Next Article in Journal
The Availability of Essential Antimicrobials in Public and Private Sector Facilities: A Cross-Sectional Survey in a District of North India
Next Article in Special Issue
Molecular Evolution and Pathogenicity of Methicillin-Resistant Staphylococcus aureus
Previous Article in Journal
Is the Use of Monensin Another Trojan Horse for the Spread of Antimicrobial Resistance?
Previous Article in Special Issue
The Role of Prophage ϕSa3 in the Adaption of Staphylococcus aureus ST398 Sublineages from Human to Animal Hosts
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Antibiotics
Volume 13
Issue 2
10.3390/antibiotics13020130
antibiotics-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Methicillin Resistance Elements in the Canine Pathogen Staphylococcus pseudintermedius and Their Association with the Peptide Toxin PSM-mec

by
Gordon Y. C. Cheung
1,
Ji Hyun Lee
1,
Ryan Liu
1,
Sara D. Lawhon
2,
Ching Yang
3 and
Michael Otto
1,*
1
Pathogen Molecular Genetics Section, Laboratory of Bacteriology, National Institute of Allergy and Infectious Diseases (NIAID), US National Institutes of Health (NIH), Bethesda, MD 20892, USA
2
Department of Veterinary Pathobiology, College of Veterinary Medicine and Biomedical Sciences, Texas A&M University, College Station, TX 77843, USA
3
Department of Veterinary Biomedical Sciences, College of Veterinary Medicine, Long Island University, Brookville, NY 11548, USA
*
Author to whom correspondence should be addressed.
Antibiotics 2024, 13(2), 130; https://doi.org/10.3390/antibiotics13020130
Submission received: 11 January 2024 / Revised: 23 January 2024 / Accepted: 25 January 2024 / Published: 28 January 2024
(This article belongs to the Special Issue Molecular Evolution and Pathogenicity of Methicillin-Resistant Staphylococcus aureus)
Browse Figures
Review Reports Versions Notes

Abstract

:
Staphylococcus pseudintermedius is a frequent cause of infections in dogs. Infectious isolates of this coagulase-positive staphylococcal species are often methicillin- and multidrug-resistant, which complicates therapy. In staphylococci, methicillin resistance is encoded by determinants found on mobile genetic elements called Staphylococcal Chromosome Cassette mec (SCCmec), which, in addition to methicillin resistance factors, sometimes encode additional genes, such as further resistance factors and, rarely, virulence determinants. In this study, we analyzed SCCmec in a collection of infectious methicillin-resistant S. pseudintermedius (MRSP) isolates from predominant lineages in the United States. We found that several lineages characteristically have specific types of SCCmec elements and Agr types and harbor additional factors in their SCCmec elements that may promote virulence or affect DNA uptake. All isolates had SCCmec-encoded restriction–modification (R-M) systems of types I or II, and sequence types (STs) ST84 and ST64 had one type II and one type I R-M system, although the latter lacked a complete methylation enzyme gene. ST68 isolates also had an SCCmec-encoded CRISPR system. ST71 isolates had a psm-mec gene, which, in all but apparently Agr-dysfunctional isolates, produced a PSM-mec peptide toxin, albeit at relatively small amounts. This study gives detailed insight into the composition of SCCmec elements in infectious isolates of S. pseudintermedius and lays the genetic foundation for further efforts directed at elucidating the contribution of identified accessory SCCmec factors in impacting SCCmec-encoded and thus methicillin resistance-associated virulence and resistance to DNA uptake in this leading canine pathogen.

1. Introduction

Staphylococcus pseudintermedius is, like Staphylococcus aureus and in contrast to many other non-S. aureus staphylococci, a coagulase-positive Staphylococcus species. It is a member of the animal pathogen Staphylococcus intermedius group (SIG) [1]. S. pseudintermedius is considered a significant opportunistic pathogen of dogs [2], where it is responsible for causing a variety of diseases, such as pyoderma (characterized as skin and soft tissue infections that scale in severity), and infections of the urinary tract and external ear canal [3]. Dog-biting incidents of humans by colonized or infected animals [4] can lead to the zoonotic transmission of S. pseudintermedius, including methicillin-resistant S. pseudintermedius (MRSP), to humans [5,6]. Since the first reports of MRSP in 2005 [7], there has been a sharp rise in multidrug resistance amongst MRSP isolates [2], making routine treatment of the aforementioned diseases much more challenging for dogs and their owners [8]. The factors that underlie the success of some S. pseudintermedius lineages as canine pathogens remain mostly unknown.
Undisputedly, resistance to methicillin (a beta-lactam antibiotic) is the most important antibiotic resistance determinant in staphylococci and is linked to the acquisition of a mobile genetic element called Staphylococcal Chromosome Cassette mec (SCCmec). Resistance to methicillin is afforded by the production of the low-affinity penicillin binding protein 2A (PBP2A) [9], encoded by the mecA gene found within the mec gene complex, one of two defining hallmark composites of the SCCmec element. The second composite is the cassette chromosome recombinase (ccr) gene complex, which harbors ccr genes responsible for the integration of the element. The mec and ccr gene complexes are separated by three non-essential J (formally known as junkyard) regions [10] that harbor other antibiotic and metal resistance genes. A classification system originally established to distinguish S. aureus SCCmec elements is based on permutations, gene variants, and the presence or absence of genes [11,12]. However, the recent molecular typing and characterization of SCCmec elements from staphylococcal species other than S. aureus have reported exceedingly complex compositions that do not conform to the original typing scheme, for which S. pseudintermedius is an excellent example [13,14,15,16,17,18,19,20,21]. In such instances, the use of SCCmec followed by the name of the strain has been proposed [11].
The whole-genome sequencing (WGS) of several dominant lineages has provided important clues about the molecular epidemiology and biological characteristics of S. pseudintermedius [22,23]. Currently, more than half of all isolates collected in the United States belong to sequence type (ST) 71, which is also expanding globally [20]. Although ST71 is dominant in the US, several other S. pseudintermedius lineages are also prevalent, including ST64, ST68, and ST84 [24].
Similar to its pathogenic human cousin, S. aureus, S. pseudintermedius harbors an impressive number of genes that encode a variety of virulence determinants, such as immune-evasion proteins [2,25] and a plethora of toxins including an exfoliative toxin [26,27], a bicomponent leucocidin [28], a superantigen [29], and several peptide toxins of the phenol-soluble modulin (PSM) superfamily [30]. PSMs possess similar alpha-helical and amphipathic secondary structures, despite lacking any significant amino acid identity [31], and play significant roles in the pathogenesis of S. aureus and the opportunistic pathogen S. epidermidis, mediated by their pro-inflammatory, cytolytic, and biofilm-structuring functions [32,33,34,35]. In many staphylococci, it has been shown that the regulation of most virulence determinants is dependent on the presence of the agr (accessory gene regulator) locus. This locus codes for a classical two-component signal transduction system and a regulatory RNA (RNAIII) that controls the transcription of virulence genes and often also contains the PSM δ-toxin gene [36,37].
First described in S. aureus, the psm-mec locus encoding the methicillin resistance-associated PSM, PSM-mec, is found on the class A mec gene complex of specific SCCmec elements (belonging to types II, III, and VIII) of many staphylococcal species [38,39,40]. The psm-mec gene is embedded in a DNA sequence coding for a small regulatory (sr) RNA, next to the mecI/mecR1/mecA genes [41,42] and, as demonstrated in S. aureus, is under RNA-independent control by Agr like the other PSMs [43,44]. To date, the contribution of the psm-mec locus towards virulence has only been investigated in S. aureus and S. epidermidis. In S. aureus, deletion of the psm-mec gene only impacts the virulence of isolates expressing greater levels of PSM-mec compared to other PSMs [40], indicating that PSM-mec may influence pathogenesis only in certain backgrounds. In contrast, S. epidermidis pathogenesis is strongly dependent on PSM-mec expression [45]. In addition to the likely importance of the relative production of PSM-mec as compared to other strongly cytolytic PSMs, these differences may be a result of the additional level of transcriptional control by the psm-mec srRNA [42]. Genomic comparisons of different S. pseudintermedius lineages have revealed the presence of the psm-mec gene predominantly in SCCmec type III elements [13,38], but no studies have determined whether these isolates are capable of producing the peptide. In S. pseudintermedius, the type III SCCmec element is mostly associated with MRSP sequence type (ST) 71.
In this study, we sought to characterize SCCmec elements from MRSP isolates representing the four major lineages within the United States in detail to further expand our current knowledge of what may explain their current expansion in North America. To that end, we also determined the production of PSM-mec in S. pseudintermedius and report that PSM-mec is expressed in specific methicillin-resistant isolates of that species.

2. Results

2.1. Selection of Isolates for SCCmec Characterization

In our previous study, 160 clinical S. pseudintermedius isolates from canines were whole-genome-sequenced [24] and their genomes were examined for the presence of antimicrobial resistance genes and the prevalence of virulence genes. As the problem of multidrug-resistant (MDR) S. pseudintermedius infections has become particularly prevalent in veterinary clinics, we sought to characterize MRSP isolates from this collection. These isolates were collected prior to 2013. Our previous work determined that the presence of the mecA gene varied between each ST/Agr group [24]. For instance, the mecA carriage rate for ST84/Agr group I, ST64/Agr group II, ST71/Agr group III, and ST68/Agr group IV were 45% (5/11), 18% (9/50), 34% (15/44), and 42% (23/55), respectively (Table 1); the total number of mecA-positive isolates was only 32%.
For this study, we focused on a smaller number of MRSP isolates for SCCmec characterization and subsequent analysis of PSM-mec production using the following isolate selection process: We chose approximately 50% of the mecA-positive isolates for each ST/Agr group and in a manner in which each group contained at least one isolate from pyoderma, urinary tract, or surgical wound infections (Table 1). This resulted in the selection of 5-12 mecA-positive isolates from various sources for each group. As the number of MRSP isolates from ST84/Agr group I was small (n = 5), all five available isolates were selected for that group. Among the isolates, two were from healthy animals. Isolates 37-032, 32-012, and the whole-genome-sequenced strain, ED99, were chosen as methicillin-sensitive (MSSP) controls. In summary, we included 29 MRSP isolates and three methicillin-sensitive S. pseudintermedius (MSSP) isolates in this study. As expected, all MRSP isolates demonstrated phenotypic resistance to oxacillin (>0.25 µg/mL) and penicillin (≥8 µg/mL) as evidenced by MIC (Table 1), while isolates 37-032, 32-012, and ED99 were oxacillin-sensitive.

2.2. Characterization of SCCmec Elements

The prediction and characterization of SCCmec types in our selected cohort of 29 MRSP isolates [24] were initiated with the online resource, SCCmecFinder 1.2, (https://cge.food.dtu.dk/services/SCCmecFinder-1.2/, accessed on 27 September 2023) [46]. SCCmecFinder determined that all the submitted MRSP WGS sequences contained the mecA gene. However, it was only able to assign an SCCmec type for six out of seven ST71/Agr group III isolates and 11 out of 12 ST68/Agr group IV isolates (Table 1). A closer inspection of the whole-genome sequences of the non-typable isolates showed that the genes associated with the mec and ccr markers were spread across multiple contigs. Short-read sequencing technology, which was used at the time, often presents problems with full assembly of the entire SCCmec sequence, most likely mediated by multiple insertion sequences [11]. Therefore, we performed long-read WGS for the remaining non-typable isolates. Genomic analyses of the SCCmec elements showed that there was only one dominant SCCmec type in each ST/Agr group. Further details are described below.

2.2.1. ST84/Agr Group I and ST64/Agr Group II

All five isolates from the ST84/Agr group I and one out of five ST64/Agr group II isolates showed a genetic layout that was identical to that of a ~52 kb SCCmec element recently described in an S. pseudintermedius isolate (NA45) from Tennessee, United States (accession no; NZ_CP016072) [23] (Figure 1). A Clustal Omega nucleotide alignment of the SCCmec elements from these six MRSP isolates with SCCmecNA45 revealed that they were 99% identical. Interestingly, the mec gene complex of SCCmecNA45 is found in the opposite orientation compared to other SCCmec elements. SCCmecNA45 harbors ccrC1 allele 6, which is 100% homologous to the same gene found in S. haemolyticus isolate 25–60 [47]. Additionally, SCCmecNA45 harbors cadmium- (cadA) and arsenic- (arsC, arsB, and arsR) resistance genes and genes belonging to Type-I and Type-II restriction–modification (R-M) systems. Interestingly, the Type-I R-M system comprises three genes, hsdM, hsdR, and hsdS, but, in these isolates, hsdM includes a premature stop codon, leading to gene truncation. In contrast, full copies of the genes of the Type-II R-M system are present. The genomic layouts for the four remaining ST64/Agr group II isolates (11-041, 29-036, 30-027, 42-072) are identical to those of SCCmecNA45 with the exception that a 2.2 kb region harboring a pair of integrase genes, intA and intB (Figure 1), is found slightly downstream of ccrC1 allele 6. We refer to this SCCmec element as SCCmecNA45int.

2.2.2. ST71/Agr Group III

The SCCmec regions of all ST71/Agr group III isolates displayed the same genetic arrangement of genes (Figure 1). SCCmecFinder predicted the prototype class A mec gene complex, which contains mecA and full nucleotide sequences of mecRI and mecI, and the ccr gene complex 3, which is represented by the recombinase genes ccrA3 and ccrB3. According to whole-genome analysis and blastn searches, this combination had 99% sequence identity to an SCCmec element originally referred to as SCCmec Type II-III hybrid (accession no. AM904732) [48], but has recently been suggested to be renamed to SCCmec III(KM1381), owing to its unique genetic characteristics [13,18]. SCCmec III(KM1381) has a length of ~39 kb, approximately 13 kb shorter than SCCmecNA45. Major features of this SCCmec element include a type I restriction–modification (RM) system, which has not been described previously, and the psm-mec locus. In contrast to the hsd locus of ST84/Agr group I and ST64/Agr group II, the full hsdM, hsdR, and hsdS genes of ST71/Agr group III are found (in the opposite orientation).
On the other hand, the psm-mec locus, which comprises the psm-mec gene embedded in a small regulatory (sr)RNA, was found adjacent to the class A mec gene complex, sandwiched between mecI and mecR2 (xylR) [42,43]. Based on the fact that the psm-mec locus is associated with SCCmec types II, IIA, IIB, IID, III, and VIII of multiple Staphylococcus species [38,39], it was reasonable to assume that only ST71/Agr group III harboring SCCmec III(KM1381) harbored that locus. Indeed, we found that the psm-mec gene and the psm-mec srRNA were exclusive to this ST/Agr group (Figure 1, Table 1) and had 100% sequence identity to those described in S. aureus and S. epidermidis [49]. A characterized -7 T > C mutation in the psm-mec promoter region, which attenuates PSM-mec expression, is present in a subset of hospital-associated methicillin-resistant S. aureus (HA-MRSA) strains harboring SCCmec Type II [41,50,51,52]. However, the psm-mec promoter region in our ST71/Agr group III isolates did not harbor this mutation, indicating host-species-independent specificity for SCCmec Type II elements.

2.2.3. ST68/Agr Group IV

All 12 sequenced isolates belonging to the ST68/Agr group IV harbored the same type of SCCmec element carrying the class C2 mec gene complex flanked by two ccrC1 genes (alleles 2 and 8) (Figure 1 and Figure 2). The mec and ccr gene complexes of this large 56 kb element are mostly homologous to S. aureus SCCmec Vb [11], formerly known as SCCmec type V (5C2&5)/SCCmec type VT/VII from S. aureus (accession no. AB462393) [53,54]. However, compared to the S. aureus SCCmec sequence, significant disparities were found downstream of the ccrC1 allele 2 gene. For instance, remains of a Type I R-M system (i.e., a truncated hsdR gene and no hsdM or hsdS genes), followed by a Type IIIA CRISPR-Cas complex, genes for a Type II R-M system (with a truncated methylase gene), and a heavy metal resistance gene (Figure 1 and Figure 2) were observed in the ST68/Agr group IV SCCmec elements. The entire SCCmec element showed an architecture similar to that of recently published whole-genome sequences of VT isolates from Australia and Argentina [16,18], with a 98–99% sequence identity to SCCmec VT of an isolate from Ireland (ERR175868) [55] and the South Korean isolate Z0118SP0108 (CP061030.1). Variances in the number of direct repeats (DRs) (n = 5–18) found in CRISPR array 1, as well as the presence or absence of a second CRISPR array (always with 4 DRs) located immediately downstream of cas6 in some isolates, accounted for sequence differences.

2.3. Detection of PSM-mec in Culture Filtrates

The presence of the psm-mec locus in S. pseudintermedius is generally overlooked and, according to our knowledge, there are no available reports describing PSM-mec protein production in this species. Therefore, we analyzed 16-h culture filtrates from our isolate collection using an established RP-HPLC/ESI-MS method [31]. As expected, PSM-mec could not be detected in filtrates of MSSP isolates lacking an SCCmec element (37-032, 32-012, and ED99) or any isolate lacking the psm-mec locus (ST84/Agr group I, ST64/Agr group II, and ST68/Agr group IV) (Table 1; Figure 3). Notably, PSM-mec production was exclusive to the ST71/Agr III group that harbored SCCmec III(KM1381), which correlates with the presence of the psm-mec locus from our WGS data analyses (Table 1; Figure 3). The production levels of PSM-mec in these isolates from the ST71/Agr III group ranged from 5 to 27 μM, which is in the range of production in the S. epidermidis isolate SE620, while the clinical S. aureus MSA3407, a documented high producer of PSM-mec, produces more than 20-fold more PSM-mec than all the S. pseudintermedius isolates. Five of the seven psm-mec-gene-positive isolates were PSM-mec producers. The two psm-mec-gene-positive isolates that did not show PSM-mec production were also δ-toxin-negative, which is indicative of a dysfunctional Agr system (Table 1) [56]. The absence of PSM-mec production in those isolates is thus expected, assuming that Agr controls psm-mec expression in S. pseudintermedius as it does in S. aureus [43].

3. Discussion

Comprehensive analyses of the accessory genomes, including specifically methicillin resistance determinants of S. pseudintermedius lineages, have been published before [13,17,20]. We focused here on the most widely distributed lineages associated with canine infections in the United States and the analysis of factors potentially determining pathogenic success, including particularly PSM-mec.
In our isolate cohort, ST was strictly associated with Agr type and SCCmec type. As we reported in our previous study [24], we did not find any association between disease type and Agr type, which contrasts findings in S. aureus [57]. There was also no association between disease type and SCCmec type in our isolates.
While the presence of the psm-mec gene in two isolates of S. pseudintermedius has been reported [38], there has been no analysis of its presence in a larger cohort of isolates and no analysis of its expression as a secreted peptide toxin. We found that the presence of psm-mec was associated with ST71/Agr group III, and SCCmec III(KM1381) in MRSP, which corresponds to the two isolates analyzed by Monecke et al. [38]. Notably, all isolates of that group had the psm-mec locus, which revealed a 100% nucleotide sequence identity to those found in S. aureus strain 252 and S. epidermidis strain RP62A. Not all these isolates also produced the PSM-mec peptide. Because the non-producers were also δ-toxin-negative, this is likely due to Agr dysfunctionality. The widespread occurrence of dysfunctional Agr mutants has repeatedly been reported in staphylococci [58,59,60]. PSM-mec production was much lower than in clinical MRSA. In S. aureus, 25% of clinical MRSA was found to have a T to C mutation at position -7 relative to the start codon in the psm-mec promoter that suppresses translation [41,51]. No psm-mec-positive MRSP isolates in this study harbored this mutation, suggesting that other, potentially species-specific factors control PSM-mec production in S. pseudintermedius and are responsible for the comparatively low levels found in culture filtrates. The contribution of PSM-mec and the psm-mec RNA to MRSP virulence will need to be investigated in the future using site-specific allelic replacement mutants. Furthermore, it is possible that PSM-mec may play a role in the observed recent spread of ST71 in the United States and elsewhere [20].
The SCCmec elements of the MSRP isolates analyzed in this study did not encode any virulence determinants other than PSM-mec. However, there were differences in genes and gene clusters between them that may affect bacterial survival and genetic adaptation. Namely, some isolates harbored genes encoding type I and/or type II R-M systems in complete arrays or with truncations, while others had CRISPR loci. ST64 and ST84 isolates had both a type I and a type II R-M system.
R–M systems are commonly found in prokaryotic genomes and protect against foreign DNA invasion. Three subunits are required for type I R-M functionality, HsdS, HsdM and HsdR, which are responsible for recognition of a specific sequence, methylation to protect from self-digestion, and an endonuclease to cleave the non-protected DNA, respectively [61]. Interestingly, the type I R-M system appears to have a truncated hsdM gene in ST64 and ST84 isolates. It remains to be analyzed whether this situation affects the functionality of the system and self-digestion. Two separate proteins are needed for the type II R-M system [62,63] and in all ST64 and ST84 isolates, the genes encode full proteins. However, the methylase gene in ST68 isolates was truncated.
CRISPR (Clustered Regularly Interspaced Short Palindromic Repeats) are bacteriophage-derived DNA sequences in prokaryotic genomes that originate from previous bacteriophage infection. CRISPR-Cas systems are used to digest DNA from similar bacteriophages during subsequent infections. They may limit the exchange of genetic material between bacteria, including, for example, antimicrobial resistance determinants [64]. CRISPR sequences have been detected in S. pseudintermedius, sometimes associated with SCCmec elements, and used as markers to analyze the spread of antimicrobial resistance among the staphylococci [65]. Whether the CRISPR-Cas system encoded on the type V SCCmec elements of MSRP ST68 limits the uptake of foreign DNA and impacts survival or genetic adaptation remains to be investigated.
Finally, in some ST64/Agr group II isolates, we noted the presence of a pair of integrase genes, intA and intB, in the SCCmec elements. These integrases may be important for the mobility of pathogenicity islands in bacterial genomes and thus for bacterial evolution [66]. However, we did not find pathogenicity islands in our isolates such as the one observed in MRSP ST181 [67].

4. Materials and Methods

4.1. Bacterial Strains and Culture

In this study, 29 methicillin-resistant S. pseudintermedius (MRSP) and three methicillin-sensitive S. pseudintermedius clinical isolates were selected from the Texas Veterinary Medical Teaching Hospital strain collection at Texas A&M University between 2007 and 2016 [24]. One MSSP isolate (36-033) was used as a negative control for mecA detection; the other two isolates (37-032 and 32-012) were chosen for WGS analyses. At the time of isolation, bacteria were identified to the level of the S. intermedius group using biochemical tests including coagulase, urease, the ability to utilize trehalose and mannitol salt, and later confirmed via matrix-assisted laser desorption ionization time-of-flight mass spectrometry (MALDI-TOF MS; Biotyper, Bruker, Billerica, USA). Identification to the species level was performed using PCR as previously described [68]. The genome-sequenced MSSP type strain, ED99, and the methicillin-resistant S. aureus isolate MSA3407 were from Fitzgerald et al. [22,69,70]. Strain SE620 is a methicillin-resistant S. epidermidis clinical isolate from Norway [71]. S. aureus ATCC 29213 and ATCC 43300, E. faecalis ATCC 29212, E. coli ATCC 25922, and P. aeruginosa ATCC 27853 were acquired from American Type Culture Collection (ATCC). All bacteria were streaked from glycerol stocks onto Tryptic soy agar (TSA) or TSA supplemented with 5% sheep blood (BD) and incubated overnight at 37 °C to yield single colonies. A colony was selected and inoculated into tryptic soy broth (TSB) and grown for 16 h with shaking at 180 rpm at 37 °C, unless stated otherwise, for subsequent experiments.

4.2. Minimal Inhibitory Concentration (MIC) Assay

A commercially available antimicrobial drug susceptibility test panel (CompGP1F; Sensititre; Thermo Fisher Scientific, Waltham, MA, USA) was used to determine the minimum inhibitory concentration (MIC) of antimicrobial drugs for the S. pseudintermedius isolates from canines. Testing was performed according to the Clinical and Laboratory Standards Institute (CLSI) Guidelines [72]. Quality control testing for the laboratory consisted of weekly testing of the microbroth dilution tests using Staphylococcus aureus ATCC 29213, Enterococcus faecalis ATCC 29212, E. coli ATCC 25922, and Pseudomonas aeruginosa ATCC 27853 in accordance with the CLSI guidelines published in the document, VET01S.

4.3. DNA Isolation, Sequencing, Genome Assembly, and Alignment

S. pseudintermedius isolates were washed with phosphate-buffered saline, pelleted, adjusted to the desired concentration, and resuspended in 0.5 mL of 1× DNA/RNA Shield (Zymo Research, Irvine, CA, USA) to lyse bacteria and stabilize nucleic acids. Samples were sent to Plasmidsaurus (Eugene, OR, USA) where genomic DNA was isolated, minimally fragmented, and prepared for long-read sequencing using Oxford Nanopore Technologies (ONT, Oxford, United Kingdom). Amplification-free libraries were constructed from the fragmented DNA using the Kit v14 library prep chemistry, and the libraries were sequenced using R10.4.1 flow cells (ONT). The flow cells comprise an electro-resistant membrane harboring an array of nanopores, each individually connected to a separate electrode. As molecules pass through the pore, unique changes in ionic current are detected by associated channel and sensor chips. These individual signatures are interpreted by algorithms, which then generate DNA sequence data in real-time. High-quality consensus sequences were generated by Plasmidsaurus through data processing with Flye (Version 2.9.1) and Medaka (Version 1.8.0) for assembly and polishing, respectively, and lastly, bacterial genome annotations were produced with Bakta (Version 1.6.1).

4.4. Comparative Genomics

The SCCmecFinder 1.2, a database (https://cge.food.dtu.dk/services/SCCmecFinder-1.2/, accessed on 27 September 2023) [46] that contains information from S. aureus SCCmec types I through XI (at the time of manuscript preparation), was employed to predict SCCmec types from WGS data. For each isolate, additional analyses were performed by comparing the presence of genetic elements as described in the guidelines by the International Working Group on the Classification of Staphylococcal Cassette Chromosome (IWG-SCC) [12]. Online tools, CRISPRfinder and (https://crisprcas.i2bc.paris-saclay.fr/CrisprCasFinder/Index, accessed on 15 October 2023) [73] and IS finder https://isfinder.biotoul.fr (accessed on 15 October 2023) [74], were used to detect and characterize clustered regularly interspaced short palindromic repeat (CRISPR) elements and insertional sequences, respectively. Finally, manual alignment/mapping was carried out using the available reference sequences for S. aureus and S. pseudintermedius SCCmec types. The CLUSTAL Omega algorithm (Version 1.2.3) was used to align sequences in Geneious (Version 2023.0.4) and comparative genome figures were created.

4.5. Detection of mecA using Real-Time PCR

For genomic DNA isolation, one bacterial colony from a TSA plate was resuspended into 50 μL of nuclease-free water and heated at 95 °C for 10 min. After heating, the samples were centrifuged down for 10 min at 10,000× g and the DNA-containing pellet was used for real-time PCR for the identification of the mecA gene as described previously [75]. Briefly, primers, LTmecAF (5′-AAAGAACCTCTGCTCAACAAGT-3′) and LtmecAR (5′-TGTTATTTAACCCAATCATTGCTGTT-3′), and probe, LTmecAHP2 (5′-[6FAM]CCAGATTACAACTTCACCAGGTTCAAC[BHQ1]-3′), were diluted to final concentrations of 500 nM in PCR reaction volume of 25 μL consisting of TaqMan Fast Universal PCR Master Mix (2×) (Thermo Fisher Scientific), 2 μL DNA template, and water. Real-time PCR was performed on an Applied Biosystems 7500 Fast Thermocycler (Thermo Fisher Scientific) using the presence/absence assay setting with cycling parameters that consisted of an initial step of 60 °C for 1 min and 95 °C for 20 s, followed by 40 cycles of 95 °C for 3 s, and then 60 °C for 30 s with a final step at 60 °C for 1 min. The mecA-positive control was MRSA ATCC 43300. The negative controls included MSSA ATCC 29213 and MSSP isolate 36-033 that we previously characterized [24].

4.6. Analysis of PSM-mec Production by RP-HPLC/MS

For the identification and quantification of PSM-mec, culture filtrates were collected from 16 h cultures of all S. pseudintermedius isolates and reference strains (S. pseudintermedius ED99, S. epidermidis isolate SE620, S. aureus isolate MSA3407) and then subjected to reversed-phase high-pressure liquid chromatography/electrospray mass spectrometry (RP-HPLC/ESI-MS) as recently described [76]. For the absolute quantification of PSMs in culture filtrates, known molar concentrations of the PSM-mec peptide (MDFTGVITSIIDLIKTCIQAFG) synthesized with an N-terminal N-formyl methionine modification at >95% purity (Peptide 2.0) were made. Peptide was first dissolved into dimethyl sulfoxide (DMSO) to a stock concentration of 10 mg/mL and further diluted into water to generate standards. The simple linear regression function in GraphPad Prism software (Version 9.5.1) was used to calculate the PSM-mec concentrations. To account for differences in PSM production in batch runs performed on different days, one selected S. pseudintermedius isolate was always included as a reference and then the values were used for normalization. The RP-HPLC/ESI-MS method was also used to detect δ-toxin.

4.7. Data Availability

The WGS-annotated genomes containing contigs with SCCmec sequences are publicly available on the Bacterial And Viral Bioinformatics Resource Center website (https://www.bv-brc.org, accessed on 19 September 2023) under the name “Slittle_StaphPseudAGR” in the BV-BRC public workspaces portal [24]. Twelve isolates, whose SCCmec regions could not be identified, because sequences spanned multiple contigs, were re-sequenced, and the raw sequence data in *.fastq.gz format were deposited to the National Center for Biotechnology Information (NCBI) database under bioproject PRJNA1055088 with accession numbers SAMN38979297–SAMN38979308 (see Table 1).

Author Contributions

Conceptualization, G.Y.C.C. and M.O.; formal analysis, G.Y.C.C., J.H.L., S.D.L. and M.O.; investigation, G.Y.C.C., C.Y., R.L., J.H.L., S.D.L. and M.O.; resources, C.Y., S.D.L. and M.O.; data curation, G.Y.C.C. and J.H.L.; writing—original draft preparation, G.Y.C.C. and M.O.; writing—review and editing, G.Y.C.C. and M.O.; visualization, G.Y.C.C., J.H.L. and M.O.; supervision, G.Y.C.C. and M.O.; project administration, G.Y.C.C. and M.O.; funding acquisition, S.D.L. and M.O. All authors have read and agreed to the published version of the manuscript.

Funding

This research was funded by the Intramural Research Program of the National Institute of Allergy and Infectious Diseases (NIAID), U.S. National Institutes of Health (NIH), project number ZIA AI000904 (to M.O.). Original isolation and sequencing of S. pseudintermedius isolates was funded by grant D15CA-833 from the Veterinary Orthopedic Society and Morris Animal Foundation (to S.D.L.).

Institutional Review Board Statement

Not applicable.

Informed Consent Statement

Not applicable.

Data Availability Statement

All data are contained within the article.

Acknowledgments

The authors thank Margaret Ho (Bioinformatics and Computational Biosciences Branch, NIAID, NIH) for help in analyzing and presenting whole-genome sequencing data.

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. Gonzalez-Martin, M.; Corbera, J.A.; Suarez-Bonnet, A.; Tejedor-Junco, M.T. Virulence factors in coagulase-positive staphylococci of veterinary interest other than Staphylococcus aureus. Vet. Q. 2020, 40, 118–131. [Google Scholar] [CrossRef]
  2. Bannoehr, J.; Guardabassi, L. Staphylococcus pseudintermedius in the dog: Taxonomy, diagnostics, ecology, epidemiology and pathogenicity. Vet. Dermatol. 2012, 23, 253–266, e251–e252. [Google Scholar] [CrossRef]
  3. Cheung, G.Y.C.; Otto, M. Virulence Mechanisms of Staphylococcal Animal Pathogens. Int. J. Mol. Sci. 2023, 24, 14587. [Google Scholar] [CrossRef] [PubMed]
  4. Borjesson, S.; Gomez-Sanz, E.; Ekstrom, K.; Torres, C.; Gronlund, U. Staphylococcus pseudintermedius can be misdiagnosed as Staphylococcus aureus in humans with dog bite wounds. Eur. J. Clin. Microbiol. 2015, 34, 839–844. [Google Scholar] [CrossRef] [PubMed]
  5. Moses, I.B.; Santos, F.F.; Gales, A.C. Human Colonization and Infection by Staphylococcus pseudintermedius: An Emerging and Underestimated Zoonotic Pathogen. Microorganisms 2023, 11, 581. [Google Scholar] [CrossRef] [PubMed]
  6. Guimaraes, L.; Teixeira, I.M.; da Silva, I.T.; Antunes, M.; Pesset, C.; Fonseca, C.; Santos, A.L.; Cortes, M.F.; Penna, B. Epidemiologic case investigation on the zoonotic transmission of Methicillin-resistant Staphylococcus pseudintermedius among dogs and their owners. J. Infect. Public Health 2023, 16 (Suppl. S1), 183–189. [Google Scholar] [CrossRef] [PubMed]
  7. Devriese, L.A.; Vancanneyt, M.; Baele, M.; Vaneechoutte, M.; De Graef, E.; Snauwaert, C.; Cleenwerck, I.; Dawyndt, P.; Swings, J.; Decostere, A.; et al. Staphylococcus pseudintermedius sp. nov., a coagulase-positive species from animals. Int. J. Syst. Evol. Microbiol. 2005, 55, 1569–1573. [Google Scholar] [CrossRef] [PubMed]
  8. Somayaji, R.; Priyantha, M.A.R.; Rubin, J.E.; Church, D. Human infections due to Staphylococcus pseudintermedius, an emerging zoonosis of canine origin: Report of 24 cases. Diagn. Microbiol. Infect. Dis. 2016, 85, 471–476. [Google Scholar] [CrossRef] [PubMed]
  9. Hartman, B.J.; Tomasz, A. Low-affinity penicillin-binding protein associated with beta-lactam resistance in Staphylococcus aureus. J. Bacteriol. 1984, 158, 513–516. [Google Scholar] [CrossRef]
  10. Ito, T.; Okuma, K.; Ma, X.X.; Yuzawa, H.; Hiramatsu, K. Insights on antibiotic resistance of Staphylococcus aureus from its whole genome: Genomic island SCC. Drug Resist. Updat. 2003, 6, 41–52. [Google Scholar] [CrossRef]
  11. Uehara, Y. Current Status of Staphylococcal Cassette Chromosome mec (SCCmec). Antibiotics 2022, 11, 86. [Google Scholar] [CrossRef]
  12. International Working Group on the Classification of Staphylococcal Cassette Chromosome Elements. Classification of staphylococcal cassette chromosome mec (SCCmec): Guidelines for reporting novel SCCmec elements. Antimicrob. Agents Chemother. 2009, 53, 4961–4967. [Google Scholar] [CrossRef] [PubMed]
  13. Krapf, M.; Muller, E.; Reissig, A.; Slickers, P.; Braun, S.D.; Muller, E.; Ehricht, R.; Monecke, S. Molecular characterisation of methicillin-resistant Staphylococcus pseudintermedius from dogs and the description of their SCCmec elements. Vet. Microbiol. 2019, 233, 196–203. [Google Scholar] [CrossRef] [PubMed]
  14. Monecke, S.; Jatzwauk, L.; Muller, E.; Nitschke, H.; Pfohl, K.; Slickers, P.; Reissig, A.; Ruppelt-Lorz, A.; Ehricht, R. Diversity of SCCmec Elements in Staphylococcus aureus as Observed in South-Eastern Germany. PLoS ONE 2016, 11, e0162654. [Google Scholar] [CrossRef] [PubMed]
  15. Srednik, M.E.; Perea, C.A.; Giacoboni, G.I.; Hicks, J.A.; Schlater, L.K. First report of Staphylococcus pseudintermedius ST71-SCCmec III and ST45-PsiSCCmec(57395) from canine pyoderma in Argentina. BMC Res. Notes 2023, 16, 19. [Google Scholar] [CrossRef] [PubMed]
  16. Srednik, M.E.; Perea, C.A.; Giacoboni, G.I.; Hicks, J.A.; Foxx, C.L.; Harris, B.; Schlater, L.K. Genomic Features of Antimicrobial Resistance in Staphylococcus pseudintermedius Isolated from Dogs with Pyoderma in Argentina and the United States: A Comparative Study. Int. J. Mol. Sci. 2023, 24, 11361. [Google Scholar] [CrossRef] [PubMed]
  17. Duim, B.; Verstappen, K.; Kalupahana, R.S.; Ranathunga, L.; Fluit, A.C.; Wagenaar, J.A. Methicillin-resistant Staphylococcus pseudintermedius among dogs in the description of novel SCCmec variants. Vet. Microbiol. 2018, 213, 136–141. [Google Scholar] [CrossRef] [PubMed]
  18. Worthing, K.A.; Schwendener, S.; Perreten, V.; Saputra, S.; Coombs, G.W.; Pang, S.; Davies, M.R.; Abraham, S.; Trott, D.J.; Norris, J.M. Characterization of Staphylococcal Cassette Chromosome mec Elements from Methicillin-Resistant Staphylococcus pseudintermedius Infections in Australian Animals. mSphere 2018, 3, e00491-18. [Google Scholar] [CrossRef]
  19. Kasai, T.; Saegusa, S.; Shirai, M.; Murakami, M.; Kato, Y. New categories designated as healthcare-associated and community-associated methicillin-resistant Staphylococcus pseudintermedius in dogs. Microbiol. Immunol. 2016, 60, 540–551. [Google Scholar] [CrossRef]
  20. Bruce, S.A.; Smith, J.T.; Mydosh, J.L.; Ball, J.; Needle, D.B.; Gibson, R.; Andam, C.P. Accessory Genome Dynamics of Local and Global Staphylococcus pseudintermedius Populations. Front. Microbiol. 2022, 13, 798175. [Google Scholar] [CrossRef]
  21. Smith, J.T.; Amador, S.; McGonagle, C.J.; Needle, D.; Gibson, R.; Andam, C.P. Population genomics of Staphylococcus pseudintermedius in companion animals in the United States. Commun. Biol. 2020, 3, 282. [Google Scholar] [CrossRef] [PubMed]
  22. Ben Zakour, N.L.; Bannoehr, J.; van den Broek, A.H.; Thoday, K.L.; Fitzgerald, J.R. Complete genome sequence of the canine pathogen Staphylococcus pseudintermedius. J. Bacteriol. 2011, 193, 2363–2364. [Google Scholar] [CrossRef] [PubMed]
  23. Riley, M.C.; Perreten, V.; Bemis, D.A.; Kania, S.A. Complete Genome Sequences of Three Important Methicillin-Resistant Clinical Isolates of Staphylococcus pseudintermedius. Genome Announc. 2016, 4, e01194-16. [Google Scholar] [CrossRef] [PubMed]
  24. Little, S.V.; Bryan, L.K.; Hillhouse, A.E.; Cohen, N.D.; Lawhon, S.D. Characterization of agr Groups of Staphylococcus pseudintermedius Isolates from Dogs in Texas. mSphere 2019, 4, e00033-19. [Google Scholar] [CrossRef]
  25. Abouelkhair, M.A.; Bemis, D.A.; Kania, S.A. Characterization of recombinant wild-type and nontoxigenic protein A from Staphylococcus pseudintermedius. Virulence 2018, 9, 1050–1061. [Google Scholar] [CrossRef]
  26. Futagawa-Saito, K.; Makino, S.; Sunaga, F.; Kato, Y.; Sakurai-Komada, N.; Ba-Thein, W.; Fukuyasu, T. Identification of first exfoliative toxin in Staphylococcus pseudintermedius. FEMS Microbiol. Lett. 2009, 301, 176–180. [Google Scholar] [CrossRef]
  27. Iyori, K.; Hisatsune, J.; Kawakami, T.; Shibata, S.; Murayama, N.; Ide, K.; Nagata, M.; Fukata, T.; Iwasaki, T.; Oshima, K.; et al. Identification of a novel Staphylococcus pseudintermedius exfoliative toxin gene and its prevalence in isolates from canines with pyoderma and healthy dogs. FEMS Microbiol. Lett. 2010, 312, 169–175. [Google Scholar] [CrossRef]
  28. Abouelkhair, M.A.; Bemis, D.A.; Giannone, R.J.; Frank, L.A.; Kania, S.A. Characterization of a leukocidin identified in Staphylococcus pseudintermedius. PLoS ONE 2018, 13, e0204450. [Google Scholar] [CrossRef]
  29. Edwards, V.M.; Deringer, J.R.; Callantine, S.D.; Deobald, C.F.; Berger, P.H.; Kapur, V.; Stauffacher, C.V.; Bohach, G.A. Characterization of the canine type C enterotoxin produced by Staphylococcus intermedius pyoderma isolates. Infect. Immun. 1997, 65, 2346–2352. [Google Scholar] [CrossRef]
  30. Maali, Y.; Badiou, C.; Martins-Simoes, P.; Hodille, E.; Bes, M.; Vandenesch, F.; Lina, G.; Diot, A.; Laurent, F.; Trouillet-Assant, S. Understanding the Virulence of Staphylococcus pseudintermedius: A Major Role of Pore-Forming Toxins. Front. Cell Infect. Microbiol. 2018, 8, 221. [Google Scholar] [CrossRef]
  31. Cheung, G.Y.; Joo, H.S.; Chatterjee, S.S.; Otto, M. Phenol-soluble modulins--critical determinants of staphylococcal virulence. FEMS Microbiol. Rev. 2014, 38, 698–719. [Google Scholar] [CrossRef]
  32. Wang, R.; Braughton, K.R.; Kretschmer, D.; Bach, T.H.; Queck, S.Y.; Li, M.; Kennedy, A.D.; Dorward, D.W.; Klebanoff, S.J.; Peschel, A.; et al. Identification of novel cytolytic peptides as key virulence determinants for community-associated MRSA. Nat. Med. 2007, 13, 1510–1514. [Google Scholar] [CrossRef]
  33. Periasamy, S.; Joo, H.S.; Duong, A.C.; Bach, T.H.; Tan, V.Y.; Chatterjee, S.S.; Cheung, G.Y.; Otto, M. How Staphylococcus aureus biofilms develop their characteristic structure. Proc. Natl. Acad. Sci. USA 2012, 109, 1281–1286. [Google Scholar] [CrossRef]
  34. Le, K.Y.; Villaruz, A.E.; Zheng, Y.; He, L.; Fisher, E.L.; Nguyen, T.H.; Ho, T.V.; Yeh, A.J.; Joo, H.S.; Cheung, G.Y.C.; et al. Role of Phenol-Soluble Modulins in Staphylococcus epidermidis Biofilm Formation and Infection of Indwelling Medical Devices. J. Mol. Biol. 2019, 431, 3015–3027. [Google Scholar] [CrossRef]
  35. Peschel, A.; Otto, M. Phenol-soluble modulins and staphylococcal infection. Nat. Rev. Microbiol. 2013, 11, 667–673. [Google Scholar] [CrossRef]
  36. Novick, R.P.; Ross, H.F.; Projan, S.J.; Kornblum, J.; Kreiswirth, B.; Moghazeh, S. Synthesis of staphylococcal virulence factors is controlled by a regulatory RNA molecule. EMBO J. 1993, 12, 3967–3975. [Google Scholar] [CrossRef]
  37. Le, K.Y.; Otto, M. Quorum-sensing regulation in staphylococci-an overview. Front. Microbiol. 2015, 6, 1174. [Google Scholar] [CrossRef]
  38. Monecke, S.; Engelmann, I.; Archambault, M.; Coleman, D.C.; Coombs, G.W.; Cortez de Jackel, S.; Pelletier-Jacques, G.; Schwarz, S.; Shore, A.C.; Slickers, P.; et al. Distribution of SCCmec-associated phenol-soluble modulin in staphylococci. Mol. Cell Probes 2012, 26, 99–103. [Google Scholar] [CrossRef] [PubMed]
  39. Shore, A.C.; Coleman, D.C. Staphylococcal cassette chromosome mec: Recent advances and new insights. Int. J. Med. Microbiol. 2013, 303, 350–359. [Google Scholar] [CrossRef] [PubMed]
  40. Queck, S.Y.; Khan, B.A.; Wang, R.; Bach, T.H.; Kretschmer, D.; Chen, L.; Kreiswirth, B.N.; Peschel, A.; Deleo, F.R.; Otto, M. Mobile genetic element-encoded cytolysin connects virulence to methicillin resistance in MRSA. PLoS Pathog. 2009, 5, e1000533. [Google Scholar] [CrossRef] [PubMed]
  41. Kaito, C.; Saito, Y.; Ikuo, M.; Omae, Y.; Mao, H.; Nagano, G.; Fujiyuki, T.; Numata, S.; Han, X.; Obata, K.; et al. Mobile genetic element SCCmec-encoded psm-mec RNA suppresses translation of agrA and attenuates MRSA virulence. PLoS Pathog. 2013, 9, e1003269. [Google Scholar] [CrossRef]
  42. Cheung, G.Y.; Villaruz, A.E.; Joo, H.S.; Duong, A.C.; Yeh, A.J.; Nguyen, T.H.; Sturdevant, D.E.; Queck, S.Y.; Otto, M. Genome-wide analysis of the regulatory function mediated by the small regulatory psm-mec RNA of methicillin-resistant Staphylococcus aureus. Int. J. Med. Microbiol. 2014, 304, 637–644. [Google Scholar] [CrossRef]
  43. Chatterjee, S.S.; Chen, L.; Joo, H.S.; Cheung, G.Y.; Kreiswirth, B.N.; Otto, M. Distribution and regulation of the mobile genetic element-encoded phenol-soluble modulin PSM-mec in methicillin-resistant Staphylococcus aureus. PLoS ONE 2011, 6, e28781. [Google Scholar] [CrossRef] [PubMed]
  44. Queck, S.Y.; Jameson-Lee, M.; Villaruz, A.E.; Bach, T.H.; Khan, B.A.; Sturdevant, D.E.; Ricklefs, S.M.; Li, M.; Otto, M. RNAIII-independent target gene control by the agr quorum-sensing system: Insight into the evolution of virulence regulation in Staphylococcus aureus. Mol. Cell 2008, 32, 150–158. [Google Scholar] [CrossRef] [PubMed]
  45. Qin, L.; Da, F.; Fisher, E.L.; Tan, D.C.; Nguyen, T.H.; Fu, C.L.; Tan, V.Y.; McCausland, J.W.; Sturdevant, D.E.; Joo, H.S.; et al. Toxin Mediates Sepsis Caused by Methicillin-Resistant Staphylococcus epidermidis. PLoS Pathog. 2017, 13, e1006153. [Google Scholar] [CrossRef] [PubMed]
  46. Kaya, H.; Hasman, H.; Larsen, J.; Stegger, M.; Johannesen, T.B.; Allesoe, R.L.; Lemvigh, C.K.; Aarestrup, F.M.; Lund, O.; Larsen, A.R. SCCmecFinder, a Web-Based Tool for Typing of Staphylococcal Cassette Chromosome mec in Staphylococcus aureus Using Whole-Genome Sequence Data. mSphere 2018, 3, e00612-17. [Google Scholar] [CrossRef] [PubMed]
  47. Hanssen, A.M.; Sollid, J.U. Multiple staphylococcal cassette chromosomes and allelic variants of cassette chromosome recombinases in Staphylococcus aureus and coagulase-negative staphylococci from Norway. Antimicrob. Agents Chemother. 2007, 51, 1671–1677. [Google Scholar] [CrossRef] [PubMed]
  48. Descloux, S.; Rossano, A.; Perreten, V. Characterization of new staphylococcal cassette chromosome mec (SCCmec) and topoisomerase genes in fluoroquinolone- and methicillin-resistant Staphylococcus pseudintermedius. J. Clin. Microbiol. 2008, 46, 1818–1823. [Google Scholar] [CrossRef]
  49. Qin, L.; McCausland, J.W.; Cheung, G.Y.; Otto, M. PSM-Mec-A Virulence Determinant that Connects Transcriptional Regulation, Virulence, and Antibiotic Resistance in Staphylococci. Front. Microbiol. 2016, 7, 1293. [Google Scholar] [CrossRef]
  50. Aoyagi, T.; Kaito, C.; Sekimizu, K.; Omae, Y.; Saito, Y.; Mao, H.; Inomata, S.; Hatta, M.; Endo, S.; Kanamori, H.; et al. Impact of psm-mec in the mobile genetic element on the clinical characteristics and outcome of SCCmec-II methicillin-resistant Staphylococcus aureus bacteraemia in Japan. Clin. Microbiol. Infect. 2014, 20, 912–919. [Google Scholar] [CrossRef]
  51. Kaito, C.; Saito, Y.; Nagano, G.; Ikuo, M.; Omae, Y.; Hanada, Y.; Han, X.; Kuwahara-Arai, K.; Hishinuma, T.; Baba, T.; et al. Transcription and translation products of the cytolysin gene psm-mec on the mobile genetic element SCCmec regulate Staphylococcus aureus virulence. PLoS Pathog. 2011, 7, e1001267. [Google Scholar] [CrossRef] [PubMed]
  52. Tabuchi, F.; Lulitanond, A.; Lulitanond, V.; Thunyaharn, S.; Kaito, C. Epidemiological study on the relationship between toxin production and psm-mec mutations in MRSA isolates in Thailand. Microbiol. Immunol. 2020, 64, 219–225. [Google Scholar] [CrossRef]
  53. Boyle-Vavra, S.; Ereshefsky, B.; Wang, C.C.; Daum, R.S. Successful multiresistant community-associated methicillin-resistant Staphylococcus aureus lineage from Taipei, Taiwan, that carries either the novel Staphylococcal chromosome cassette mec (SCCmec) type VT or SCCmec type IV. J. Clin. Microbiol. 2005, 43, 4719–4730. [Google Scholar] [CrossRef]
  54. Black, C.C.; Solyman, S.M.; Eberlein, L.C.; Bemis, D.A.; Woron, A.M.; Kania, S.A. Identification of a predominant multilocus sequence type, pulsed-field gel electrophoresis cluster, and novel staphylococcal chromosomal cassette in clinical isolates of mecA-containing, methicillin-resistant Staphylococcus pseudintermedius. Vet. Microbiol. 2009, 139, 333–338. [Google Scholar] [CrossRef] [PubMed]
  55. McCarthy, A.J.; Harrison, E.M.; Stanczak-Mrozek, K.; Leggett, B.; Waller, A.; Holmes, M.A.; Lloyd, D.H.; Lindsay, J.A.; Loeffler, A. Genomic insights into the rapid emergence and evolution of MDR in Staphylococcus pseudintermedius. J. Antimicrob. Chemother. 2015, 70, 997–1007. [Google Scholar] [CrossRef]
  56. Otto, M.; Gotz, F. Analysis of quorum sensing activity in staphylococci by RP-HPLC of staphylococcal delta-toxin. Biotechniques 2000, 28, 1088–1096. [Google Scholar] [CrossRef]
  57. Jarraud, S.; Mougel, C.; Thioulouse, J.; Lina, G.; Meugnier, H.; Forey, F.; Nesme, X.; Etienne, J.; Vandenesch, F. Relationships between Staphylococcus aureus genetic background, virulence factors, agr groups (alleles), and human disease. Infect. Immun. 2002, 70, 631–641. [Google Scholar] [CrossRef] [PubMed]
  58. Fowler, V.G., Jr.; Sakoulas, G.; McIntyre, L.M.; Meka, V.G.; Arbeit, R.D.; Cabell, C.H.; Stryjewski, M.E.; Eliopoulos, G.M.; Reller, L.B.; Corey, G.R.; et al. Persistent bacteremia due to methicillin-resistant Staphylococcus aureus infection is associated with agr dysfunction and low-level in vitro resistance to thrombin-induced platelet microbicidal protein. J. Infect. Dis. 2004, 190, 1140–1149. [Google Scholar] [CrossRef]
  59. He, L.; Zhang, F.; Jian, Y.; Lv, H.; Hamushan, M.; Liu, J.; Liu, Y.; Wang, H.; Tang, J.; Han, P.; et al. Key role of quorum-sensing mutations in the development of Staphylococcus aureus clinical device-associated infection. Clin. Transl. Med. 2022, 12, e801. [Google Scholar] [CrossRef]
  60. Traber, K.E.; Lee, E.; Benson, S.; Corrigan, R.; Cantera, M.; Shopsin, B.; Novick, R.P. agr function in clinical Staphylococcus aureus isolates. Microbiology 2008, 154, 2265–2274. [Google Scholar] [CrossRef]
  61. Murray, N.E. Type I restriction systems: Sophisticated molecular machines (a legacy of Bertani and Weigle). Microbiol. Mol. Biol. Rev. 2000, 64, 412–434. [Google Scholar] [CrossRef] [PubMed]
  62. Sussenbach, J.S.; Steenbergh, P.H.; Rost, J.A.; van Leeuwen, W.J.; van Embden, J.D. A second site-specific restriction endonuclease from Staphylococcus aureus. Nucleic Acids Res. 1978, 5, 1153–1163. [Google Scholar] [CrossRef] [PubMed]
  63. Pingoud, A.; Fuxreiter, M.; Pingoud, V.; Wende, W. Type II restriction endonucleases: Structure and mechanism. Cell Mol. Life Sci. 2005, 62, 685–707. [Google Scholar] [CrossRef] [PubMed]
  64. Sorek, R.; Kunin, V.; Hugenholtz, P. CRISPR--a widespread system that provides acquired resistance against phages in bacteria and archaea. Nat. Rev. Microbiol. 2008, 6, 181–186. [Google Scholar] [CrossRef] [PubMed]
  65. Rossi, C.C.; Andrade-Oliveira, A.L.; Giambiagi-deMarval, M. CRISPR tracking reveals global spreading of antimicrobial resistance genes by Staphylococcus of canine origin. Vet. Microbiol. 2019, 232, 65–69. [Google Scholar] [CrossRef] [PubMed]
  66. Alibayov, B.; Baba-Moussa, L.; Sina, H.; Zdenkova, K.; Demnerova, K. Staphylococcus aureus mobile genetic elements. Mol. Biol. Rep. 2014, 41, 5005–5018. [Google Scholar] [CrossRef]
  67. Phumthanakorn, N.; Schwendener, S.; Dona, V.; Chanchaithong, P.; Perreten, V.; Prapasarakul, N. Genomic insights into methicillin-resistant Staphylococcus pseudintermedius isolates from dogs and humans of the same sequence types reveals diversity in prophages and pathogenicity islands. PLoS ONE 2021, 16, e0254382. [Google Scholar] [CrossRef]
  68. Sasaki, T.; Tsubakishita, S.; Tanaka, Y.; Sakusabe, A.; Ohtsuka, M.; Hirotaki, S.; Kawakami, T.; Fukata, T.; Hiramatsu, K. Multiplex-PCR method for species identification of coagulase-positive staphylococci. J. Clin. Microbiol. 2010, 48, 765–769. [Google Scholar] [CrossRef]
  69. Musser, J.M.; Kapur, V. Clonal analysis of methicillin-resistant Staphylococcus aureus strains from intercontinental sources: Association of the mec gene with divergent phylogenetic lineages implies dissemination by horizontal transfer and recombination. J. Clin. Microbiol. 1992, 30, 2058–2063. [Google Scholar] [CrossRef]
  70. Fitzgerald, J.R.; Sturdevant, D.E.; Mackie, S.M.; Gill, S.R.; Musser, J.M. Evolutionary genomics of Staphylococcus aureus: Insights into the origin of methicillin-resistant strains and the toxic shock syndrome epidemic. Proc. Natl. Acad. Sci. USA 2001, 98, 8821–8826. [Google Scholar] [CrossRef]
  71. Klingenberg, C.; Ronnestad, A.; Anderson, A.S.; Abrahamsen, T.G.; Zorman, J.; Villaruz, A.; Flaegstad, T.; Otto, M.; Sollid, J.E. Persistent strains of coagulase-negative staphylococci in a neonatal intensive care unit: Virulence factors and invasiveness. Clin. Microbiol. Infect. 2007, 13, 1100–1111. [Google Scholar] [CrossRef] [PubMed]
  72. CLSI Supplement VET01S; Performance Standards for Antimicrobial Disk and Dilution Susceptibility Tests for Bacteria Isolated from Animals. CLSI: Wayne, PA, USA, 2023.
  73. Couvin, D.; Bernheim, A.; Toffano-Nioche, C.; Touchon, M.; Michalik, J.; Neron, B.; Rocha, E.P.C.; Vergnaud, G.; Gautheret, D.; Pourcel, C. CRISPRCasFinder, an update of CRISRFinder, includes a portable version, enhanced performance and integrates search for Cas proteins. Nucleic Acids Res. 2018, 46, W246–W251. [Google Scholar] [CrossRef] [PubMed]
  74. Siguier, P.; Perochon, J.; Lestrade, L.; Mahillon, J.; Chandler, M. ISfinder: The reference centre for bacterial insertion sequences. Nucleic Acids Res. 2006, 34, D32–D36. [Google Scholar] [CrossRef] [PubMed]
  75. Thomas, L.C.; Gidding, H.F.; Ginn, A.N.; Olma, T.; Iredell, J. Development of a real-time Staphylococcus aureus and MRSA (SAM-) PCR for routine blood culture. J. Microbiol. Methods 2007, 68, 296–302. [Google Scholar] [CrossRef]
  76. Da, F.; Joo, H.S.; Cheung, G.Y.C.; Villaruz, A.E.; Rohde, H.; Luo, X.; Otto, M. Phenol-Soluble Modulin Toxins of Staphylococcus haemolyticus. Front. Cell Infect. Microbiol. 2017, 7, 206. [Google Scholar] [CrossRef]
Antibiotics 13 00130 g001
Figure 1. Genetic layout of SCCmec elements representative of ST84/Agr group I, ST64/Agr group II, ST71/Agr group III, and ST68/Agr group IV S. pseudintermedius isolates. A pair of integrase genes (intA and intB) are found in some ST64/Agr group II isolates. The number of direct repeats (DRs) in CRISPR array 1, represented by dark green arrows in the SCCmec elements of ST68/Agr group IV isolates, vary between 5 and 18. In some isolates, a second CRISPR array is found downstream of the CRISPR protein machinery (light green arrows). orfX, mecA, IS elements, and recombination proteins are depicted by gray, red, yellow, and blue arrows, respectively. The psm-mec locus, comprising the psm-mec gene (black arrow) and the srRNA (orange bar), is found exclusively in the SCCmec of ST71/Agr group III isolates. R-M, restriction–modification; ISL3, transposase.
Figure 1. Genetic layout of SCCmec elements representative of ST84/Agr group I, ST64/Agr group II, ST71/Agr group III, and ST68/Agr group IV S. pseudintermedius isolates. A pair of integrase genes (intA and intB) are found in some ST64/Agr group II isolates. The number of direct repeats (DRs) in CRISPR array 1, represented by dark green arrows in the SCCmec elements of ST68/Agr group IV isolates, vary between 5 and 18. In some isolates, a second CRISPR array is found downstream of the CRISPR protein machinery (light green arrows). orfX, mecA, IS elements, and recombination proteins are depicted by gray, red, yellow, and blue arrows, respectively. The psm-mec locus, comprising the psm-mec gene (black arrow) and the srRNA (orange bar), is found exclusively in the SCCmec of ST71/Agr group III isolates. R-M, restriction–modification; ISL3, transposase.
Antibiotics 13 00130 g001
Antibiotics 13 00130 g002
Figure 2. Alignment of S. pseudintermedius ST68/Agr group IV SCCmec elements with that of S. pseudintermedius isolate Z0118SP0108 (CP061030.1).
Figure 2. Alignment of S. pseudintermedius ST68/Agr group IV SCCmec elements with that of S. pseudintermedius isolate Z0118SP0108 (CP061030.1).
Antibiotics 13 00130 g002
Antibiotics 13 00130 g003
Figure 3. PSM-mec production in 16 h culture filtrates of a collection of MRSP and MSSP isolates. S. epidermidis SE620 and S. aureus MSA3407, previously described PSM-mec producers, are denoted by red and blue columns, respectively, for comparison.
Figure 3. PSM-mec production in 16 h culture filtrates of a collection of MRSP and MSSP isolates. S. epidermidis SE620 and S. aureus MSA3407, previously described PSM-mec producers, are denoted by red and blue columns, respectively, for comparison.
Antibiotics 13 00130 g003
Table 1. Characteristics of S. pseudintermedius canine isolates in this study.
Table 1. Characteristics of S. pseudintermedius canine isolates in this study.
Isolate NumberDisease TypeSourceAccession NumberMLST aAgr Group bCollection DatemecA
PCR c		Oxacillin dPenicillin dSCCmec Typepsm-mec ePSM-mec fD-Toxin g
11-025SurgicalThis studySAMN3897930484I4/14/08+ h>2>8NA45- i--
11-033PyodermaThis studySAMN3897930584I5/19/08+>2>8NA45--+
18-007SurgicalThis studySAMN3897930684I12/15/09+>2>8NA45--+
29-086PyodermaThis studySAMN3897930784I11/24/10+>2>8NA45--+
31-086UrineThis studySAMN3897930884I3/22/11+0.58NA45--+
11-041PyodermaThis studySAMN3897929764II6/9/08+>2>8NA45int--+
29-036PyodermaThis studySAMN3897929864II10/29/10+>2>8NA45int--+
30-027HealthyThis studySAMN3897929964II12/16/10+2>8NA45int--+
36-067SurgicalThis studySAMN3897930064II9/9/11+2>8NA45--+
42-072UrineThis studySAMN3897930164II1/3/13+2>8NA45int--+
11-092Surgical[24]283734.132071III10/28/08+>2>8III(KM1381)+--
16-041Urine[24]283734.133571III10/14/09+>2>8III(KM1381)+++
16-047Surgical[24]283734.133671III10/16/09+>2>8III(KM1381)+++
27-080Surgical[24]283734.135671III8/19/10+>2>8III(KM1381)+--
28-009SurgicalThis studySAMN3897930371III9/1/10+>2>8III(KM1381)+++
38-020Surgical[24]283734.143871III11/21/11+>2>8III(KM1381)+++
39-094Pyoderma[24]283734.145871III3/16/12+>2>8III(KM1381)+++
10-098Pyoderma[24]283734.131568IV2/26/08+0.5>8VT--+
11-012Pyoderma[24]283734.131668IV3/17/08+>2>8VT--+
13-061Surgical[24]283734.133068IV12/30/08+0.5>8VT--+
16-021Urine[24]283734.133468IV9/21/09+2>8VT--+
19-007SurgicalThis studySAMN3897930268IV2/2/10+0.5>8VT--+
22-078Urine[24]283734.134468IV3/2/10+1>8VT--+
27-010Surgical[24]283734.135068IV7/14/10+1>8VT--+
27-023Urine[24]283734.135268IV7/20/10+0.5>8VT--+
32-003Surgical[24]283734.138568IV3/29/11+>2>8VT--+
33-021Surgical[24]283734.139368IV4/28/11+>2>8VT--+
34-031Urine[24]283734.140168IV6/16/11+2>8VT--+
39-002Urine[24]283734.145268IV1/6/12+0.5>8VT--+
37-032Pyoderma[24]283734.1401850II10/6/11-≤0.250.5NA--+f
32-012Healthy[24]283734.1452871II4/1/11-≤0.250.5NA--+
ED99Pyoderma[24]CP002478.125IIIN/A-≤0.251NA--+
a MLST (multilocus sequence types) as determined previously [24]. b Agr group as determined previously [24]. c Presence of mecA was previously determined by WGS [24] and confirmed by real-time PCR (this study). d Determined by MIC (µg/mL). e psm-mec gene sequence detected from WGS data. f Detected in stationary-phase (16 h) cultures through RP-HPLC/ESI-MS. g This strain produces a δ-toxin variant as described in Maali et al. [30]. h Present. i Absent/below detection limit.
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Cheung, G.Y.C.; Lee, J.H.; Liu, R.; Lawhon, S.D.; Yang, C.; Otto, M. Methicillin Resistance Elements in the Canine Pathogen Staphylococcus pseudintermedius and Their Association with the Peptide Toxin PSM-mec. Antibiotics 2024, 13, 130. https://doi.org/10.3390/antibiotics13020130

AMA Style

Cheung GYC, Lee JH, Liu R, Lawhon SD, Yang C, Otto M. Methicillin Resistance Elements in the Canine Pathogen Staphylococcus pseudintermedius and Their Association with the Peptide Toxin PSM-mec. Antibiotics. 2024; 13(2):130. https://doi.org/10.3390/antibiotics13020130

Chicago/Turabian Style

Cheung, Gordon Y. C., Ji Hyun Lee, Ryan Liu, Sara D. Lawhon, Ching Yang, and Michael Otto. 2024. "Methicillin Resistance Elements in the Canine Pathogen Staphylococcus pseudintermedius and Their Association with the Peptide Toxin PSM-mec" Antibiotics 13, no. 2: 130. https://doi.org/10.3390/antibiotics13020130

APA Style

Cheung, G. Y. C., Lee, J. H., Liu, R., Lawhon, S. D., Yang, C., & Otto, M. (2024). Methicillin Resistance Elements in the Canine Pathogen Staphylococcus pseudintermedius and Their Association with the Peptide Toxin PSM-mec. Antibiotics, 13(2), 130. https://doi.org/10.3390/antibiotics13020130

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop