Postbiotic Metabolite Derived from Lactiplantibacillus plantarum PD18 Maintains the Integrity of Cell Barriers and Affects Biomarkers Associated with Periodontal Disease
Abstract
1. Introduction
2. Results
2.1. Identification of PM PD18 Using GC–MS and HPLC
2.2. Safety Assessment of PM PD18
2.2.1. Effect of PM PD18 on Viability of RAW 264.7 Cells
2.2.2. Effect of PM PD18 on Wound Healing
2.3. Effect of PM PD18 on Adhesion of Pathogens to SF-TY Cells
2.4. Effect of PM PD18 on Induced SF-TY Cell Monolayer Permeability
2.5. Effect of PM PD18 on Alkaline Phosphatase (ALP) Activity of SF-TY Cells
2.6. Modulation of Inflammatory Cytokines in SF-TY Cells Using PM PD18
2.7. Effect of PM PD18 on Inflammatory Cytokines and Tight Junction Protein Gene Expression
3. Discussion
4. Materials and Methods
4.1. Bacterial Strain and Culture Conditions
4.2. Preparation of Postbiotic Metabolite of L. plantarum PD18 (PM PD18)
4.3. Identification of PM PD18
4.3.1. Gas Chromatography–Mass Spectrometry (GC–MS) Analysis
4.3.2. High-Performance Liquid Chromatography (HPLC)
4.4. Cell Culture
4.5. Safety Evaluations of PM PD18
4.5.1. Cell Viability Assay
4.5.2. Scratch Wound Healing Assay
4.6. Antiadhesion Assay
4.7. SF-TY Cells Treated with PM PD18 in Transwell Culture Insert Plate
4.8. Transepithelial Electrical Resistance (TEER) Measurements
4.9. Determination of Alkaline Phosphatase (ALP) Activity
4.10. Effect of PM PD18 on Inflammatory Cytokines in SF-TY Cells
4.11. Quantitative Real-Time Polymerase Chain Reaction (qRT-PCR) Analysis
4.12. Western Blot (WB) Analysis
4.13. Statistical Analysis
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Butrungrod, W.; Chaiyasut, C.; Makhamrueang, N.; Peerajan, S.; Chaiyana, W.; Sirilun, S. Postbiotic Metabolite of Lactiplantibacillus plantarum PD18 against Periodontal Pathogens and Their Virulence Markers in Biofilm Formation. Pharmaceutics 2023, 15, 1419. [Google Scholar] [CrossRef] [PubMed]
- Haque, M.M.; Yerex, K.; Kelekis-Cholakis, A.; Duan, K. Advances in novel therapeutic approaches for periodontal diseases. BMC Oral Health 2022, 22, 492. [Google Scholar] [CrossRef] [PubMed]
- Peres, M.A.; Macpherson, L.M.; Weyant, R.J.; Daly, B.; Venturelli, R.; Mathur, M.R.; Listl, S.; Celeste, R.K.; Guarnizo-Herreño, C.C.; Kearns, C. Oral diseases: A global public health challenge. Lancet 2019, 394, 249–260. [Google Scholar] [CrossRef] [PubMed]
- Brauchle, F.; Noack, M.; Reich, E. Impact of periodontal disease and periodontal therapy on oral health-related quality of life. Int. Dent. J. 2013, 63, 306–311. [Google Scholar] [CrossRef]
- Saito, A.; Hosaka, Y.; Kikuchi, M.; Akamatsu, M.; Fukaya, C.; Matsumoto, S.; Ueshima, F.; Hayakawa, H.; Fujinami, K.; Nakagawa, T. Effect of initial periodontal therapy on oral health–related quality of life in patients with periodontitis in Japan. J. Periodontol. 2010, 81, 1001–1009. [Google Scholar] [CrossRef]
- Frencken, J.E.; Sharma, P.; Stenhouse, L.; Green, D.; Laverty, D.; Dietrich, T. Global epidemiology of dental caries and severe periodontitis–a comprehensive review. J. Clin. Periodontol. 2017, 44, S94–S105. [Google Scholar] [CrossRef]
- Scannapieco, F.A.; Gershovich, E. The prevention of periodontal disease—An overview. Periodontology 2000 2020, 84, 9–13. [Google Scholar] [CrossRef]
- Chen, W.A.; Dou, Y.; Fletcher, H.M.; Boskovic, D.S. Local and systemic effects of Porphyromonas gingivalis infection. Microorganisms 2023, 11, 470. [Google Scholar] [CrossRef]
- Cardoso, E.M.; Reis, C.; Manzanares-Céspedes, M.C. Chronic periodontitis, inflammatory cytokines, and interrelationship with other chronic diseases. Postgrad. Med. 2018, 130, 98–104. [Google Scholar] [CrossRef]
- Yamaji, Y.; Kubota, T.; Sasaguri, K.; Sato, S.; Suzuki, Y.; Kumada, H.; Umemoto, T. Inflammatory cytokine gene expression in human periodontal ligament fibroblasts stimulated with bacterial lipopolysaccharides. Infect. Immun. 1995, 63, 3576–3581. [Google Scholar] [CrossRef]
- Huang, G.T.-J.; Kim, D.; Lee, J.K.-H.; Kuramitsu, H.K.; Haake, S.K. Interleukin-8 and intercellular adhesion molecule 1 regulation in oral epithelial cells by selected periodontal bacteria: Multiple effects of Porphyromonas gingivalis via antagonistic mechanisms. Infect. Immun. 2001, 69, 1364–1372. [Google Scholar] [CrossRef] [PubMed]
- Morandini, A.C.d.F.; Sipert, C.R.; Ramos-Junior, E.S.; Brozoski, D.T.; Santos, C.F. Periodontal ligament and gingival fibroblasts participate in the production of TGF-β, interleukin (IL)-8 and IL-10. Braz. Oral Res. 2011, 25, 157–162. [Google Scholar] [CrossRef] [PubMed]
- Han, N.; Jia, L.; Guo, L.; Su, Y.; Luo, Z.; Du, J.; Mei, S.; Liu, Y. Balanced oral pathogenic bacteria and probiotics promoted wound healing via maintaining mesenchymal stem cell homeostasis. Stem Cell Res. Ther. 2020, 11, 61. [Google Scholar] [CrossRef] [PubMed]
- Duan, Y.; An, W.; Wu, Y.; Wang, J. Tetramethylpyrazine reduces inflammation levels and the apoptosis of LPS-stimulated human periodontal ligament cells via the downregulation of miR-302b. Int. J. Mol. Med. 2020, 45, 1918–1926. [Google Scholar] [CrossRef] [PubMed]
- Singh, S.B.; Coffman, C.N.; Varga, M.G.; Carroll-Portillo, A.; Braun, C.A.; Lin, H.C. Intestinal alkaline phosphatase prevents sulfate reducing bacteria-induced increased tight junction permeability by inhibiting snail pathway. Front. Cell. Infect. Microbiol. 2022, 12, 882498. [Google Scholar] [CrossRef]
- Zihni, C.; Mills, C.; Matter, K.; Balda, M.S. Tight junctions: From simple barriers to multifunctional molecular gates. Nat. Rev. Mol. Cell Biol. 2016, 17, 564–580. [Google Scholar] [CrossRef]
- Makino-Oi, A.; Ishii, Y.; Hoshino, T.; Okubo, N.; Sugito, H.; Hosaka, Y.; Fukaya, C.; Nakagawa, T.; Saito, A. Effect of periodontal surgery on oral health-related quality of life in patients who have completed initial periodontal therapy. J. Periodontal Res. 2016, 51, 212–220. [Google Scholar] [CrossRef]
- Lai, S.; Lingström, P.; Cagetti, M.G.; Cocco, F.; Meloni, G.; Arrica, M.A.; Campus, G. Effect of Lactobacillus brevis CD2 containing lozenges and plaque pH and cariogenic bacteria in diabetic children: A randomised clinical trial. Clin. Oral Investig. 2021, 25, 115–123. [Google Scholar] [CrossRef]
- Saïz, P.; Taveira, N.; Alves, R. Probiotics in oral health and disease: A systematic review. Appl. Sci. 2021, 11, 8070. [Google Scholar] [CrossRef]
- Jung, J.-I.; Baek, S.-M.; Nguyen, T.H.; Kim, J.W.; Kang, C.-H.; Kim, S.; Imm, J.-Y. Effects of probiotic culture supernatant on cariogenic biofilm formation and RANKL-induced osteoclastogenesis in RAW 264.7 macrophages. Molecules 2021, 26, 733. [Google Scholar] [CrossRef]
- Che, J.; Shi, J.; Fang, C.; Zeng, X.; Wu, Z.; Du, Q.; Tu, M.; Pan, D. Elimination of pathogen biofilms via postbiotics from lactic acid bacteria: A promising method in food and biomedicine. Microorganisms 2024, 12, 704. [Google Scholar] [CrossRef] [PubMed]
- Yeşilyurt, N.; Yılmaz, B.; Ağagündüz, D.; Capasso, R. Involvement of probiotics and postbiotics in the immune system modulation. Biologics 2021, 1, 89–110. [Google Scholar] [CrossRef]
- Ma, L.; Tu, H.; Chen, T. Postbiotics in human health: A narrative review. Nutrients 2023, 15, 291. [Google Scholar] [CrossRef]
- Wanhong, L.; Fang, L.; Fan, W.; Maiqi, D.; Tiansen, L. Industrial water pollution and transboundary eco-compensation: Analyzing the case of Songhua River Basin, China. Environ. Sci. Pollut. Res. 2020, 27, 34746–34759. [Google Scholar] [CrossRef] [PubMed]
- Moraes, R.M.; Schlagenhauf, U.; Anbinder, A.L. Outside the limits of bacterial viability: Postbiotics in the management of periodontitis. Biochem. Pharmacol. 2022, 201, 115072. [Google Scholar] [CrossRef]
- Salminen, S.; Collado, M.C.; Endo, A.; Hill, C.; Lebeer, S.; Quigley, E.M.; Sanders, M.E.; Shamir, R.; Swann, J.R.; Szajewska, H. The International Scientific Association of Probiotics and Prebiotics (ISAPP) consensus statement on the definition and scope of postbiotics. Nat. Rev. Gastroenterol. Hepatol. 2021, 18, 649–667. [Google Scholar] [CrossRef]
- Shi, J.; Wang, Q.; Ruan, G.; Chen, Y.; Zhao, M.; Shi, D.; Pan, B.; Xu, Z.; Zhang, T.; Wang, F. Efficacy of probiotics against dental caries in children: A systematic review and meta-analysis. Crit. Rev. Food Sci. Nutr. 2023, 63, 9977–9994. [Google Scholar] [CrossRef] [PubMed]
- Hajishengallis, G. Interconnection of periodontal disease and comorbidities: Evidence, mechanisms, and implications. Periodontology 2000 2022, 89, 9–18. [Google Scholar] [CrossRef]
- Lin, J.; Wang, Q.; Zhou, S.; Xu, S.; Yao, K. Tetramethylpyrazine: A review on its mechanisms and functions. Biomed. Pharmacother. 2022, 150, 113005. [Google Scholar] [CrossRef]
- Zhao, J.-h.; Ji, L.; Wang, H.; Chen, Z.-Q.; Zhang, Y.-T.; Liu, Y.; Feng, N.-P. Microemulsion-based novel transdermal delivery system of tetramethylpyrazine: Preparation and evaluation in vitro and in vivo. Int. J. Nanomed. 2011, 6, 1611–1619. [Google Scholar]
- Cui, D.-Y.; Wei, Y.-N.; Lin, L.-C.; Chen, S.-J.; Feng, P.-P.; Xiao, D.-G.; Lin, X.; Zhang, C.-Y. Increasing yield of 2, 3, 5, 6-tetramethylpyrazine in Baijiu through Saccharomyces cerevisiae metabolic engineering. Front. Microbiol. 2020, 11, 596306. [Google Scholar] [CrossRef] [PubMed]
- Lee, J.-E.; Woo, G.-J.; Lee, H.-J. Tetramethylpyrazine production by immobilized culture of Lactococcus lactis subsp. lactis biovar diacetilactis FCl. J. Microbiol. Biotechnol. 1996, 6, 137–141. [Google Scholar]
- McFall, S.M.; Montville, T.J. pH-mediated regulation of pyruvate catabolism in Lactobacillus plantarum chemostat cultures. J. Ind. Microbiol. Biotechnol. 1989, 4, 335–340. [Google Scholar]
- Hegazi, F.Z.; Abo-Elnaga, I.G. Production of acetoin and diacetyl by lactic acid bacteria in skimmed milk with added citrate and pyruvate. Z. Für Lebensm.-Unters. Und-Forsch. 1981, 171, 367–370. [Google Scholar] [CrossRef]
- Cho, Y.-D.; Kim, K.-H.; Lee, Y.-M.; Ku, Y.; Seol, Y.-J. Periodontal wound healing and tissue regeneration: A narrative review. Pharmaceuticals 2021, 14, 456. [Google Scholar] [CrossRef]
- Wang, S.-S.; Tang, Y.-L.; Pang, X.; Zheng, M.; Tang, Y.-J.; Liang, X.-H. The maintenance of an oral epithelial barrier. Life Sci. 2019, 227, 129–136. [Google Scholar] [CrossRef] [PubMed]
- Marre, A.T.d.O.; Domingues, R.M.; Lobo, L.A. Adhesion of anaerobic periodontal pathogens to extracellular matrix proteins. Braz. J. Microbiol. 2020, 51, 1483–1491. [Google Scholar] [CrossRef]
- Esteban-Fernández, A.; Zorraquín-Peña, I.; Ferrer, M.D.; Mira, A.; Bartolomé, B.A.; Gonzalez de Llano, D.; Moreno-Arribas, M.V. Inhibition of oral pathogens adhesion to human gingival fibroblasts by wine polyphenols alone and in combination with an oral probiotic. J. Agric. Food Chem. 2018, 66, 2071–2082. [Google Scholar] [CrossRef] [PubMed]
- Ciandrini, E.; Campana, R.; Baffone, W. Live and heat-killed Lactobacillus spp. interfere with Streptococcus mutans and Streptococcus oralis during biofilm development on titanium surface. Arch. Oral Biol. 2017, 78, 48–57. [Google Scholar] [CrossRef]
- Casula, E.; Pisano, M.B.; Serreli, G.; Zodio, S.; Melis, M.P.; Corona, G.; Costabile, A.; Cosentino, S.; Deiana, M. Probiotic lactobacilli attenuate oxysterols-induced alteration of intestinal epithelial cell monolayer permeability: Focus on tight junction modulation. Food Chem. Toxicol. 2023, 172, 113558. [Google Scholar] [CrossRef]
- Scher, J.U.; Abramson, S.B. The microbiome and rheumatoid arthritis. Nat. Rev. Rheumatol. 2011, 7, 569–578. [Google Scholar] [CrossRef] [PubMed]
- Liu, H.-Y.; Roos, S.; Jonsson, H.; Ahl, D.; Dicksved, J.; Lindberg, J.E.; Lundh, T. Effects of Lactobacillus johnsonii and Lactobacillus reuteri on gut barrier function and heat shock proteins in intestinal porcine epithelial cells. Physiol. Rep. 2015, 3, e12355. [Google Scholar] [CrossRef] [PubMed]
- Suzuki, T. Regulation of intestinal epithelial permeability by tight junctions. Cell. Mol. Life Sci. 2013, 70, 631–659. [Google Scholar] [CrossRef] [PubMed]
- Yang, K.; Jiang, Z.; Zheng, C.; Wang, L.; Yang, X. Effect of Lactobacillus plantarum on diarrhea and intestinal barrier function of young piglets challenged with enterotoxigenic Escherichia coli K88. J. Anim. Sci. 2014, 92, 1496–1503. [Google Scholar] [CrossRef]
- Wu, Y.; Zhu, C.; Chen, Z.; Chen, Z.; Zhang, W.; Ma, X.; Wang, L.; Yang, X.; Jiang, Z. Protective effects of Lactobacillus plantarum on epithelial barrier disruption caused by enterotoxigenic Escherichia coli in intestinal porcine epithelial cells. Vet. Immunol. Immunopathol. 2016, 172, 55–63. [Google Scholar] [CrossRef]
- Zheng, L.; Kelly, C.J.; Battista, K.D.; Schaefer, R.; Lanis, J.M.; Alexeev, E.E.; Wang, R.X.; Onyiah, J.C.; Kominsky, D.J.; Colgan, S.P. Microbial-derived butyrate promotes epithelial barrier function through IL-10 receptor–dependent repression of claudin-2. J. Immunol. 2017, 199, 2976–2984. [Google Scholar] [CrossRef]
- Peng, L.; Li, Z.-R.; Green, R.S.; Holzmanr, I.R.; Lin, J. Butyrate enhances the intestinal barrier by facilitating tight junction assembly via activation of AMP-activated protein kinase in Caco-2 cell monolayers. J. Nutr. 2009, 139, 1619–1625. [Google Scholar] [CrossRef]
- Saeed, M.; Afzal, Z.; Afzal, F.; Khan, R.U.; Elnesr, S.S.; Alagawany, M.; Chen, H. Use of postbiotic as growth promoter in poultry industry: A review of current knowledge and future prospects. Food Sci. Anim. Resour. 2023, 43, 1111. [Google Scholar] [CrossRef]
- Behzadi, P.; Sameer, A.S.; Nissar, S.; Banday, M.Z.; Gajdács, M.; García-Perdomo, H.A.; Akhtar, K.; Pinheiro, M.; Magnusson, P.; Sarshar, M. The Interleukin-1 (IL-1) superfamily cytokines and their single nucleotide polymorphisms (SNPs). J. Immunol. Res. 2022, 2022, 2054431. [Google Scholar] [CrossRef]
- Haileselassie, Y.; Navis, M.; Vu, N.; Qazi, K.R.; Rethi, B.; Sverremark-Ekström, E. Postbiotic modulation of retinoic acid imprinted mucosal-like dendritic cells by probiotic Lactobacillus reuteri 17938 in vitro. Front. Immunol. 2016, 7, 96. [Google Scholar] [CrossRef]
- Chen, J.C.; Chen, Q.H.; Guo, Q.; Ruan, S.; Ruan, H.; He, G.Q.; Gu, Q. Simultaneous determination of acetoin and tetramethylpyrazine in traditional vinegars by HPLC method. Food Chem. 2010, 122, 1247–1252. [Google Scholar] [CrossRef]
- Lee, K.; Kim, H.J.; Kim, S.A.; Park, S.-D.; Shim, J.-J.; Lee, J.-L. Exopolysaccharide from Lactobacillus plantarum HY7714 protects against skin aging through skin–gut axis communication. Molecules 2021, 26, 1651. [Google Scholar] [CrossRef]
- Governa, P.; Carullo, G.; Biagi, M.; Rago, V.; Aiello, F. Evaluation of the in vitro wound-healing activity of calabrian honeys. Antioxidants 2019, 8, 36. [Google Scholar] [CrossRef] [PubMed]
- Darling, N.J.; Mobbs, C.L.; González-Hau, A.L.; Freer, M.; Przyborski, S. Bioengineering novel in vitro co-culture models that represent the human intestinal mucosa with improved Caco-2 structure and barrier function. Front. Bioeng. Biotechnol. 2020, 8, 992. [Google Scholar] [CrossRef]
- Li, N.; Sui, Z.; Liu, Y.; Wang, D.; Ge, G.; Yang, L. A fast screening model for drug permeability assessment based on native small intestinal extracellular matrix. RSC Adv. 2018, 8, 34514–34524. [Google Scholar] [CrossRef] [PubMed]
- Klinder, A.; Seyfarth, A.; Hansmann, D.; Bader, R.; Jonitz-Heincke, A. Inflammatory response of human peripheral blood mononuclear cells and osteoblasts incubated with metallic and ceramic submicron particles. Front. Immunol. 2018, 9, 831. [Google Scholar] [CrossRef] [PubMed]
- Weiss, G.; Christensen, H.R.; Zeuthen, L.H.; Vogensen, F.K.; Jakobsen, M.; Frøkiær, H. Lactobacilli and bifidobacteria induce differential interferon-β profiles in dendritic cells. Cytokine 2011, 56, 520–530. [Google Scholar] [CrossRef]
- Yang, F.; Wang, A.; Zeng, X.; Hou, C.; Liu, H.; Qiao, S. Lactobacillus reuteri I5007 modulates tight junction protein expression in IPEC-J2 cells with LPS stimulation and in newborn piglets under normal conditions. BMC Microbiol. 2015, 15, 32. [Google Scholar] [CrossRef]
- Ahn, S.; Siddiqi, M.H.; Aceituno, V.C.; Simu, S.Y.; Zhang, J.; Jimenez Perez, Z.E.; Kim, Y.-J.; Yang, D.-C. Ginsenoside Rg5: Rk1 attenuates TNF-α/IFN-γ-induced production of thymus-and activation-regulated chemokine (TARC/CCL17) and LPS-induced NO production via downregulation of NF-κB/p38 MAPK/STAT1 signaling in human keratinocytes and macrophages. Vitr. Cell. Dev. Biol.-Anim. 2016, 52, 287–295. [Google Scholar] [CrossRef]
- Karimi, F.; Hamidian, Y.; Behrouzifar, F.; Mostafazadeh, R.; Ghorbani-HasanSaraei, A.; Alizadeh, M.; Mortazavi, S.-M.; Janbazi, M.; Asrami, P.N. An applicable method for extraction of whole seeds protein and its determination through Bradford’s method. Food Chem. Toxicol. 2022, 164, 113053. [Google Scholar] [CrossRef]
Name | Time of Culture (h) | Retention Time (min) | Concentration (% w/w) |
---|---|---|---|
2,3,5,6-Tetramethylpyrazine | 0 | Not detected | Not detected |
72 | 8.896 | 0.100 |
Sample | Secretion of Cytokines (pg/mL) | ||
---|---|---|---|
IL-6 | IL-8 | IL-10 | |
Control | 1.17 ± 0.10 e | 7.63 ± 0.14 e | 7.91 ± 0.15 c |
Pg | 7.63 ± 0.10 a | 47.83 ± 0.09 a | ND |
LPS | 3.83 ± 0.01 b | 22.29 ± 0.03 b | ND |
25% PD18 | 1.12 ± 0.02 e | 2.74 ± 0.17 g | 15.04 ± 0.09 b |
25% PD18 + Pg | 1.53 ± 0.01 c | 7.98 ± 0.09 e | 6.91 ± 0.08 d |
25% PD18 + LPS | 1.33 ± 0.06 d | 3.90 ± 0.08 f | 6.14 ± 0.09 e |
50% PD18 | ND | 4.05 ± 0.38 f | 92.18 ± 0.10 a |
50% PD18 + Pg | 0.01 ± 0.00 f | 11.96 ± 0.13 c | 7.91 ± 0.07 c |
50% PD18 + LPS | 1.15 ± 0.04 e | 9.12 ± 0.10 d | 6.60 ± 0.10 d |
Primer | Sequence (5′–3′) | NCBI RefSeq | Reference |
---|---|---|---|
IL-6 | F: TGGATTCAATGAGGAGACTGCC R: CTGGCATTTGTGGTTGGGTC | NM_000600.3 | [56] |
IL-8 | F: TCTGTGTGAAGGTGCAGTTTTG R: ATTTCTGTGTTGGCGCAGTG | NM_00584.3 | [56] |
IL-10 | F: AGCATGGCCCAGAAATCAAG R: CGCATCCTGAGGGTCTTCAG | NM_010548 | [57] |
ZO-1 | F: GAGTTTGATAGTGGCGTT R: GTGGGAGGATGCTGTTGT | AJ318101.1 | [58] |
β-actin | F: CACCCGCGAGTACAACCTTC R: CCCATACCCACCATCACACC | NM_031144.2 | [59] |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Butrungrod, W.; Chaiyasut, C.; Makhamrueang, N.; Peerajan, S.; Chaiyana, W.; Sirilun, S. Postbiotic Metabolite Derived from Lactiplantibacillus plantarum PD18 Maintains the Integrity of Cell Barriers and Affects Biomarkers Associated with Periodontal Disease. Antibiotics 2024, 13, 1054. https://doi.org/10.3390/antibiotics13111054
Butrungrod W, Chaiyasut C, Makhamrueang N, Peerajan S, Chaiyana W, Sirilun S. Postbiotic Metabolite Derived from Lactiplantibacillus plantarum PD18 Maintains the Integrity of Cell Barriers and Affects Biomarkers Associated with Periodontal Disease. Antibiotics. 2024; 13(11):1054. https://doi.org/10.3390/antibiotics13111054
Chicago/Turabian StyleButrungrod, Widawal, Chaiyavat Chaiyasut, Netnapa Makhamrueang, Sartjin Peerajan, Wantida Chaiyana, and Sasithorn Sirilun. 2024. "Postbiotic Metabolite Derived from Lactiplantibacillus plantarum PD18 Maintains the Integrity of Cell Barriers and Affects Biomarkers Associated with Periodontal Disease" Antibiotics 13, no. 11: 1054. https://doi.org/10.3390/antibiotics13111054
APA StyleButrungrod, W., Chaiyasut, C., Makhamrueang, N., Peerajan, S., Chaiyana, W., & Sirilun, S. (2024). Postbiotic Metabolite Derived from Lactiplantibacillus plantarum PD18 Maintains the Integrity of Cell Barriers and Affects Biomarkers Associated with Periodontal Disease. Antibiotics, 13(11), 1054. https://doi.org/10.3390/antibiotics13111054