Interference with Bacterial Conjugation and Natural Alternatives to Antibiotics: Bridging a Gap
Abstract
:1. Introduction
2. Results
2.1. Physicochemical and Morphological Characteristics of Lipid Nanocarriers
2.2. Minimum Inhibitory Concentration (MIC) of Sage and Olibanum Lipidic Nanocarriers
2.3. Spectral Evaluation and Co-Product Supplementation
2.4. Gene Exchange and Inhibitors of the Conjugation Process
2.5. Molecular Analyses
3. Discussion
4. Materials and Methods
4.1. Origin of Strains
4.2. Nanostructured Lipidic Carriers
4.3. Determination of the Minimum Inhibitory Concentration (MIC)
4.4. Chicken Juice and Whey
4.5. Fourier-Transform Infrared (FTIR)
4.6. Bacterial Conjugation and Inhibition of HGT by Nanocarriers
- (i)
- Traditional conjugation (no supplements): 180 μL of the donor strain (S. Heidelberg) and 720 μL of the recipient strain (E. coli J53AzR) represented the co-culture in a 1:4 ratio, added to 100 μL of each NLC (salvia or olibanum).
- (ii)
- SL coproduct conjugation (5%): 170 μL of the donor strain (S. Heidelberg) and 680 μL of the recipient strain (E. coli J53 AzR), preserving the 1:4 ratio, added to 50 μL of SL and 100 μL of each of the NLCs in separate reactions.
- (iii)
- CJ coproduct conjugation (5%): 170 μL of the donor strain (S. Heidelberg) and 680 μL of the recipient (E. coli J53 AzR), preserving the ratio of 1:4, added to 50 μL of CJ and 100 μL of each of the NLCs in separate reactions.
- (i)
- Traditional conjugation (no supplements): 800 μL of the donor and 200 μL of the recipient.
- (ii)
- Conjugation with SL coproduct (5%): 190 μL of the donor strain, 760 μL of the recipient, and 50 μL of SL.
- (iii)
- CJ coproduct conjugation (5%): 190 μL of the donor strain, 760 μL of the recipient, and 50 μL of CJ. After recombination, the co-cultures were subjected to serial decimal dilution (10−1 to 10−8) in 0.85% saline, followed by surface plating on MacConkey agar (Biokar®) supplemented with ampicillin (90 μg/mL) and sodium azide (160 μg/mL) for the determination of trans-conjugative colonies of resistant E. coli J53AzR. All assays were performed in triplicate and three repetitions.
4.7. Identification of Recombinants
4.8. Gene Recombination Frequency
4.9. Scanning Electron Microscopy (SEM)
4.9.1. SEM—Conjugation
4.9.2. SEM—NLC
4.10. Statistical Analysis
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Thompson, T. The Staggering Death Toll of Drug-Resistant Bacteria. Nature 2022, 6. [Google Scholar] [CrossRef]
- Anvisa Boletim Segurança do Paciente e Qualidade em Serviços de Saúde n. 28. Agência Nacional de Vigilância Sanitária 2022. Available online: https://www.gov.br/anvisa/pt-br/centraisdeconteudo/publicacoes/servicosdesaude/boletins-e-relatorios-das-notificacoes-de-iras-e-outros-eventos-adversos-1/boletins-e-relatorios-das-notificacoes-de-iras-e-outros-eventos-adversos (accessed on 5 April 2023).
- Santos, A.L.; Dos Santos, A.P.; Ito, C.R.M.; Queiroz, P.H.P.D.; de Almeida, J.A.; de Carvalho Júnior, M.A.B.; de Oliveira, C.Z.; Avelino, M.A.G.; Wastowski, I.J.; Gomes, G.P.L.A.; et al. Profile of Enterobacteria Resistant to Beta-Lactams. Antibiotics 2020, 9, 410. [Google Scholar] [CrossRef] [PubMed]
- Oladeinde, A.; Cook, K.; Lakin, S.M.; Abdo, Z.; Looft, T.; Herrington, K.; Zock, G.; Lawrence, J.P.; Thomas, J.C.; Beaudry, M.S.; et al. Dynamics Between Horizontal Gene Transfer and Acquired Antibiotic Resistance in S. Heidelberg Following IN VITRO Incubation in Broiler Ceca. bioRxiv 2019, 85, 684787. [Google Scholar] [CrossRef] [Green Version]
- Amador, P.; Fernandes, R.; Prudêncio, C.; Brito, L. Resistance to β-Lactams in Bacteria Isolated from Different Types of Portuguese Cheese. Int. J. Mol. Sci. 2009, 10, 1538–1551. [Google Scholar] [CrossRef] [Green Version]
- Sunde, M.; Tharaldsen, H.; Slettemeås, J.S.; Norström, M.; Carattoli, A.; Bjorland, J. Escherichia Coli of Animal Origin in Norway Contains a blaTEM-20-Carrying Plasmid Closely Related to blaTEM-20 and blaTEM-52 Plasmids from Other European Countries. J. Antimicrob. Chemother. 2008, 63, 215–216. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Bibbal, D.; Dupouy, V.; Ferré, J.P.; Toutain, P.L.; Fayet, O.; Prère, M.F.; Bousquet-Mélou, A. Impact of Three Ampicillin Dosage Regimens on Selection of Ampicillin Resistance in Enterobacteriaceae and Excretion of bla TEM Genes in Swine Feces. Appl. Environ. Microbiol. 2007, 73, 4785–4790. [Google Scholar] [CrossRef] [Green Version]
- Singh, G.; Vajpayee, P.; Rani, N.; Amoah, I.D.; Stenström, T.A.; Shanker, R. Exploring the Potential Reservoirs of Non Specific TEM Beta Lactamase ( bla TEM ) Gene in the Indo-Gangetic Region: A risk Assessment Approach to Predict Health Hazards. J. Hazard. Mater. 2016, 314, 121–128. [Google Scholar] [CrossRef]
- Tekiner, I.H.; Özpınar, H. Occurrence and Characteristics of Extended Spectrum Beta-Lactamases-Producing Enterobacteriaceae from Foods of Animal Origin. Braz. J. Microbiol. 2016, 47, 444–451. [Google Scholar] [CrossRef] [Green Version]
- Virolle, C.; Goldlust, K.; Djermoun, S.; Bigot, S.; Lesterlin, C. Plasmid Transfer by Conjugation in Gram-Negative Bacteria: From the Cellular to the Community Level. Genes 2020, 11, 1239. [Google Scholar] [CrossRef] [PubMed]
- Olesen, I.; Hasman, H.; Aarestrup, F.M.; Wyrsch, E.R.; Chowdhury, P.R.; Chapman, T.A.; Charles, I.G.; Hammond, J.M.; Djordjevic, S.P.; Matias, C.A.R.; et al. Prevalence of β-Lactamases Among Ampicillin-Resistant Escherichia coli and Salmonella Isolated from Food Animals in Denmark. Microb. Drug Resist. 2004, 10, 334–340. [Google Scholar] [CrossRef]
- Walsh, C.; Duffy, G.; Nally, P.; O’mahony, R.; McDowell, D.; Fanning, S. Transfer of Ampicillin Resistance from Salmonella Typhimurium DT104 to Escherichia Coli K12 in Food. Lett. Appl. Microbiol. 2007, 46, 210–215. [Google Scholar] [CrossRef] [PubMed]
- Samtiya, M.; Matthews, K.R.; Dhewa, T.; Puniya, A.K. Antimicrobial Resistance in the Food Chain: Trends, Mechanisms, Pathways, and Possible Regulation Strategies. Foods 2022, 11, 2966. [Google Scholar] [CrossRef]
- Ansharieta, R.; Ramandinianto, S.C.; Effendi, M.H.; Plumeriastuti, H. Molecular Identification Of Blactx-M And Blatem Genes Encoding Extended-Spectrum ß-Lactamase (ESBL) Producing Escherichia Coli Isolated From Raw Cow’s Milk in East Java, Indonesia. Biodiversitas J. Biol. Divers. 2021, 22, 1600–1605. [Google Scholar] [CrossRef]
- Effendi, M.H.; Bintari, I.G.; Aksono, E.B.; Hermawan, I.P. Detection of blaTEM Gene of Klebsiella Pneumoniae Isolated from Swab of Food-Producing Animals in East Java. Trop. Anim. Sci. J. 2018, 41, 174–178. [Google Scholar] [CrossRef] [Green Version]
- Dewangan, P.; Shakya, S.; Patyal, A.; Gade, N.E. Bhoomika Prevalence and Molecular Characterization of Extended-Spectrum b-Lactamases (blaTEM) Producing Escherichia Coli Isolated from Humans and Foods of Animal Origin in Chhattisgarh, India. Indian J. Anim. Res. 2016, 51, 310–315. [Google Scholar] [CrossRef] [Green Version]
- Liang, B.; Xie, Y.; He, S.; Mai, J.; Huang, Y.; Yang, L.; Zhong, H.; Deng, Q.; Yao, S.; Long, Y.; et al. Prevalence, Serotypes, and Drug Resistance of Nontyphoidal Salmonella Among Paediatric Patients in a Tertiary Hospital in Guangzhou, China, 2014–2016. J. Infect. Public Heal. 2019, 12, 252–257. [Google Scholar] [CrossRef]
- World Organization for Animal Health. Brazil Tracking AMR Country Self-Assessment Survey (TrACSS) 2022 Country Report AMR National Action Plan Governance 2022 TrACSS Country Report; World Organization for Animal Health: Paris, France, 2022; pp. 1–10. [Google Scholar]
- Monteiro, G.P.; Melo, R.T.D.; Guidotti-Takeuchi, M.; Dumont, C.F.; Ribeiro, R.A.C.; Guerra, W.; Ramos, L.M.S.; Paixão, D.A.; Santos, F.A.L.D.; Rodrigues, D.D.P.; et al. A Ternary Copper (II) Complex with 4-Fluorophenoxyacetic Acid Hydrazide in Combination with Antibiotics Exhibits Positive Synergistic Effect against Salmonella Typhimurium. Antibiotics 2022, 11, 388. [Google Scholar] [CrossRef]
- Peres, P.A.B.M.; de Melo, R.T.; Armendaris, P.M.; Barreto, F.; Perin, T.F.; Grazziotin, A.L.; Monteiro, G.P.; Mendonça, E.P.; Lourenzatto, E.C.A.; Bicalho, A.S.M.; et al. Multi-virulence and phenotypic spread of Campylobacter jejuni carried by 2chicken meat in Brazil (preprint). bioRxiv 2022. [Google Scholar] [CrossRef]
- Anjum, M.F.; Schmitt, H.; Börjesson, S.; Berendonk, T.U.; Donner, E.; Stehling, E.G.; Boerlin, P.; Topp, E.; Jardine, C.; Li, X.; et al. The Potential of Using E. coli as an Indicator for the Surveillance of Antimicrobial Resistance (AMR) in the Environment. Curr. Opin. Microbiol. 2021, 64, 152–158. [Google Scholar] [CrossRef]
- EU Commission. Commission Implementing Decision 2013/652/EU Commission Implementing Decision 2013/652/EU of 12 November 2013 on the Monitoring and Reporting of Antimicrobial Resistance in Zoonotic and Commensal Bacteria. Off. J. Eur. Union 2013, 303, 26–39. [Google Scholar]
- Carranza, G.; Menguiano, T.; Valenzuela-Gómez, F.; García-Cazorla, Y.; Cabezón, E.; Arechaga, I. Monitoring Bacterial Conjugation by Optical Microscopy. Front. Microbiol. 2021, 12, 750200. [Google Scholar] [CrossRef] [PubMed]
- Neil, K.; Allard, N.; Rodrigue, S. Molecular Mechanisms Influencing Bacterial Conjugation in the Intestinal Microbiota. Front. Microbiol. 2021, 12, 1–10. [Google Scholar] [CrossRef] [PubMed]
- Cascales, E.; Christie, P.J. The Versatile Bacterial Type IV Secretion Systems. Nat. Rev. Microbiol. 2003, 1, 137–149. [Google Scholar] [CrossRef] [Green Version]
- Alvarez-Martinez, C.E.; Christie, P.J. Biological Diversity of Prokaryotic Type IV Secretion Systems. Microbiol. Mol. Biol. Rev. 2009, 73, 775–808. [Google Scholar] [CrossRef] [Green Version]
- Lopatkin, A.J.; Huang, S.; Smith, R.P.; Srimani, J.K.; Sysoeva, T.A.; Bewick, S.; Karig, D.K.; You, L. Antibiotics as a Selective Driver for Conjugation Dynamics. Nat. Microbiol. 2016, 1, 16044. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Sheppard, R.J.; Beddis, A.E.; Barraclough, T.G. The Role of Hosts, Plasmids and Environment in Determining Plasmid Transfer Rates: A Meta-Analysis. Plasmid 2020, 108, 102489. [Google Scholar] [CrossRef] [PubMed]
- Getino, M.; Sanabria-Ríos, D.J.; Fernández-López, R.; Campos-Gomez, J.; Sánchez-López, J.M.; Fernández, A.; Carballeira, N.; de la Cruz, F. Synthetic Fatty Acids Prevent Plasmid-Mediated Horizontal Gene Transfer. mBio 2015, 6, 1–10. [Google Scholar] [CrossRef] [Green Version]
- Graf, F.E.; Palm, M.; Warringer, J.; Farewell, A. Inhibiting Conjugation as a Tool in the Fight Against Antibiotic Resistance. Drug Dev. Res. 2019, 80, 19–23. [Google Scholar] [CrossRef] [Green Version]
- Guidotti-Takeuchi, M.; Ribeiro, L.N.D.M.; dos Santos, F.A.L.; Rossi, D.A.; Della Lucia, F.; de Melo, R.T. Essential Oil-Based Nanoparticles as Antimicrobial Agents in the Food Industry. Microorganisms 2022, 10, 1504. [Google Scholar] [CrossRef]
- Baldim, I.; Paziani, M.H.; Barião, P.H.G.; Kress, M.R.V.Z.; Oliveira, W.P. Nanostructured Lipid Carriers Loaded with Lippia sidoides Essential Oil as a Strategy to Combat the Multidrug-Resistant Candida auris. Pharmaceutics 2022, 14, 180. [Google Scholar] [CrossRef]
- Nahr, F.K.; Ghanbarzadeh, B.; Hamishehkar, H.; Kafil, H.S. Food Grade Nanostructured Lipid Carrier for Cardamom Essential Oil: Preparation, Characterization and Antimicrobial Activity. J. Funct. Foods 2018, 40, 1–8. [Google Scholar] [CrossRef]
- Shajari, M.; Rostamizadeh, K.; Shapouri, R.; Taghavi, L. Eco-Friendly Curcumin-Loaded Nanostructured Lipid Carrier as an Efficient Antibacterial for Hospital Wastewater Treatment. Environ. Technol. Innov. 2020, 18, 100703. [Google Scholar] [CrossRef]
- Ribeiro, L.N.D.M.; de Paula, E.; Rossi, D.A.; Martins, F.A.; de Melo, R.T.; Monteiro, G.P.; Breitkreitz, M.C.; Goulart, L.R.; Fonseca, B.B. Nanocarriers from Natural Lipids With In Vitro Activity Against Campylobacter jejuni. Front. Cell. Infect. Microbiol. 2021, 10, 827. [Google Scholar] [CrossRef] [PubMed]
- Botelho, B.G.; Reis, N.; Oliveira, L.S.; Sena, M.M. Development and Analytical Validation of a Screening Method for Simultaneous Detection of Five Adulterants in Raw Milk Using Mid-Infrared Spectroscopy and PLS-DA. Food Chem. 2015, 181, 31–37. [Google Scholar] [CrossRef]
- Upadhyay, N.; Jaiswal, P.; Jha, S.N. Application of Attenuated Total Reflectance Fourier Transform Infrared Spectroscopy (ATR–FTIR) in MIR Range Coupled with Chemometrics for Detection of Pig Body Fat in Pure Ghee (Heat Clarified Milk Fat). J. Mol. Struct. 2018, 1153, 275–281. [Google Scholar] [CrossRef]
- Andrade, J.; Pereira, C.G.; Junior, J.C.D.A.; Viana, C.C.R.; Neves, L.N.D.O.; da Silva, P.H.F.; Bell, M.J.V.; Anjos, V.D.C.D. FTIR-ATR Determination of Protein Content to Evaluate Whey Protein Concentrate Adulteration. LWT 2019, 99, 166–172. [Google Scholar] [CrossRef]
- Andrade, J.; Pereira, C.G.; Ranquine, T.; Azarias, C.A.; Bell, M.J.V.; Anjos, V.D.C.D. Long-Term Ripening Evaluation of Ewes’ Cheeses by Fourier-Transformed Infrared Spectroscopy under Real Industrial Conditions. Spectrosc. 2018, 2018, 1381864. [Google Scholar] [CrossRef]
- El Darra, N.; Rajha, H.N.; Saleh, F.; Al-Oweini, R.; Maroun, R.G.; Louka, N. Food Fraud Detection in Commercial Pomegranate Molasses Syrups by UV–VIS Spectroscopy, ATR-FTIR Spectroscopy and HPLC Methods. Food Control. 2017, 78, 132–137. [Google Scholar] [CrossRef]
- Wang, X.; Esquerre, C.; Downey, G.; Henihan, L.; O’callaghan, D.; O’donnell, C. Feasibility of Discriminating Dried Dairy Ingredients and Preheat Treatments Using Mid-Infrared and Raman Spectroscopy. Food Anal. Methods 2017, 11, 1380–1389. [Google Scholar] [CrossRef]
- Martins, M.S.; Nascimento, M.H.; Barbosa, L.L.; Campos, L.C.; Singh, M.N.; Martin, F.L.; Romão, W.; Filgueiras, P.R.; Barauna, V.G. Detection and Quantification Using ATR-FTIR Spectroscopy of Whey Protein Concentrate Adulteration with Wheat Flour. LWT 2022, 172, 114161. [Google Scholar] [CrossRef]
- Rosanne, A.C.R.; Micaela, G.-T.; de Melo, R.T.; Carolyne, F.D.; de Araújo Brum, B.; Thais, J.M.; Wendell, G.L.M.; Sousa Ramos, D.A.R. Transfer of the bla TEM Gene Between Salmonella and Escherichia Coli Under Conditions of Animal Products Processing: Influence of a Copper Complex. Microbiol. Spectr. 2023. Available online: https://repositorio.ufu.br/bitstream/123456789/37150/3/Transfer%c3%aanciaGeneblaTEM.pdf (accessed on 5 March 2023).
- Davison, J. Genetic Exchange between Bacteria in the Environment. Plasmid 1999, 42, 73–91. [Google Scholar] [CrossRef]
- Coque, T.M.; Cajal, R.; Graham, D.W.; Pruden, A.; So, A.D.; Topp, E.; Grooters, S.V. Bracing for Superbugs: Strengthening Environmental Action in the One Health Response to Antimicrobial Resistance; UNEP: Geneva, Switzerland, 2023. [Google Scholar]
- Tóth, A.G.; Csabai, I.; Krikó, E.; Tőzsér, D.; Maróti, G.; Patai, V.; Makrai, L.; Szita, G.; Solymosi, N. Antimicrobial Resistance Genes in Raw Milk for Human Consumption. Sci. Rep. 2020, 10, 7464. [Google Scholar] [CrossRef]
- Li, W.; Bai, X.; Sheng, H.; Chen, J.; Wang, Z.; Wang, T.; Sun, R.; Feng, Z.; Wang, Y.; Peng, K.; et al. Conjugative Transfer of mcr-1-Bearing Plasmid from Salmonella to Escherichia Coli in vitro on Chicken Meat and in Mouse Gut. Food Res. Int. 2022, 157, 111263. [Google Scholar] [CrossRef] [PubMed]
- Low, W.W.; Wong, J.L.C.; Beltran, L.C.; Seddon, C.; David, S.; Kwong, H.-S.; Bizeau, T.; Wang, F.; Peña, A.; Costa, T.R.D.; et al. Mating Pair Stabilization Mediates Bacterial Conjugation Species Specificity. Nat. Microbiol. 2022, 7, 1016–1027. [Google Scholar] [CrossRef] [PubMed]
- Selover, B.; Waite-Cusic, J.G. Growth Potential and Biofilm Development of Nonstarter Bacteria on Surfaces Exposed to a Continuous Whey Stream. J. Dairy Sci. 2021, 104, 6508–6515. [Google Scholar] [CrossRef] [PubMed]
- Headd, B.; Bradford, S.A. Physicochemical Factors That Favor Conjugation of an Antibiotic Resistant Plasmid in Non-growing Bacterial Cultures in the Absence and Presence of Antibiotics. Front. Microbiol. 2018, 9, 2122. [Google Scholar] [CrossRef]
- Funnell, B.E.; Phillips, G.J. Plasmid Biology; American Society for Microbiology, Ed.; American Society for Microbiology: Washington, DC, USA, 2004; ISBN 9788527729833. [Google Scholar]
- De La Cruz, F.; Frost, L.S.; Meyer, R.J.; Zechner, E.L. Conjugative DNA Metabolism in Gram-Negative Bacteria. FEMS Microbiol. Rev. 2010, 34, 18–40. [Google Scholar] [CrossRef]
- Lopatkin, A.J.; Meredith, H.R.; Srimani, J.K.; Pfeiffer, C.; Durrett, R.; You, L. Persistence and Reversal of Plasmid-Mediated Antibiotic Resistance. Nat. Commun. 2017, 8, 1689. [Google Scholar] [CrossRef] [Green Version]
- Mishra, S.; Klümper, U.; Voolaid, V.; Berendonk, T.U.; Kneis, D. Simultaneous Estimation of Parameters Governing the Vertical and Horizontal Transfer of Antibiotic Resistance Genes. Sci. Total. Environ. 2021, 798, 149174. [Google Scholar] [CrossRef]
- Alderliesten, J.B.; Duxbury, S.J.N.; Zwart, M.P.; de Visser, J.A.G.M.; Stegeman, A.; Fischer, E.A.J. Effect of Donor-Recipient Relatedness on the Plasmid Conjugation Frequency: A Meta-Analysis. BMC Microbiol. 2020, 20, 135. [Google Scholar] [CrossRef]
- Shafieifini, M.; Sun, Y.; Staley, Z.R.; Riethoven, J.-J.; Li, X. Effects of Nutrient Level and Growth Rate on the Conjugation Process That Transfers Mobile Antibiotic Resistance Genes in Continuous Cultures. Appl. Environ. Microbiol. 2022, 88, 1–12. [Google Scholar] [CrossRef]
- Moralez, J.; Szenkiel, K.; Hamilton, K.; Pruden, A.; Lopatkin, A.J. Quantitative Analysis of Horizontal Gene Transfer in Complex Systems. Curr. Opin. Microbiol. 2021, 62, 103–109. [Google Scholar] [CrossRef]
- Reynolds, C.K.; Harmon, D.L.; Cecava, M.J. Absorption and Delivery of Nutrients for Milk Protein Synthesis by Portal-Drained Viscera. J. Dairy Sci. 1994, 77, 2787–2808. [Google Scholar] [CrossRef]
- de Divitiis, M.; Ami, D.; Pessina, A.; Palmioli, A.; Sciandrone, B.; Airoldi, C.; Regonesi, M.E.; Brambilla, L.; Lotti, M.; Natalello, A.; et al. Cheese-Whey Permeate Improves the Fitness of Escherichia Coli Cells During Recombinant Protein Production. Biotechnol. Biofuels Bioprod. 2023, 16, 30. [Google Scholar] [CrossRef]
- Ammar, E.M.; Wang, X.; Rao, C.V. Regulation of Metabolism in Escherichia Coli During Growth on Mixtures of the Non-Glucose Sugars: Arabinose, Lactose, and Xylose. Sci. Rep. 2018, 8, 609. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Candoğan, K.; Altuntas, E.G.; İğci, N. Authentication and Quality Assessment of Meat Products by Fourier-Transform Infrared (FTIR) Spectroscopy. Food Eng. Rev. 2021, 13, 66–91. [Google Scholar] [CrossRef]
- Van Heeswijk, W.C.; Westerhoff, H.V.; Boogerd, F.C. Nitrogen Assimilation in Escherichia coli: Putting Molecular Data into a Systems Perspective. Microbiol. Mol. Biol. Rev. 2013, 77, 628–695. [Google Scholar] [CrossRef] [Green Version]
- Huang, L.; Zhang, Y.; Du, X.; An, R.; Liang, X. Escherichia coli Can Eat DNA as an Excellent Nitrogen Source to Grow Quickly. Front. Microbiol. 2022, 13, 894849. [Google Scholar] [CrossRef] [PubMed]
- Ji, Y.; Yang, X.; Ji, Z.; Zhu, L.; Ma, N.; Chen, D.; Jia, X.; Tang, J.; Cao, Y. DFT-Calculated IR Spectrum Amide I, II, and III Band Contributions of N-Methylacetamide Fine Components. ACS Omega 2020, 5, 8572–8578. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Oniciuc, E.A.A.; Walsh, C.J.; Coughlan, L.M.; Awad, A.; Simon, C.A.; Ruiz, L.; Crispie, F.; Cotter, P.D.; Alvarez-Ordóñez, A. Dairy Products and Dairy-Processing Environments as a Reservoir of Antibiotic Resistance and Quorum-Quenching Determinants as Revealed through Functional Metagenomics. Msystems 2020, 5, e00723-19. [Google Scholar] [CrossRef] [Green Version]
- Monte, D.F.; Lincopan, N.; Fedorka-Cray, P.J.; Landgraf, M. Current Insights on High Priority Antibiotic-Resistant Salmonella Enterica in Food and Foodstuffs: A Review. Curr. Opin. Food Sci. 2019, 26, 35–46. [Google Scholar] [CrossRef]
- Liu, J.; Zhu, Y.; Jay-Russell, M.; Lemay, D.G.; Mills, D.A. Reservoirs of Antimicrobial RESISTANCE genes in Retail Raw Milk. Microbiome 2020, 8, 99. [Google Scholar] [CrossRef]
- Patkowski, J.B.; Dahlberg, T.; Amin, H.; Gahlot, D.K.; Vijayrajratnam, S.; Vogel, J.P.; Francis, M.S.; Baker, J.L.; Andersson, M.; Costa, T.R.D. The F-pilus Biomechanical Adaptability Accelerates Conjugative Dissemination of Antimicrobial Resistance and Biofilm Formation. Nat. Commun. 2023, 14, 1879. [Google Scholar] [CrossRef] [PubMed]
- Likotrafiti, E.; Oniciuc, E.; Prieto, M.; Santos, J.; López, S.; Alvarez-Ordóñez, A. Risk Assessment of Antimicrobial Resistance Along the Food Chain Through Culture-Independent Methodologies. EFSA J. 2018, 16, e160811. [Google Scholar] [CrossRef]
- Oniciuc, E.-A.; Likotrafiti, E.; Alvarez-Molina, A.; Prieto, M.; López, M.; Alvarez-Ordóñez, A. Food processing as a risk factor for antimicrobial resistance spread along the food chain. Curr. Opin. Food Sci. 2019, 30, 21–26. [Google Scholar] [CrossRef]
- Lambrecht, E.; Van Coillie, E.; Van Meervenne, E.; Boon, N.; Heyndrickx, M.; Van de Wiele, T. Commensal E. coli Rapidly Transfer Antibiotic Resistance Genes to Human Intestinal Microbiota in the Mucosal Simulator of the Human Intestinal Microbial Ecosystem (M-SHIME). Int. J. Food Microbiol. 2019, 311, 108357. [Google Scholar] [CrossRef]
- Christie, P.J. The Mosaic Type IV Secretion Systems. EcoSal Plus 2016, 7. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Darphorn, T.S.; Sintanneland, B.B.K.-V.; Grootemaat, A.E.; van der Wel, N.N.; Brul, S.; ter Kuile, B.H. Transfer Dynamics of Multi-Resistance Plasmids in Escherichia Coli Isolated From Meat. PLoS ONE 2022, 17, e0270205. [Google Scholar] [CrossRef] [PubMed]
- García-Cazorla, Y.; Getino, M.; Sanabria-Ríos, D.J.; Carballeira, N.M.; de la Cruz, F.; Arechaga, I.; Cabezón, E. Conjugation Inhibitors Compete with Palmitic Acid for Binding to the Conjugative Traffic ATPase TrwD, Providing a Mechanism to Inhibit Bacterial Conjugation. J. Biol. Chem. 2018, 293, 16923–16930. [Google Scholar] [CrossRef] [Green Version]
- Waksman, G. From Conjugation to T4S Systems in Gram-negative bacteria: A Mechanistic Biology Perspective. EMBO Rep. 2019, 20, e47012. [Google Scholar] [CrossRef] [PubMed]
- Bragagnolo, N.; Rodriguez, C.; Samari-Kermani, N.; Fours, A.; Korouzhdehi, M.; Lysenko, R.; Audette, G.F. Protein Dynamics in F-like Bacterial Conjugation. Biomedicines 2020, 8, 362. [Google Scholar] [CrossRef] [PubMed]
- Swain, S.S.; Paidesetty, S.K.; Padhy, R.N.; Hussain, T. Nano-Technology Platforms to Increase the Antibacterial Drug Suitability of Essential Oils: A Drug Prospective Assessment. Opennano 2023, 9, 100115. [Google Scholar] [CrossRef]
- Mot, M.-D.; Gavrilaș, S.; Lupitu, A.I.; Moisa, C.; Chambre, D.; Tit, D.M.; Bogdan, M.A.; Bodescu, A.-M.; Copolovici, L.; Copolovici, D.M.; et al. Salvia officinalis L. Essential Oil: Characterization, Antioxidant Properties, and the Effects of Aromatherapy in Adult Patients. Antioxidants 2022, 11, 808. [Google Scholar] [CrossRef]
- Bekhit, S.A. Evaluation of the Antibacterial Effect of Salvia Officinalis Essential Oil and its Synergistic Effect with Meropenem. Lett. Appl. NanoBioScience 2022, 12, 44. [Google Scholar] [CrossRef]
- Al-Dahmash, N.D.; Al-Ansari, M.M.; Al-Otibi, F.O.; Singh, A.R. Frankincense, an Aromatic Medicinal Exudate of Boswellia Carterii used to Mediate Silver Nanoparticle Synthesis: Evaluation of Bacterial Molecular Inhibition and its Pathway. J. Drug Deliv. Sci. Technol. 2021, 61, 102337. [Google Scholar] [CrossRef]
- Apiwatsiri, P.; Pupa, P.; Yindee, J.; Niyomtham, W.; Sirichokchatchawan, W.; Lugsomya, K.; Shah, A.A.; Prapasarakul, N. Anticonjugation and Antibiofilm Evaluation of Probiotic Strains Lactobacillus plantarum 22F, 25F, and Pediococcus acidilactici 72N Against Escherichia coli Harboring mcr-1 Gene. Front. Veter-Sci. 2021, 8, 614439. [Google Scholar] [CrossRef]
- Oyedemi, B.O.; Shinde, V.; Shinde, K.; Kakalou, D.; Stapleton, P.D.; Gibbons, S. Novel R-plasmid Conjugal Transfer Inhibitory and Antibacterial Activities of Phenolic Compounds from Mallotus Philippensis (Lam.) Mull. Arg. J. Glob. Antimicrob. Resist. 2016, 5, 15–21. [Google Scholar] [CrossRef]
- Cabezón, E.; de la Cruz, F.; Arechaga, I. Conjugation Inhibitors and Their Potential Use to Prevent Dissemination of Antibiotic Resistance Genes in Bacteria. Front. Microbiol. 2017, 8, 2329. [Google Scholar] [CrossRef] [Green Version]
- Tang, H.; Liu, Z.; Hu, B.; Zhu, L. Effects of Iron Mineral Adhesion on Bacterial Conjugation: Interfering the Transmission of Antibiotic Resistance Genes Through an Interfacial process. J. Hazard. Mater. 2022, 435, 128889. [Google Scholar] [CrossRef] [PubMed]
- Linklater, D.P.; Baulin, V.A.; Le Guével, X.; Fleury, J.; Hanssen, E.; Nguyen, T.H.P.; Juodkazis, S.; Bryant, G.; Crawford, R.J.; Stoodley, P.; et al. Antibacterial Action of Nanoparticles by Lethal Stretching of Bacterial Cell Membranes. Adv. Mater. 2020, 32, e2005679. [Google Scholar] [CrossRef]
- Bahari, L.A.S.; Hamishehkar, H. The Impact of Variables on Particle Size of Solid Lipid Nanoparticles and Nanostructured Lipid Carriers; A Comparative Literature Review. Adv. Pharm. Bull. 2016, 6, 143–151. [Google Scholar] [CrossRef] [PubMed]
- Atmakuri, K.; Cascales, E.; Christie, P.J. Energetic Components VirD4, VirB11 and VirB4 Mediate Early DNA Transfer Reactions Required for Bacterial Type IV Secretion. Mol. Microbiol. 2004, 54, 1199–1211. [Google Scholar] [CrossRef] [PubMed]
- Getino, M.; Fernandez-Lopez, R.; Palencia-Gándara, C.; Campos-Gomez, J.; Sánchez-López, J.M.; Martínez, M.; Fernández, A.; de la Cruz, F. Tanzawaic Acids, a Chemically Novel Set of Bacterial Conjugation Inhibitors. PLoS ONE 2016, 11, e0148098. [Google Scholar] [CrossRef] [PubMed]
- Brown, H.L.; Reuter, M.; Salt, L.J.; Cross, K.L.; Betts, R.P.; van Vliet, A.H.M. Chicken Juice Enhances Surface Attachment and Biofilm Formation of Campylobacter jejuni. Appl. Environ. Microbiol. 2014, 80, 7053–7060. [Google Scholar] [CrossRef] [Green Version]
- Melo, R.T.; Mendonça, E.P.; Monteiro, G.P.; Siqueira, M.C.; Pereira, C.B.; Peres, P.A.B.M.; Fernandez, H.; Rossi, D.A. Intrinsic and Extrinsic Aspects on Campylobacter jejuni Biofilms. Front. Microbiol. 2017, 8, 1332. [Google Scholar] [CrossRef] [Green Version]
- Bashiri, S.; Ghanbarzadeh, B.; Ayaseh, A.; Dehghannya, J.; Ehsani, A.; Ozyurt, H. Essential Oil-Loaded Nanostructured Lipid Carriers: The effects of Liquid Lipid Type on the Physicochemical Properties in Beverage Models. Food Biosci. 2020, 35, 100526. [Google Scholar] [CrossRef]
- Sharma, S.; Mulrey, L.; Byrne, M.; Jaiswal, A.K.; Jaiswal, S. Encapsulation of Essential Oils in Nanocarriers for Active Food Packaging. Foods 2022, 11, 2337. [Google Scholar] [CrossRef]
- Huh, A.J.; Kwon, Y.J. “Nanoantibiotics”: A New Paradigm for Treating Infectious Diseases Using Nanomaterials in the Antibiotics Resistant Era. J. Control. Release 2011, 156, 128–145. [Google Scholar] [CrossRef]
- Fernandez-Lopez, R.; Machón, C.; Longshaw, C.M.; Martin, S.; Molin, S.; Zechner, E.L.; Espinosa, M.; Lanka, E.; de la Cruz, F. Unsaturated Fatty Acids are Inhibitors of Bacterial Conjugation. Microbiology 2005, 151, 3517–3526. [Google Scholar] [CrossRef] [Green Version]
- Gussoni, M.; Greco, F.; Pegna, M.; Bianchi, G.; Zetta, L. Solid State and Microscopy NMR Study of the Chemical Constituents of Afzelia Cuanzensis Seeds. Magn. Reson. Imaging 1994, 12, 477–486. [Google Scholar] [CrossRef]
- Van Vuuren, S.; Kamatou, G.; Viljoen, A. Volatile Composition and Antimicrobial Activity of Twenty Commercial Frankincense Essential Oil Samples. S. Afr. J. Bot. 2010, 76, 686–691. [Google Scholar] [CrossRef]
- Gerbeth, K.; Meins, J.; Kirste, S.; Momm, F.; Schubert-Zsilavecz, M.; Abdel-Tawab, M. Determination of Major Boswellic Acids in Plasma by High-Pressure Liquid Chromatography/Mass Spectrometry. J. Pharm. Biomed. Anal. 2011, 56, 998–1005. [Google Scholar] [CrossRef]
- Afonso, A.F.; Pereira, O.R.; Fernandes, Â.; Calhelha, R.C.; Silva, A.M.S.; Ferreira, I.C.F.R.; Cardoso, S.M. Phytochemical Composition and Bioactive Effects of Salvia africana, Salvia officinalis ‘Icterina’ and Salvia mexicana Aqueous Extracts. Molecules 2019, 24, 4327. [Google Scholar] [CrossRef] [Green Version]
- Lekbach, Y.; Li, Z.; Xu, D.; El Abed, S.; Dong, Y.; Liu, D.; Gu, T.; Koraichi, S.I.; Yang, K.; Wang, F. Salvia Officinalis Extract Mitigates the Microbiologically Influenced Corrosion of 304L Stainless Steel by Pseudomonas Aeruginosa Biofilm. Bioelectrochemistry 2019, 128, 193–203. [Google Scholar] [CrossRef]
- Křížkovská, B.; Hoang, L.; Brdová, D.; Klementová, K.; Szemerédi, N.; Loučková, A.; Kronusová, O.; Spengler, G.; Kaštánek, P.; Hajšlová, J.; et al. Modulation of the Bacterial Virulence and Resistance by Well-Known European Medicinal Herbs. J. Ethnopharmacol. 2023, 312, 116484. [Google Scholar] [CrossRef] [PubMed]
- Barbosa, R.D.M.; Ribeiro, L.N.M.; Casadei, B.R.; Da Silva, C.M.G.; Queiróz, V.A.; Duran, N.; De Araújo, D.R.; Severino, P.; De Paula, E. Solid Lipid Nanoparticles for Dibucaine Sustained Release. Pharmaceutics 2018, 10, 231. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Melo, R.T.; Galvão, N.N.; Guidotti-Takeuchi, M.; Peres, P.A.B.M.; Fonseca, B.B.; Profeta, R.; Azevedo, V.A.C.; Monteiro, G.P.; Brenig, B.; Rossi, D.A. Molecular Characterization and Survive Abilities of Salmonella Heidelberg Strains of Poultry Origin in Brazil. Front. Microbiol. 2021, 12, 1461. [Google Scholar] [CrossRef] [PubMed]
- Matsumura, Y.; Peirano, G.; Pitout, J.D.D. Complete Genome Sequence of Escherichia coli J53, an Azide-Resistant Laboratory Strain Used for Conjugation Experiments. Genome Announc. 2018, 6, e00433-18. [Google Scholar] [CrossRef] [Green Version]
- Rodriguez-Grande, J.; Fernandez-Lopez, R. Measuring Plasmid Conjugation Using Antibiotic Selection. Methods Mol. Biol. 2020, 2075, 93–98. [Google Scholar] [CrossRef]
- Ahmed, A.M.; Motoi, Y.; Sato, M.; Maruyama, A.; Watanabe, H.; Fukumoto, Y.; Shimamoto, T. Zoo Animals as Reservoirs of Gram-Negative Bacteria Harboring Integrons and Antimicrobial Resistance Genes. Appl. Environ. Microbiol. 2007, 73, 6686–6690. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Suhartono, S.; Savin, M. Conjugative Transmission of Antibiotic-Resistance from Stream Water Escherichia coli as Related to Number of Sulfamethoxazole but Not Class 1 and 2 Integrase Genes. Mob. Genet. Elem. 2016, 6, e1256851. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Silva, N. Manual de Métodos de Análise Microbiológica de Alimentos e Água, 5th ed.; Blucher: São Paulo, Brazil, 2017; ISBN 978-85-212-1225-6. [Google Scholar]
Solid/Liquid Lipid | Size (nm) | PDI | Zeta Potential (mV) |
---|---|---|---|
Shea butter/sage EO | 257.6 ± 3.00 | 0.147 ± 0.01 | −31.0 ± 0.1 |
Ucuuba butter/olibanum EO | 228.3 ± 1.91 | 0.137 ± 0.05 | −36.6 ± 0.9 |
Control | NpS | * p | NpO | * p | |
---|---|---|---|---|---|
Escherichia coli (log UFC) | 6.88 ± 0.09 | 6.87 ± 0.17 | >0.99 | 6.71 ± 0.25 | 0.95 |
Salmonella Heidelberg (log UFC) | 7.17 ± 0.20 | 6.68 ± 0.42 | 0.13 | 6.72 ± 0.25 | 0.23 |
Gene | Sequence 5′→3′ | PCR Conditions (°C) | ADN (ng) | Reference |
---|---|---|---|---|
blaTEM | CAGCGGTAAGATCCTTGAGA ACTCCCCGTCGTGTAGATAA | 95 °C—5 min; 50 °C—45 s; 72 °C 90 s; 72 °C 10 min | 10 | [105] |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Guidotti-Takeuchi, M.; Melo, R.T.d.; Ribeiro, L.N.d.M.; Dumont, C.F.; Ribeiro, R.A.C.; Brum, B.d.A.; de Amorim Junior, T.L.I.F.; Rossi, D.A. Interference with Bacterial Conjugation and Natural Alternatives to Antibiotics: Bridging a Gap. Antibiotics 2023, 12, 1127. https://doi.org/10.3390/antibiotics12071127
Guidotti-Takeuchi M, Melo RTd, Ribeiro LNdM, Dumont CF, Ribeiro RAC, Brum BdA, de Amorim Junior TLIF, Rossi DA. Interference with Bacterial Conjugation and Natural Alternatives to Antibiotics: Bridging a Gap. Antibiotics. 2023; 12(7):1127. https://doi.org/10.3390/antibiotics12071127
Chicago/Turabian StyleGuidotti-Takeuchi, Micaela, Roberta Torres de Melo, Lígia Nunes de Morais Ribeiro, Carolyne Ferreira Dumont, Rosanne Aparecida Capanema Ribeiro, Bárbara de Araújo Brum, Tanaje Luiz Izidio Ferreira de Amorim Junior, and Daise Aparecida Rossi. 2023. "Interference with Bacterial Conjugation and Natural Alternatives to Antibiotics: Bridging a Gap" Antibiotics 12, no. 7: 1127. https://doi.org/10.3390/antibiotics12071127