, K.; Sparling, J.; Chow, B.L.; Elsayed, S.; Hussain, Z.; Church, D.L.; Gregson, D.B.; Louie, T.; Conly, J.M. New Quadriplex PCR Assay for Detection of Methicillin and Mupirocin Resistance and Simultaneous Discrimination of Staphylococcus aureus from Coagulase-Negative Staphylococci. J. Clin. Microbiol. 2004, 42, 4947. [Google Scholar] [CrossRef]
  50. CLSI, (Clinical and Laboratory Standards Institute). Performance Standards for Antimicrobial Disk Susceptibility Tests, 13th ed.; CLSI Standard M02; Clinical and Laboratory Standards Institute: Wayne, PA, USA, 2018. [Google Scholar]
  51. CLSI, (Clinical and Laboratory Standards Institute). Methods for Dilution Antimicrobila Susceptibility Tests for Bacteria That Grow Aerobically, 11th ed.; CLSI Standard M07; Clinical and Laboratory Standards Institute: Wayne, PA, USA, 2018. [Google Scholar]
  52. CLSI, (Clinical and Laboratory Standards Institute). M100 Performance Standards for Antimicrobial Susceptibility Testing a CLSI Supplement for Global Application, 33th ed.; CLSI Supplement M100; Clinical and Laboratory Standards Institute: Wayne, PA, USA, 2023. [Google Scholar]
  53. CLSI, (Clinical and Laboratory Standards Institute). Performance Standards for Antimicrobial Disk and Dilution Susceptibility Tests for Bacteria Isolated from Animals, 5th ed.; CLSI Supplement VET01S; Clinical and Laboratory Standars Institute: Wayne, PA, USA, 2020. [Google Scholar]
  54. EUCAST, (The European Committee on Antimicrobial Susceptibility Testing). Breakpoint Tables for Interpretation of MICs and Zone Diameters. Version 15.0; EUCAST: Växjö, Sweden, 2025. [Google Scholar]
  55. Magiorakos, A.P.; Srinivasan, A.; Carey, R.B.; Carmeli, Y.; Falagas, M.E.; Giske, C.G.; Harbarth, S.; Hindler, J.F.; Kahlmeter, G.; Olsson-Liljequist, B.; et al. Multidrug-resistant, extensively drug-resistant and pandrug-resistant bacteria: An international expert proposal for interim standard definitions for acquired resistance. Clin. Microbiol. Infect. 2012, 18, 268–281. [Google Scholar] [CrossRef]
  56. Noguchi, N.; Nakaminami, H.; Nishijima, S.; Kurokawa, I.; So, H.; Sasatsu, M. Antimicrobial agent of susceptibilities and antiseptic resistance gene distribution among methicillin-resistant Staphylococcus aureus isolates from patients with impetigo and staphylococcal scalded skin syndrome. J. Clin. Microbiol. 2006, 44, 2119–2125. [Google Scholar] [CrossRef]
  57. Schnellmann, C.; Gerber, V.; Rossano, A.; Jaquier, V.; Panchaud, Y.; Doherr, M.G.; Thomann, A.; Straub, R.; Perreten, V. Presence of New mecA and mph(C) Variants Conferring Antibiotic Resistance in Staphylococcus spp. Isolated from the Skin of Horses before and after Clinic Admission. J. Clin. Microbiol. 2006, 44, 4444. [Google Scholar] [CrossRef]
  58. Zhang, K.; McClure, J.A.; Elsayed, S.; Louie, T.; Conly, J.M. Novel multiplex PCR assay for characterization and concomitant subtyping of staphylococcal cassette chromosome mec types I to V in methicillin-resistant Staphylococcus aureus. J. Clin. Microbiol. 2005, 43, 5026–5033. [Google Scholar] [CrossRef]
  59. Cuny, C.; Layer, F.; Strommenger, B.; Witte, W. Rare Occurrence of Methicillin-Resistant Staphylococcus aureus CC130 with a Novel mecA Homologue in Humans in Germany. PLoS ONE 2011, 6, e24360. [Google Scholar] [CrossRef]
  60. Kondo, Y.; Ito, T.; Ma, X.X.; Watanabe, S.; Kreiswirth, B.N.; Etienne, J.; Hiramatsu, K. Combination of Multiplex PCRs for Staphylococcal Cassette Chromosome mec Type Assignment: Rapid Identification System for mec, ccr, and Major Differences in Junkyard Regions. Antimicrob. Agents Chemother. 2007, 51, 264. [Google Scholar] [CrossRef]
  61. Dutka-Malen, S.; Evers, S.; Courvalin, P. Detection of glycopeptide resistance genotypes and identification to the species level of clinically relevant enterococci by PCR. J. Clin. Microbiol. 1995, 33, 24. [Google Scholar] [CrossRef]
Table 1. Morphometric data, age, and gender of the tested hedgehogs.
Table 1. Morphometric data, age, and gender of the tested hedgehogs.
HedgehogsSexAgeBody Length
(cm)		Hindfoot Length
(cm)		Jaw Length
(cm)		Body Weight
(g)
H1MJ122.41.365.97
H2FA163.62.5377
H3MA193.63.3427.30
H4FJ132.71.792.13
H5FA193.62.5345.7
H6FA234.34734.77
H7MA19.53.93.7554.56
H8MA22.543425.74
H9MA2643.5662.40
H10MA244.32.5571.24
H11MA203.94611.70
H12FA2244.3574
H13FA213.84.2469
H14FA234,53.8540.50
H15MA244.04.0638
H16FA203.63750.68
H17FA19.53.63400
H18MJ122.52.487.27
Legend. M: male; F: female; J: juvenile; A: adult.
Table 2. Staphylococcal species, resistance profiles, and antimicrobials genes detected.
Table 2. Staphylococcal species, resistance profiles, and antimicrobials genes detected.
SamplesStaphylococcal
Species		Resistance ProfileResistance
Class		Oxacillin
MIC		blaZmecAmecCvanA/
vanB
H1AS. sciuriP 1 *−+−NE
H1BS. epidermidisP FOX C ENR CN SXT EXDR1 *++−NE
H1CS. epidermidisP AMC FOX C ENR CIP CN SXT EXDR1 *++−NE
H2AS. sciuriP RD VAMDR1 *−+−−
H2BS. xylosusP E RDMDR0.25−−−NE
H2CS. xylosusE NENENENENE
H3AS. xylosusP RD 0.5−−−NE
H3BS. xylosusP RD 0.25−−−NE
H3CS. sciuri NENENENENE
H4AS. xylosusP RD 0.25−−−NE
H4BS. sciuri NENENENENE
H4CS. sciuriP 0.5−−−NE
H5AS. sciuri NENENENENE
H5BS. lentusTE NENENENENE
H5CS. xylosusP C TE ENR CIPMDR0.5−−−NE
H6AS. aureusVA NENENENE−
H6BS. aureus NENENENENE
H6C1S. aureusRD NENENENENE
H6C2S. hyicus NENENENENE
H7AS. simulans NENENENENE
H7BS. simulans NENENENENE
H7CS. simulans NENENENENE
H8AS. aureusP AMC FOX EFT 4 *−−−NE
H8BS. aureusP AMC FOX EFT 0.5−−−NE
H8CS. simulans NENENENENE
H9AS. aureusRD NENENENENE
H9BS. xylosusP 0.5−−−NE
H9CS. pseudintermediusP 0.5−−−−
H10AS. chromogenes NENENENENE
H10BS. chromogenesRD NENENENENE
H10CS. chromogenes NENENENENE
H11AS. xylosusP RD 0.25−−−NE
H11BS. xylosus NENENENENE
H11CS. hyicus NENENENENE
H12AS. xylosusRD NENENENENE
H12BS. xylosusP 0.5−−−−
H12CS. xylosusP E RDMDR0.5−−−NE
H13AS. xylosusP C TE ENR CIP EMDR≤0.125−−−NE
H13BS. xylosusP C TE ENR CIPMDR≤0.125−−−NE
H14AS. sciuriP TE 1 *−+−NE
H14BS. xylosusP RD 0.5−−−NE
H14CS. pseudintermediusP 0.5−−−NE
H15AS. pseudintermediusRD NENENENENE
H15BS. pseudintermediusRD NENENENENE
H15CS. pseudintermediusRD NENENENENE
H16AS. aureusP AMC FOX EFT 8 *−−−NE
H16BS. aureusP AMC FOX EFT 16 *−−−NE
H16CS. xylosusP FOX EFT CN AK RDMDR0.5−−−NE
H17AS. chromogenesP FOX RDMDR1 *−+−NE
H17BS. aureus NENENENENE
H17CS. simulans NENENENENE
H18AS. pseudintermediusP FOX EFT AK RDMDR≤0.125−− NE
H18BS. chromogenesP 1 *−+−NE
H18CS. sciuriP 1 *−+−NE
Legend. H: hedgehog; A: oral swab; B: nasal swab; C: intestine; P: penicillin, AMC: amoxicillin–clavulanate, FOX: cefoxitin, EFT: ceftiofur, C: chloramphenicol, TE: tetracycline, ENR: enrofloxacin, CIP: ciprofloxacin, CN: gentamicin, AK: amikacin, SXT: trimethoprim–sulfamethoxazole, E: erythromycin, RD: rifampicin; VA: vancomycin; MDR: multidrug- resistant; XDR: extensively drug-resistant; *: methicillin resistant; +: PCR positive; −: PCR negative; NE: not evaluated.
Table 3. Results of the disk diffusion test carried out on 54 Staphylococcus spp. isolates.
Table 3. Results of the disk diffusion test carried out on 54 Staphylococcus spp. isolates.
Antimicrobial
Class		MoleculeSusceptibleIntermediateResistantNot Susceptible
n. of
Isolates		%n. of
Isolates		%n. of
Isolates		%n. of
Isolates		%
penicillinsP2546.3000.002953.702953.70
AMC4990.7400.0059.2659.26
cephalosporinsFOX4583.3300.00916.67916.67
EFT4379.6359.26611.111120.37
phenicolsC4277.78712.9659.261222.22
tetracyclinesTE4481.4859.2659.261018.52
fluoroquinolonesENR2750.002240.7459.262750.00
CIP3870.371222.2247.411629.63
aminoglycosidesCN4990.7423.7035.5659.26
AK5296.3000.0023.7023.70
sulfonamidesSXT5194.4411.8623.7035.56
macrolidesE814.814074.08611.114685.19
ansamycinRD2851.85814.811833.342648.15
Legend. P: penicillin, AMC: amoxicillin–clavulanate, FOX: cefoxitin, EFT: ceftiofur, C: chloramphenicol, TE: tetracycline, ENR: enrofloxacin, CIP: ciprofloxacin, CN: gentamicin, AK: amikacin, SXT: trimethoprim–sulfamethoxazole, E: erythromycin, RD: rifampicin.
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Bertelloni, F.; Pauselli, F.; Cagnoli, G.; Biscontri, R.; Ceccherelli, R.; Ebani, V.V. Antimicrobial-Resistant Staphylococcus spp. Harbored by Hedgehogs (Erinaceus europaeus) in Central Italy. Antibiotics 2025, 14, 725. https://doi.org/10.3390/antibiotics14070725

AMA Style

Bertelloni F, Pauselli F, Cagnoli G, Biscontri R, Ceccherelli R, Ebani VV. Antimicrobial-Resistant Staphylococcus spp. Harbored by Hedgehogs (Erinaceus europaeus) in Central Italy. Antibiotics. 2025; 14(7):725. https://doi.org/10.3390/antibiotics14070725

Chicago/Turabian Style

Bertelloni, Fabrizio, Francesca Pauselli, Giulia Cagnoli, Roberto Biscontri, Renato Ceccherelli, and Valentina Virginia Ebani. 2025. "Antimicrobial-Resistant Staphylococcus spp. Harbored by Hedgehogs (Erinaceus europaeus) in Central Italy" Antibiotics 14, no. 7: 725. https://doi.org/10.3390/antibiotics14070725

APA Style

Bertelloni, F., Pauselli, F., Cagnoli, G., Biscontri, R., Ceccherelli, R., & Ebani, V. V. (2025). Antimicrobial-Resistant Staphylococcus spp. Harbored by Hedgehogs (Erinaceus europaeus) in Central Italy. Antibiotics, 14(7), 725. https://doi.org/10.3390/antibiotics14070725

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop