A Novel Single-Tube Eicosaplex/Octaplex PCR System for the Detection of Extended-Spectrum β-Lactamases, Plasmid-Mediated AmpC β-Lactamases, and Integrons in Gram-Negative Bacteria
by
,
Ahmed M. Soliman
1,*,†,
Hirofumi Nariya
2,†,
Daiki Tanaka
3,‡,
Toshi Shimamoto
4 and
Tadashi Shimamoto
4,* 1
Department of Microbiology and Immunology, Faculty of Pharmacy, Kafrelsheikh University, Kafr El-Sheikh 33516, Egypt
2
Laboratory of Food Microbiology, Graduate School of Human Life Sciences, Jumonji University, Niiza 352-8510, Japan
3
Laboratory of Food Microbiology and Hygiene, Graduate School of Biosphere Science, Hiroshima University, 1-4-4 Kagamiyama, Higashihiroshima 739-8528, Japan
4
Laboratory of Food Microbiology and Hygiene, Graduate School of Integrated Sciences for Life, Hiroshima University, 1-4-4 Kagamiyama, Higashihiroshima 739-8528, Japan
*
Authors to whom correspondence should be addressed.
†
These authors contributed equally to this work.
‡
Present address: Ikeda Tohka Industries Co., Ltd., 95-7 Minooki-cho, Fukuyama, Hiroshima 721-0956, Japan.
Antibiotics 2023, 12(1), 90; https://doi.org/10.3390/antibiotics12010090
Submission received: 27 November 2022
/
Revised: 26 December 2022
/
Accepted: 28 December 2022
/
Published: 4 January 2023
(This article belongs to the Special Issue Research on Beta-Lactamases and Resistance Genes of Gram-Negative Bacteria)
Abstract
:We developed two multiplex polymerase chain reactions (PCRs) for the detection of extended-spectrum β-lactamases (ESBLs), plasmid-mediated AmpC β-lactamases, aac(6′)-Ib gene, and integrase genes (intI1, intI2, and intI3) in class 1, 2, and 3 integrons in Gram-negative bacteria. We evaluated the PCRs using 109 Gram-negative isolates from non-organic (ANO) and organic (AO) vegetables and fruits. Screening of ANO substances identified five SHV, one TEM-1, one CTX-M, 20 AmpC-CS, and two intI1 positives. DNA sequencing revealed CTX-M in Pantoea spp. was blaRANH-2, a plasmid-mediated CTX-M related ESBL gene only found in Rahnella spp. Of the 20 AmpC-CS positives, 10 were CMY/MIR/ACT/EC (3 new variants), eight were ACT, one was AZECL, and one was new Pseudomonas-related AmpC family. Screening of AO substances identified 11 SHV, two TEM-1, three CTX-M (one OXY-2, two CTX-M-14/-15), two OXA-9, 13 AmpC-CS and one intI1 positives. The 13 AmpC-CS positives were five CMY/MIR/ACT/EC, three ACT, one MOX-12 variant, and four ADC (one ADC-25 and three new variants). We developed a rapid, easy-to-perform, low-cost, and reliable multiplex PCR system for screening clinically relevant β-lactamases and integrons in Gram-negative bacteria. We showed the prevalence of ESBLs and AmpC β-lactamases among our panel of ampicillin-resistant Gram-negative strains and detection of NDM and OXA carbapenemases.
1. Introduction
Antimicrobial resistance (AMR) is defined as the ability of microorganisms (bacteria or fungi) to overcome the action of the antibiotics that intend to kill them (i.e., bactericidal), or inhibit their growth (i.e., bacteriostatic) [1]. AMR is considered one of the greatest threats to global public health [1]. In the USA, annual data estimate more than 2.8 million infections with antibiotic-resistant bacteria, causing more than 35,000 deaths [1]. Because of antimicrobial-resistant infections, it is estimated that approximately 10 million global deaths, with fiscal losses of > USD 100 trillion, will occur by 2050 [2].
β-lactams are one of the most clinically important and widely prescribed classes of antibiotics used for the treatment of Gram-negative or Gram-positive bacteria [3]. The major mechanism of β-lactam resistance is the production of β-lactamases [4]. Extended-spectrum β-lactamases (ESBLs) and plasmid-mediated AmpC β-lactamases are groups of these enzymes that should be considered by clinical microbiologists [5,6]. AmpC β-lactamases have been identified globally in nosocomial and non-nosocomial bacterial strains with activity against penicillin, cephalosporin, cephamycins (e.g., cefoxitin and cefotetan), oxyiminocephalosporins (e.g., ceftriaxone, cefotaxime, and ceftazidime), and monobactam (e.g., aztreonam) [5]. ESBLs have been associated with outbreaks and have become a key cause of hospital-acquired infections, especially in intensive care units [6,7]. Recently, the most frequently encountered ESBLs in clinical, environmental, and animal sources are TEM, SHV, and CTX-M [6,7].
Integrons are DNA elements found in many bacterial species and are characterized by their ability to capture, exchange, and express small mobile elements called gene cassettes [8]. Cassettes usually contain only one open reading frame, possibly any gene, and an attC recombination site [8]. A specialized IntI site-specific recombinase encoded by the integron recognizes attC and incorporates cassettes into an attI site located adjacent to the intI gene [8]. An integron can comprise zero to hundreds of cassettes due to repeated attC-attI recombination [8]. Therefore, integrons participate in increasing the plasticity of bacterial, plasmid, and genomes and facilitating the widespread distribution of genetic materials among bacteria [8]. Three integron types are classified according to the encoded integrase enzyme into class 1, class 2, and class 3 integrons and are usually associated with AMR genes [8,9].
Whole-genome sequencing (WGS) is the best way to identify all known AMR genes in bacteria; however, it is expensive for epidemiological surveys [10]. For example, ResFinder, a web-based tool available at the Center for Genomic Epidemiology (https://cge.cbs.dtu.dk/services/ResFinder/) (accessed on 26 November 2022), is widely used to identify AMR genes in WGS data [10]. Several interesting multiplex PCR systems using specific primer sets have been published and used for screening ESBLs or plasmid-mediated AmpC β-lactamases among Enterobacteriaceae and other Gram-negative bacteria [11,12,13,14]. Unfortunately, these primers could not fully cover the increasing number of alleles deposited in the GenBank database. In this study, we aimed to develop a multiplex PCR assay for the detection of all variants of i) ESBLs (CTX-M, TEM, SHV, OXA-1-like, OXA-2-like, OXA-5-like, OXA-9-like) and ii) AmpC β-lactamases (ACC, ACT/MIR, DHA, CMY/LAT, FOX, MOX, ADC, PDC) submitted to GenBank as of May 2018 in combination with class 1, 2, and 3 integrons.
2. Materials and Methods
2.1. Bacterial Isolates
For optimization of the two multiplex PCRs, previously well-characterized strains that had been recovered from different parts of the world were used as positive controls (Table 1) [15,16,17,18,19,20]. Owing to the lack of positive control strains for blaOXA-2, blaFOX, blaACC, and integrase genes of class 3 integrons (intI3), the corresponding gene was synthesized by Eurofins Genomics KK (Tokyo, Japan) and incorporated into the kanamycin resistant (KmR) plasmid pEX-K4J2 (https://eurofinsgenomics.jp/media/29197/pex-k4j2vector-mapseq.pdf) (accessed on 10 November 2022), which was further electroporated into E. coli DH10B (Table 2).
For evaluation, 109 Gram-negative strains were grown on MacConkey agar plates containing 100 μg/mL ampicillin (AMP) from October 2014 to August 2015 from 27 non-organic (ANO) (n = 54 isolates) and 21 organic (AO) (n = 55 isolates) vegetables and fruits (including imported ones) retailed in Hiroshima Prefecture, Japan. The 16S rRNA gene was amplified and sequenced using 27F primer (5′-AGAGTTTGATCMTGGCTCAG-3′) [21] and 1492R (5′-CGGYTACCTTGTTACGACTT-3′). The strains were further screened on Luria-Bertani (LB) (Lennox) agar medium supplemented with 1 and 4 μg/mL meropenem (MEM), 4 μg/mL cefotaxime (CTX), and 16 μg/mL ceftazidime (CAZ).
2.2. Design of Specific Primers for Eicosaplex and Octaplex PCRs
Two multiplex PCRs were developed in this study: (1) eicosaplex PCR for the detection of ESBLs (blaCTX-M, blaOXA-1, blaOXA-2, blaOXA-5, blaOXA-9, blaSHV, blaTEM), plasmid-mediated AmpC β-lactamases (blaACC, blaACT/MIR, blaCMY/LAT, blaDHA, blaFOX, and blaMOX family plus intrinsic blaADC and blaPDC family in Acinetobacter and Pseudomonas, respectively) families, in combination with integrase genes (intI1, intI2, and intI3) in class 1, 2, and 3 integrons and aac(6’)-Ib gene in Gram-negative bacteria and (2) octaplex PCR for differentiation of plasmid-mediated AmpC β-lactamases (blaACC, blaACT/MIR, blaCMY/LAT, blaDHA, blaFOX, blaMOX, blaADC and blaPDC). The blaAmpC in the eicosaplex PCR assay targets the AmpC conserved (CS) region (amplicon size, approximately 374 bp) using each family-specific AmpC-CS primer set. AmpC-CS positives were then distinguished by octaplex PCR using a family-specific (SP) primer set, AmpC-SP. In the eicosaplex PCR, amplification of blaADC and blaACC resulted in a 388 bp product, while amplification of blaMOX and blaFOX resulted in a 371-bp product.
DNA sequences of the different genes and their variants were obtained from the GenBank database and aligned using Clustal Omega software (Clustal W) (https://www.ebi.ac.uk/Tools/msa/clustalo/) (accessed on 10 November 2022). Specific primers were manually designed for each family to cover all alleles deposited in the GenBank database as of May 2018 and amplify internal fragments of different sizes (Table 3 and Table 4, Figure 1 and Figure 2). For example, CTX-M primers were designed to cover all 214 publicly available CTX-M variants (including those belonging to phylogenetic group 1, 2, 8, and 9), KLUA, KLUC, KLUG, and TOHO-1 to TOHO-3.
2.3. Eicosaplex and Octaplex PCR Technique
DNA was prepared using the boiling lysate method, as previously reported [15]. Total DNA (0.2 μL) was subjected to eicosaplex or octaplex PCR in a 10 μL reaction mixture containing 5 μL of 2 X Gflex PCR Buffer (TaKaRa Bio, Shiga, Japan, Cat. #R060A/B) (2 mM Mg2+, ~400 μM dNTP plus), varying concentrations of the specific primers (Table 3 and Table 4), 4.2 μL Milli-Q water (4.6 μL in case of octaplex PCR) and 0.1 μL Tks Gflex™ DNA Polymerase (1.25 units/μL) (TaKaRa Bio, Shiga, Japan, Cat. #R060A/B). Thermal cycling was performed as follows: initial denaturation at 98 °C for 1 min; 35 cycles of 98 °C for 10 s, 50 °C for 15 s, and 68 °C for 30 s; and a final elongation at 68 °C for 15 s. For octaplex PCR, primer annealing was optimized at 57.5 °C. The PCR products were imaged after running at 100 V for 60 min on a 3% agarose gel and stained with a solution containing ethidium bromide.
2.4. DNA Sequencing and Analysis
Amplified genes were purified using the ExoSAP-IT™ PCR product cleanup kit (https://assets.fishersci.com/TFS-Assets/LSG/manuals/78200b.pdf) (accessed on 10 November 2022) (Applied Biosystems, Foster City, CA, USA) and sequenced in both directions using a 3730xl DNA Analyzer (Applied Biosystems). To identify genes or their variants, a search was performed using the BLAST program accessible on the NCBI BLAST homepage (https://blast.ncbi.nlm.nih.gov/Blast.cgi) (accessed on 10 November 2022).
2.5. Whole Genome Sequencing and Analysis
Some interesting carbapenem-resistant Gram-negative bacteria detected in this study were subjected to WGS using Illumina MiniSeq (Illumina, San Diego, CA, USA) and Oxford MinION Nanopore (Oxford Nanopore Technologies, Oxford, UK). Hybrid assembly was performed as previously reported to produce high-quality sequences [22]. The complete genome sequences of the three isolates and their analyses have been previously published [20].
3. Results and Discussion
3.1. MER, CTX, CAZ-Resistant Strains from the ANO and AO Substances
We screened 109 strains isolated in this study on LB agar medium supplemented with 4 μg/mL MEM, 4 μg/mL CTX, and 16 μg/mL CAZ. A total of 8, 33, and 15 different Gram-negative strains were resistant to MEM 4, CTX 4, and CAZ 16, respectively, indicating the potential for spreading and infecting human beings. Fresh produce is commonly consumed raw or is under cooked [23]. Subsequently, a significant portion of the latest foodborne outbreaks have been associated with fresh produce polluted by bacteria [24]. Similarly, the spread of antimicrobial resistance in humans can occur through the consumption of vegetables contaminated with multidrug-resistant bacteria [24].
3.2. Design of Specific Primers for Eicosaplex and Octaplex PCRs
In this study, we developed two multiplex PCRs, namely eicosaplex and octaplex, for the detection of ESBLs and AmpC β-lactamases in combination with integrase genes (intI1, intI2, and intI3) in class 1, 2, and 3 integrons and aac(6’)-Ib gene in Gram-negative bacteria. After the optimization of the PCR reaction conditions, the expected target size of each amplicon was obtained using either the primer pairs in a simplex (Figure 3C,D) or multiplex (Figure 3A,B) approach. The specificity was good, with amplification of all the expected fragments (Figure 3). For example, every DNA template of blaTEM and blaCTX-M resulted in 602 bp and 509 bp, respectively.
3.3. Evaluation of the Eicosaplex and Octaplex PCRs with Gram-Negative Strains Isolated from Vegetables and Fruits in Japan
To verify the specificity of the system, simplex and multiplex PCRs were performed on 109 Gram-negative strains isolated in this study. All the PCR products were bidirectionally sequenced.
ESBLs were identified in 25 isolates (23%), plasmid-mediated AmpC β-lactamases were detected in 33 isolates (30%), and 3 isolates (2.75%) carried both a plasmid-mediated AmpC β-lactamase and a class 1 integron, from which another isolate additionally carried the broad-spectrum β-lactamase TEM-1.
Screening of ANO substances identified five SHV (one SHV-1, three SHV-1 variants, and one SHV-41 variant), one TEM-1, one CTX-M, 20 AmpC-CS, and two intI1 positives (Table 5 and Table 6). Furthermore, DNA sequence analysis revealed that CTX-M in Pantoea spp. was blaRANH-2, a plasmid-mediated CTX-M-related ESBL gene found only in Rahnella spp. The 20 AmpC-CS positives were 10 CMY2/MIR/ACT/EC (three new variants), eight ACT (two ACT-16, two ACT-61, one ACT-64, two ACT-32, and one ACT-51 variants), one AZECL, and one new Pseudomonas-related AmpC family. Screening of the AO identified 11 SHV (two SHV-1, one SHV-27, one SHV-11, one SHV-11 variant, one LEN-13, two LEN-19 variants, one LEN-27 variant, one LEN-25, and one LEN-16), two TEM-1, three CTX-M (one OXY-2, two CTX-M-14/-15), two OXA-9, two aac(6′)-Ib, 13 AmpC-CS, and one intI1 positive. The 13 AmpC-CS positives were five CMY2/MIR/ACT/EC (one new variant), three ACT (one ACT-51 variant, one ACT-2 variant, and one ACT-9), one MOX-12 variant, and four ADC (one ADC-25 and three new variants).
CMY2/MIR/ACT/EC and ACT enzymes were the most frequently detected plasmid-mediated AmpC β-lactamases (found in 15 and 11 isolates, respectively); only one variant of MOX-12 AmpC β-lactamase was reported. Carbapenemase-encoding genes were detected using previously published primers and conditions [25]. New Delhi metallo-β-lactamase 1 (NDM-1) was detected in two K. pneumoniae (AO15 and AO22) isolates in this study [20]. The two isolates belonged to the same clone and sequence type 15 (ST15) [20]. Complete genome sequencing and ResFinder (https://cge.food.dtu.dk/services/ResFinder/) (accessed on 10 November 2022) analysis identified that both the isolates carried 19 different antimicrobial resistance genes. blaNDM-1 was carried by a self-conjugable IncFII(K):IncR plasmid of 122,804 bp with other genes conferring resistance to β-lactams (blaCTX-M-15, blaOXA-9, and blaTEM-1A), fluoroquinolones [aac(6′)-Ib-cr], aminoglycosides [aac(6′)-Ib, aadA1, aph(3′)-VI], and quinolones (qnrS1) [20]. In addition, another A. baumannii AO22 isolate identified in our study carried a chromosomal blaOXA-66 and two copies of blaOXA-72 on a 10,880 bp GR2-type plasmid [20]. None of the carbapenemase genes targeted were found in this study in the other five isolates showing decreased susceptibility to meropenem. A complete description of the characteristics of the 109 Gram-negative isolates in this study are presented in Table 7 and Table 8.
A recent study from Nepal reported E. coli and Salmonella producing multidrug-resistant ESBL in vegetable salads served at restaurants and hotels. Alarmingly, three samples harbored E. coli O157: H7 [26]. Colosi et al. (2020) reported β-lactamase-producing Enterobacterales in 7.9% of raw vegetables retailed in Romania, with 5.5% showing the ESBL or AmpC phenotype and 2.4% associated with carbapenemase producers [27]. Therefore, retail vegetables and fruits might be important reservoirs of multidrug-resistant bacteria that produce ESBLs, AmpC, or carbapenemases. Furthermore, the detection of these organisms in fresh vegetables in Japan, a country with quite low levels of antimicrobial resistance and high-level sanitary standards, is disturbing and poses food safety and public health concerns, as resistant organisms might be transmitted to humans. From a global health perspective, surveillance plans using a fast, low-cost, and effective method (i.e., eicosaplex/octaplex system) are essential at both the international and local levels to offer evidence for risk improvement strategies to reduce the spread of resistance.
The PCR products can be sequenced directly and efficiently, permitting the detection of a large number of β-lactamases. Even if the strain carried two different variants of the same β-lactamase, it could be detected by sequence analysis of the resulting amplicon (for example, the positive control strains LM22-1 carrying blaCTX-M-9 and blaCTX-M-15, and AO15/22 carrying blaCTX-M-14b and blaCTX-M-15). Here, we developed two rapid, easy-to-perform, cost-effective, and reliable multiplex PCRs for the efficient screening of ESBLs, AmpC β-lactamases, and integrons in Gram-negative bacteria. This method allows for the detection of new variants of ESBLs and AmpC β-lactamases. Interestingly, in eicosaplex PCR, we were able to amplify 20 targets in a single tube using Tks Gflex DNA Polymerase (TaKaRa Bio, Shiga, Japan, Cat. #R060A/B).
4. Conclusions
In this study, we developed two multiplex PCRs, eicosaplex and octaplex, in a single tube (using Tks Gflex™ DNA Polymerase), for the detection of ESBLs, plasmid-mediated AmpC β-lactamases, and class 1, 2, and 3 integrons in Gram-negative bacteria. This PCR assay is a rapid, low-cost, easy-to-perform, and reliable method for screening clinically relevant mobile and disseminated β-lactamases and integrons. This method allows for the detection of new variants of ESBLs and AmpC β-lactamases. For epidemiological surveys in low- and middle-income countries, and for reference laboratories, our technique may be extremely helpful in reducing the time and cost of multiplex PCRs. This PCR system will assist in controlling the emergence and spread of frequently encountered β-lactamases. In conclusion, our study showed the prevalence of ESBLs and AmpC among our panel of ampicillin-resistant Gram-negative strains isolated from vegetables and fruits in Japan, and the detection of NDM and OXA carbapenemases. This situation is disturbing and poses food safety and public health concerns, as resistant organisms can be transmitted to humans. This multiplex PCR assay is a promising workflow in bacterial diagnosis in high-risk patients providing a great assistance in optimizing and fast choice of antibiotics for treating infections due to ESBLs- and AmpC β-lactamases-producing Gram-negative pathogens.
Author Contributions
Conceptualization, A.M.S., H.N. and T.S. (Tadashi Shimamoto); Data curation, A.M.S., H.N., D.T. and T.S. (Toshi Shimamoto); Formal analysis, A.M.S. and H.N.; Funding acquisition, T.S. (Tadashi Shimamoto); Investigation, A.M.S. and H.N.; Methodology, A.M.S., D.T. and H.N.; Project administration, T.S. (Tadashi Shimamoto); Software, A.M.S. and H.N.; Validation, A.M.S. and H.N.; Writing–original draft, A.M.S.; Writing–review & editing, A.M.S. and T.S. (Tadashi Shimamoto). All authors have read and agreed to the published version of the manuscript.
Funding
This research received no external funding.
Institutional Review Board Statement
Not applicable.
Informed Consent Statement
Not applicable.
Data Availability Statement
Data is contained within the article.
Acknowledgments
A.M.S. was supported by a fellowship from the Ministry of Education, Culture, Sports, Science, and Technology of Japan (Fellowship no. 153532).
Conflicts of Interest
The authors declare no conflict of interest.
References
- Centres for Disease Control and Prevention (US). Antibiotic Resistance Threats in the United States; Centres for Disease Control and Prevention, US Department of Health and Human Services: Atlanta, GA, USA, 2019. Available online: https://www.cdc.gov/drugresistance/pdf/threats-report/2019-ar-threats-report-508.pdf (accessed on 5 November 2022).
- O’Neill, J. (Chairman) the review on antimicrobial resistance. Tackling a globalhealth crisis: Initial steps. AMR Rev. Lond. 1–20. Available online: https://amr-review.org/sites/default/files/Report-52.15.pdf (accessed on 5 November 2022).
- Bush, K.; Bradford, P.A. β-Lactams and β-lactamase inhibitors: An overview. In Antibiotics and Antibiotic Resistance; Silver, L.L., Bush, K., Eds.; Cold Spring Harbor Laboratory Press: Cold Spring Harbor, NY, USA, 2016; pp. 23–44. [Google Scholar]
- Bush, K. Past and present perspectives on β-lactamases. Antimicrob. Agents Chemother. 2018, 62, e01076-18. [Google Scholar] [CrossRef] [Green Version]
- Jacoby, G.A. AmpC β-lactamases. Clin. Microbiol. Rev. 2009, 22, 161–182. [Google Scholar] [CrossRef] [Green Version]
- Brolund, A.; Sandegren, L. Characterization of ESBL disseminating plasmids. J. Infect. Dis. 2016, 48, 18–25. [Google Scholar] [CrossRef] [PubMed]
- Dhillon, R.H.; Clark, J. ESBLs: A clear and present danger? Crit. Care Res. Pract. 2012, 2012, 625170. [Google Scholar] [CrossRef] [PubMed]
- Hall, R.M. Integrons and gene cassettes: Hotspots of diversity in bacterial genomes. Ann. N. Y. Acad. Sci. 2012, 1267, 71–78. [Google Scholar] [CrossRef]
- Hall, R.M.; Collis, C.M. Antibiotic resistance in gram-negative bacteria: The role of gene cassettes and integrons. Drug Resist. Updates 1998, 1, 109–119. [Google Scholar] [CrossRef] [PubMed]
- Zankari, E.; Hasman, H.; Cosentino, S.; Vestergaard, M.; Rasmussen, S.; Lund, O.; Aarestrup, F.M.; Larsen, M.V. Identification of acquired antimicrobial resistance genes. J. Antimicrob. Chemother. 2012, 67, 2640–2644. [Google Scholar] [CrossRef]
- Dallenne, C.; Da Costa, A.; Decré, D.; Favier, C.; Arlet, G. Development of a set of multiplex PCR assays for the detection of genes encoding important β-lactamases in Enterobacteriaceae. J. Antimicrob. Chemother. 2010, 65, 490–495. [Google Scholar] [CrossRef] [Green Version]
- Trung, N.T.; Hien, T.T.T.; Huyen, T.T.T.; Quyen, D.T.; Binh, M.T.; Hoan, P.Q.; Meyer, C.G.; Velavan, T.P. Simple multiplex PCR assays to detect common pathogens and associated genes encoding for acquired extended spectrum betalactamases (ESBL) or carbapenemases from surgical site specimens in Vietnam. Ann. Clin. Microbiol. Antimicrob. 2015, 14, 23. [Google Scholar] [CrossRef] [Green Version]
- Kazi, M.; Ajbani, K.; Tornheim, J.A.; Shetty, A.; Rodrigues, C. Multiplex PCR to detect pAmpC β-lactamases among enterobacteriaceae at a tertiary care laboratory in Mumbai, India. Microbiology (Read. Engl.) 2019, 165, 246–250. [Google Scholar] [CrossRef]
- Kao, C.C.; Liu, M.F.; Lin, C.F.; Huang, Y.C.; Liu, P.Y.; Chang, C.W.; Shi, Z.Y. Antimicrobial susceptibility and multiplex PCR screening of AmpC genes from isolates of Enterobacter cloacae, Citrobacter freundii, and Serratia marcescens. J. Microbiol. Immunol. Infect. 2010, 43, 180–187. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Soliman, A.M.; Ahmed, A.M.; Shimamoto, T.; El-Domany, R.A.; Nariya, H.; Shimamoto, T. First report in Africa of two clinical isolates of Proteus mirabilis carrying Salmonella genomic island (SGI1) variants, SGI1-PmABB and SGI1-W. Infect. Genet. Evol. 2017, 51, 132–137. [Google Scholar] [CrossRef] [PubMed]
- Hussein, A.I.; Ahmed, A.M.; Sato, M.; Shimamoto, T. Characterization of integrons and antimicrobial resistance genes in clinical isolates of Gram-negative bacteria from Palestinian hospitals. Microbiol. Immunol. 2009, 53, 595–602. [Google Scholar] [CrossRef] [PubMed]
- Soliman, A.M.; Shimamoto, T.; Nariya, H.; Shimamoto, T. Emergence of Salmonella genomic island 1 variant SGI1-W in a clinical isolate of Providencia stuartii from Egypt. Antimicrob. Agents Chemother. 2018, 63, e01793-18. [Google Scholar] [CrossRef] [Green Version]
- Khalifa, H.O.; Soliman, A.M.; Saito, T.; Kayama, S.; Yu, L.; Hisatsune, J.; Sugai, M.; Nariya, H.; Ahmed, A.M.; Shimamoto, T.; et al. First report of foodborne Klebsiella pneumoniae coharboring blaVIM-1, blaNDM-1, and mcr-9. Antimicrob. Agents Chemother. 2020, 64, e00882-20. [Google Scholar] [CrossRef] [PubMed]
- Soliman, A.M.; Zarad, H.O.; Nariya, H.; Shimamoto, T.; Shimamoto, T. Genetic analysis of carbapenemase-producing Gram-negative bacteria isolated from a university teaching hospital in Egypt. Infect. Genet. Evol. 2020, 77, 104065. [Google Scholar] [CrossRef]
- Soliman, A.M.; Nariya, H.; Tanaka, D.; Yu, L.; Hisatsune, J.; Kayama, S.; Kondo, K.; Sugai, M.; Shimamoto, T.; Shimamoto, T. Vegetable-derived carbapenemase-producing high-risk Klebsiella pneumoniae ST15 and Acinetobacter baumannii ST2 clones in Japan: Coexistence of blaNDM-1, blaOXA-66, blaOXA-72, and an AbaR4-Like resistance island in the same sample. Appl. Environ. Microbiol. 2021, 87, e02166-20. [Google Scholar] [CrossRef]
- Park, C.; Kim, S.B.; Choi, S.H.; Kim, S. Comparison of 16S rRNA gene based microbial profiling using five next-generation sequencers and various primers. Front. Microbiol. 2021, 12, 715500. [Google Scholar] [CrossRef]
- Wick, R.R.; Judd, L.M.; Gorrie, C.L.; Holt, K.E. Unicycler: Resolving bacterial genome assemblies from short and long sequencing reads. PLoS Comput. Biol. 2017, 13, e1005595. [Google Scholar] [CrossRef] [Green Version]
- Yeni, F.; Yavaş, S.; Alpas, H.; Soyer, Y. Most common foodborne pathogens and mycotoxins on fresh produce: A review of recent outbreaks. Crit. Rev. Food Sci. Nutr. 2016, 56, 1532–1544. [Google Scholar] [CrossRef]
- Pletz, M.W.; Wollny, A.; Dobermann, U.-H.; Rödel, J.; Neubauer, S.; Stein, C.; Brandt, C.; Hartung, A.; Mellmann, A.; Trommer, S.; et al. A nosocomial foodborne outbreak of a VIM carbapenemase-expressing Citrobacter freundii. Clin. Infect. Dis. 2018, 67, 58–64. [Google Scholar] [CrossRef] [PubMed]
- Poirel, L.; Walsh, T.R.; Cuvillier, V.; Nordmann, P. Multiplex PCR for detection of acquired carbapenemase genes. Diagn. Microbiol. Infect. Dis. 2011, 70, 119–123. [Google Scholar] [CrossRef] [PubMed]
- Sapkota, S.; Adhikari, S.; Pandey, A.; Khadka, S.; Adhikari, M.; Kandel, H.; Pathak, S.; Pandey, A. Multi-drug resistant extended-spectrum beta-lactamase producing E. coli and Salmonella on raw vegetable salads served at hotels and restaurants in Bharatpur, Nepal. BMC Res. Notes 2019, 12, 516. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Colosi, I.A.; Baciu, A.M.; Opriș, R.V.; Peca, L.; Gudat, T.; Simon, L.M.; Colosi, H.A.; Costache, C. Prevalence of ESBL, AmpC and carbapenemase-producing Enterobacterales isolated from raw vegetables retailed in Romania. Foods 2020, 9, 1726. [Google Scholar] [CrossRef]
Figure 1.
Example of the primer design for eicosaplex PCR. The catalytic residues for β-lactamases are indicated above the alignment of the amino acid sequences of each β-lactamase family with red color. The forward and reverse primers are highlighted in turquoise and bright green colors.
Figure 1.
Example of the primer design for eicosaplex PCR. The catalytic residues for β-lactamases are indicated above the alignment of the amino acid sequences of each β-lactamase family with red color. The forward and reverse primers are highlighted in turquoise and bright green colors.
Figure 2.
Example of the primer design for octaplex PCR for the major AmpC families. The catalytic residues for β-lactamases are indicated above the alignment of the amino acid sequences of each β-lactamase family with a red color. The forward and reverse primers are highlighted in turquoise and bright green colors, respectively. SPF and SPR indicates the specific forward and reverse primers for each AmpC family in the octaplex, respectively. CSF and CSR indicate the conserved forward and reverse primers for each AmpC family in the eicosaplex PCR, respectively.
Figure 2.
Example of the primer design for octaplex PCR for the major AmpC families. The catalytic residues for β-lactamases are indicated above the alignment of the amino acid sequences of each β-lactamase family with a red color. The forward and reverse primers are highlighted in turquoise and bright green colors, respectively. SPF and SPR indicates the specific forward and reverse primers for each AmpC family in the octaplex, respectively. CSF and CSR indicate the conserved forward and reverse primers for each AmpC family in the eicosaplex PCR, respectively.
Figure 3.
Amplification of the expected amplicons of ESBLs, AmpC β-lactamases, and the integrase genes of class 1, 2 and 3 integrons, from the positive control strains and plasmids used in this study. (A) indicates the eicosaplex PCR which amplifies blaCTX-M, blaOXA-1, blaOXA-2, blaOXA-5, blaOXA-9, blaSHV, blaTEM, AmpC-CS (blaACC, blaACT/MIR, blaCMY/LAT, blaDHA, blaFOX and blaMOX, blaADC, and blaPDC), aac(6’)-Ib, and integrase genes (intI1, 2 and 3). In case of obtaining a band of AmpC-CS (374 bp) in (A), we should use (B) which indicates the octaplex PCR amplifying and differentiating specifically between blaACC, blaACT/MIR, blaCMY/LAT, blaDHA, blaFOX, blaMOX, blaADC, and blaPDC. The PCR products were separated in a 3% agarose gel. The lanes were named according to the positive control strain or plasmid used, for example, lane Eco PL65 indicates the amplification of blaOXA-1, blaTEM-1, blaCTX-M-15, and aac(6′)-Ib-cr. Lane pOXA2m/Eco indicates the amplification of the synthesized blaOXA-2. Lane Eicosa and Octa Ladders indicate a single amplification of each target in the two multiplexes, as shown in (C,D), then all the amplicons of each one were mixed in the same ratio and loaded into the agarose gel. NC indicates the negative control strain E. coli K12. Red asterisks indicate synthesized genes inserted in the pEX-K4J2 (KmR) plasmid. Yellow asterisks indicate non-specific band that appeared only from P. aeruginosa in the case of octaplex PCR. Blue colored text indicates AmpC β-lactamases. Orange colored text indicates integrons (intI1, intI2, and intI3). Green colored text indicates Internal controls (IC).
Figure 3.
Amplification of the expected amplicons of ESBLs, AmpC β-lactamases, and the integrase genes of class 1, 2 and 3 integrons, from the positive control strains and plasmids used in this study. (A) indicates the eicosaplex PCR which amplifies blaCTX-M, blaOXA-1, blaOXA-2, blaOXA-5, blaOXA-9, blaSHV, blaTEM, AmpC-CS (blaACC, blaACT/MIR, blaCMY/LAT, blaDHA, blaFOX and blaMOX, blaADC, and blaPDC), aac(6’)-Ib, and integrase genes (intI1, 2 and 3). In case of obtaining a band of AmpC-CS (374 bp) in (A), we should use (B) which indicates the octaplex PCR amplifying and differentiating specifically between blaACC, blaACT/MIR, blaCMY/LAT, blaDHA, blaFOX, blaMOX, blaADC, and blaPDC. The PCR products were separated in a 3% agarose gel. The lanes were named according to the positive control strain or plasmid used, for example, lane Eco PL65 indicates the amplification of blaOXA-1, blaTEM-1, blaCTX-M-15, and aac(6′)-Ib-cr. Lane pOXA2m/Eco indicates the amplification of the synthesized blaOXA-2. Lane Eicosa and Octa Ladders indicate a single amplification of each target in the two multiplexes, as shown in (C,D), then all the amplicons of each one were mixed in the same ratio and loaded into the agarose gel. NC indicates the negative control strain E. coli K12. Red asterisks indicate synthesized genes inserted in the pEX-K4J2 (KmR) plasmid. Yellow asterisks indicate non-specific band that appeared only from P. aeruginosa in the case of octaplex PCR. Blue colored text indicates AmpC β-lactamases. Orange colored text indicates integrons (intI1, intI2, and intI3). Green colored text indicates Internal controls (IC).
Table 1.
Positive control bacteria used in this study.
| Strain Name | Bacterial spp. | Source | Country | Isolation Year | Resistance Genes | Reference |
|---|---|---|---|---|---|---|
| Eco TAN60 | E. coli | Clinical | Egypt | 2014 | blaNDM-1, blaSHV-12, blaCTX-M-15, blaTEM-1, blaCMY-2, class 1 integron (aac(6’)-Ib), qnrS, rmtC | [19] |
| Eco TAN92 | E. coli | Clinical | Egypt | 2014 | blaNDM-1, blaCTX-M-15, blaCMY-2, rmtC, class 1 integron carrying (aac(6´)-Ib) | [19] |
| Eco PL65 | E. coli | Clinical | Palestine | 2006 | blaTEM-1, blaOXA-1, blaCTX-M-15, aac(6´)-Ib-cr | [16] |
| Pmi TAN59 | P. mirabilis | Clinical | Egypt | 2014 | class 1 integron (aacA5-aadA7-qacE1- sul1), blaTEM-1, blaDHA, blaOXA-5, qnrA1, class 2 integron (intI2) | [15] |
| Kpn D6 | K. pneumoniae | Water | Japan | 2016 | blaTEM-1, blaSHV-12, blaOXA-1, blaCTX-M-15, aac(6´)-Ib-cr5, oqxAB, class 1 integron | This study |
| Kpn LM22-1 | K. pneumoniae | Chicken | Japan | 2016 | blaSHV-71, oqxAB, fosA, blaVIM-1, mcr-9, blaTEM-1B, blaCTX-M-9, aadA24, ant(2´´)-Ia, aadA2, aph(3´)-Ia, sul1, dfrA1, blaNDM-1, aac(6´)-Ib, aadA1, blaCTX-M-15, blaOXA-9, blaTEM-1A, qnrS1, aac(6´)-Ib-cr | [18] |
| Kpn AO15/22 | K. pneumoniae | Vegetable | Japan | 2015 | blaSHV-28, fosA, oqxAB, blaSHV-1, blaTEM-1A, tet(D), aac(6’)-Ib, aadA1, aph(3’)-VI, blaCTXM-15, blaNDM-1, blaOXA-9, aac(6’)-Ib-cr, qnrS1, aph(6)-Id, aph(3’)-VIb, aph(3’’)-Ib, blaCTXM-14b | [20] |
| Pst TAN3 | P. stuartii | Clinical | Egypt | 2014 | class 1 integron (aadA2-lnuF), blaTEM-1, blaDHA-1, qnrD, floR, class 2 integron (intI2) | [17] |
| Pst TAN14 | P. stuartii | Clinical | Egypt | 2014 | blaNDM-1, blaCMY-2, blaDHA-1, rmtC, qnrA, qnrD, class 1 integron carrying (aac(6’)-Ib) | [19] |
| Pae S16 | P. aeruginosa | Clinical | Egypt | 2014 | class 1 integron (blaVIM-24-aadB-blaOXA-10), blaPDC | [19] |
| Aba 392 | A. baumannii | Clinical | Egypt | 2015 | blaOXA-23-like,blaOXA-51-like, class 1 integron, blaADC,aac(6’)-Ib | This study |
| Aba AO22 | A. baumannii | Vegetable | Japan | 2015 | class 1 integron, blaADC-25, blaOXA-66, sul2, tet(B), aac(3)-Ia, aac(6’)-Ip, aph(3’’)-Ib, aph(6)-Id | [20] |
| Aero AO12 | Aeromonas spp. | Vegetable | Japan | 2014-2015 | blaMOX-12 | This study |
| Aero 19-2B | Aeromonas spp. | Vegetable | Japan | 2019 | blaFOX | This study |
| Ente ANO11 | Enterobacter spp. | Vegetable | Japan | 2014-2015 | blaACT-64 | This study |
Table 2.
Positive control plasmids used in this study.
| Plasmid Name | Vector | Resistance Genes | Reference |
|---|---|---|---|
| pOXA-2m | pEX-K4J2 (KmR) | blaOXA-2 | This study |
| pIntI3m | pEX-K4J2 (KmR) | Integrase gene of class 3 integron (intI3) | This study |
| pFOXm | pEX-K4J2 (KmR) | blaFOX | This study |
| pACCm | pEX-K4J2 (KmR) | blaACC | This study |
All the pEX-K4J2 (KmR) plasmids were transformed into E. coli DH10B.
Table 3.
Group-specific oligonucleotides used in this study for eicosaplex PCR.
| Primer | Sequence (5’–3’) 1 | Targeted Gene or Targeted β-Lactamase(s) 2 | Amplicon Size (bp) | Primer Concentration (pmol/μL) | Reference |
|---|---|---|---|---|---|
| 515F 1492R | GTGCCAGCMGCCGCGGTAA CGGYTACCTTGTTACGACTT | 16S rRNA | 1001 | 0.2 0.2 | This study |
| OXA1-WGF OXA1-WGR | ATGAAAAACACAATACATATCAACTTC TTATAAATTTAGTGTGTTTAGAATGGTG | OXA-1, OXA-4, OXA-30, OXA-31, OXA-47, OXA-224, OXA-320, OXA-392, OXA-543 | 831 | 0.4 0.4 | This study |
| SHV-FW SHV-RV | GTGTATTATCTCCCTGTTAGCC GGCCAAGCAGGGCGACAAT | SHV-1 to SHV-203 | 722 | 0.2 0.2 | This study |
| TEM-FW TEM-RV | TTGAGAGTTTTCGCCCCGAA ACGGGAGGGCTTACCATCTG | TEM-1 to TEM-232 | 602 | 0.1 0.1 | This study |
| CTXM-FW CTXM-RV | TGCAGYACCAGTAARGTKATGGC CCGCTGCCGGTYTTATC | CTX-M-1 to CTX-M-214, KLUA, KLUC, KLUG, and TOHO-1 to TOHO-3 | 509 | 0.3 0.3 | This study |
| OXA2-FW OXA2-RV | ATAGTTGTGGCAGACGAACG TTGACCAAGCGCTGATGTTC | OXA-2, OXA-3, OXA-15, OXA-20, OXA-21, OXA-32, OXA-37, OXA-46, OXA-53, OXA-118, OXA-119, OXA-141, OXA-161, OXA-210, OXA-226, OXA-415, OXA-539, OXA-540, OXA-541, OXA-543, OXA-544 | 452 | 0.2 0.2 | This study |
| CMY/LAT-CSFCMY/LAT-CSR | TCCAGCATTGGTCTGTTTGG GGCCAGTTCAGCATCTCCCA | CMY-2 to CMY-157, BIL-1, LAT-1 to LAT-4, CFE-1 | 374 | 0.1 0.1 | This study |
| MIR/ACT-CSFMIR/ACT-CSR1 MIR/ACT-CSR2 | GCCAGCATCGGTCTTTTTGG GGCCAGTTGAGCATCTCCCA GGCCAGTTTAGCATTTCCCA | ACT-1 to ACT-54, MIR-1 to MIR-22 | 374 | 0.1 0.1 0.1 | This study |
| DHA-CSF DHA-CSR | AGCAGTATCGGCCTGTTTGG GGCCAGTCATACATTTCCCA | DHA-1 to DHA-25 | 374 | 0.1 0.1 | This study |
| MOX-CSF1 MOX-CSF2 MOX-CSR | CCCAGCATAGGGCTGTTCGG CCCAGCATCGGGCTCTTTGG GGATAGGCGTAACKCTCCCA | MOX-1 to MOX-13, CMY-1, CMY-8, CMY-8b, CMY-9, CMY-10, CMY-11, CMY-19 | 371 | 0.1 0.1 0.1 | This study |
| FOX-CSF FOX-CSR | CCCAGCATMGGCCTGTTTGG GGATAGGCGTARCTCTCCCA | FOX-1 to FOX-16 | 371 | 0.1 0.1 | This study |
| PDC-CSF PDC-CSR | CCGAGCATCGGYCTGTTCGG GGCCAGTCGTAGGCTTCCCA | PDC-1 to PDC-249 | 374 | 0.1 0.1 | This study |
| ACC-CSF ACC-CSR | ATCGGTACYGGTTTGCTAGG GGATATGGCARCTGCTCCCA | ACC-1 to ACC-7 | 380 | 0.1 0.1 | This study |
| ADC-CSF ADC-CSR | GACAATATTCAAAYCCAAGYATTGG GGATAAGAAAAYTCTTCCCAACC | ADC-1 to ADC-107 | 388 | 0.4 0.4 | This study |
| OXA5-FW OXA5-RV | GTATTTCAACAAATYGCCAGAGA CCACCAWGCGACACCAGGA | OXA-5, OXA-7, OXA-10, OXA-11, OXA-13, OXA-14, OXA-17, OXA-19, OXA-28, OXA-35, OXA-56, OXA-74, OXA-101, OXA-129, OXA-142, OXA-145, OXA-147, OXA-183, OXA-233, OXA-240, OXA-246, OXA-251, OXA-256, OXA-368, OXA-454, OXA-520 | 312 | 0.4 0.4 | This study |
| AAC6-FW AAC6-RV | TTGCGATGCTCTATGAGTGGCTA AGTTGTGATGCATTCGCCAG | aac(6′)-Ib | 274 | 0.1 0.1 | This study |
| OXA9-FW OXA9-RV | CAGTTCCGTGGCTTCTGATG GTTGTATTCCGGCTTCAATTCC | OXA-9a, OXA-9b | 211 | 0.1 0.1 | This study |
| IntI1-FW IntI1-RV | AGCTTGGCACCCAGCCTG GACACCGCTCCGTGGATC | intI1 of class 1 integron | 192 | 0.15 0.15 | This study |
| IntI2-FW IntI2-RV | AAGGTTATGCGCTGAAAACTGAA TCTGCGTGTTTATGGCTACATG | intI2 of class 2 integron | 159 | 0.1 0.1 | This study |
| IntI3-FW IntI3-RV | CACCGAGAAGCAAGTGG AATCCGCTTGCGTTCTG | intI3 of class 3 integron | 133 | 0.2 0.2 | This study |
1 R = G or A, Y = C or T, M = A or C, K = G or T, W = A or T. 2 Bolded OXA β-lactamases indicate extended-spectrum β-lactamase activity.
Table 4.
Group-specific oligonucleotides used in this study for octaplex PCR.
| Primer | Sequence (5’–3’) 1 | Targeted Gene or Targeted β-Lactamase(s) | Amplicon Size (bp) | Primer Concentration (pmol/μL) | Reference |
|---|---|---|---|---|---|
| DHA-SPF DHA-SPR | ACCGCTGATGGCACAGCAG CAGCGCAGCATATCTTTTGAG | DHA-1 to DHA-25 | 648 | 0.2 0.2 | This study |
| CMY/LAT-SPFCMY/LAT-SPR1 CMY/LAT-SPR2 | AAAACAGAACAACARATTGCCGATA GGACGCGTCTGGTCATTGCC GGACGCGGGTGGTCATCGCC | CMY-2 to CMY-157, BIL-1, LAT-1 to LAT-4, CFE-1 | 529 | 0.2 0.2 0.2 | This study |
| MIR/ACT-SPF1MIR/ACT-SPF2MIR/ACT-SPR1MIR/ACT-SPR2 | CTGGGYTCTATAAGTAAAACCTTCACCG CTGGGCTCAATCAGCAAAACCTTCACCG CGGTATCCCCAGGCGTAATG CGATAGCCCCAGGCGTAATG | ACT-1 to ACT-54, MIR-1 to MIR-22 | 428 | 0.3 0.3 0.3 0.3 | This study |
| MOX-SPF MOX-SPR | GCCCCGTGGTGGATGCCAG GYCCACTGGCGGTAGTAGGC | MOX-1 to MOX-13, CMY-1, CMY-8, CMY-8b, CMY-9, CMY-10, CMY-11, CMY-19 | 391 | 0.2 0.2 | This study |
| FOX-SPF FOX-SPR | TGGTCACCGGTTTATCCGGC GCATCTCCCTGATACCCCATGTT | FOX-1 to FOX-16 | 323 | 0.2 0.2 | This study |
| PDC-SPF PDC-SPR | GACCTGCTGCGCTTCGTC GGTCTTGTTCAGCAGGCGCT | PDC-1 to PDC-249 | 263 | 0.2 0.2 | This study |
| ADC-SPF ADC-SPR | CTTTTTATTTTTAGTACCTCAATTTATGC TGCTATTTACGGCTTTTTTATCTTGAAC | ADC-1 to ADC-107 | 202 | 0.4 0.4 | This study |
| ACC-SPF ACC-SPR | GATGAGAGCAAAATTAAAGACACCG AGGCTGTTTTGCCGCTAACC | ACC-1 to ACC-7 | 143 | 0.2 0.2 | This study |
1 R = G or A, and Y = C or T.
Table 5.
Sum of positive strains of the eicosaplex/octaplex PCR system from the ANO substances.
| 54 ANO | Number of Isolates | CTX-M | OXA-1 | OXA-2 | OXA-5 | OXA-9 | SHV | TEM | aac(6’) | intI1 | intI2 | intI3 | AmpC | DHA | CMY/LAT | ACT/MIR | MOX | FOX | PDC | ADC | ACC | ND |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Enterobacter | 16 | - | - | - | - | - | 1 | 2 | - | - | - | - | 16 | - | - | 15 | - | - | - | - | - | 1 |
| Klebsiella | 6 | - | - | - | - | - | 5 | - | - | - | - | - | 1 | - | - | 1 | - | - | - | - | - | - |
| Citrobacter | 2 | - | - | - | - | - | - | - | - | - | - | - | 2 | - | - | - | - | - | - | - | - | 2 |
| Pseudomonas | 1 | - | - | - | - | - | - | - | - | - | - | - | 1 | - | - | - | - | - | - | - | - | 1 |
| Rhanella | 1 | 1 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| Total | 26 | 1 | - | - | - | - | 6 | 2 | - | - | - | - | 20 | - | - | 16 | - | - | - | - | - | 4 |
Table 6.
Sum of positive strains of the eicosaplex/octaplex PCR system from the AO substances.
| 55 AO | Number of Isolates | CTX-M | OXA-1 | OXA-2 | OXA-5 | OXA-9 | SHV | TEM | aac(6’) | intI1 | intI2 | intI3 | AmpC | DHA | CMY/LAT | ACT/MIR | MOX | FOX | PDC | ADC | ACC | ND |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Klebsiella | 18 | 8 | - | - | - | 2 | 11 | 2 | 2 | - | - | - | 1 | - | - | - | - | - | - | - | - | 1 |
| Enterobacter | 7 | - | - | - | - | - | - | - | - | - | - | - | 7 | - | - | 7 | - | - | - | - | - | - |
| Acinetobacter | 4 | - | - | - | - | - | - | - | - | 1 | - | - | 4 | - | - | - | - | - | - | 4 | - | - |
| Aeromonas | 1 | - | - | - | - | - | - | - | - | - | - | - | 1 | - | - | - | 1 | - | - | - | - | - |
| Proteus | 1 | 1 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| Total | 31 | 9 | - | - | - | 2 | 11 | 2 | 2 | 1 | - | - | 13 | - | - | 7 | 1 | - | - | 4 | - | 1 |
Table 7.
Features of the Gram-negative isolates grown on MacConkey plates containing 100 μg/mL ampicillin from 21 organic (AO: 55 isolates) vegetables and fruits.
Table 7.
Features of the Gram-negative isolates grown on MacConkey plates containing 100 μg/mL ampicillin from 21 organic (AO: 55 isolates) vegetables and fruits.
| No. | Strain AO | Source (# Imported) | Identification by 16S rRNA Sequencing 2 | Growing on LB Agar Medium Supplemented with 3 | Genotype Eicosa (Octa) Plex PCR 4 | ||||
|---|---|---|---|---|---|---|---|---|---|
| AMP 100 24 h | MER 4 24 h | MER 1 24 h | CTX 4 24 h | CAZ 16 24 h | |||||
| 1 | 1-1 | Green onion | ND | + | ND | ||||
| 2 | 1-2 | ND | + | ND | |||||
| 3 | 2-1 | Hakusai | Klebsiella oxytoca | + | OXY-2 | ||||
| 4 | 2-3 | Pseudomonas spp. | + | + | + | ND | |||
| 5 | 2-5 | Klebsiella oxytoca | + | OXY-2 | |||||
| 6 | 2-6 | Pseudomonas spp. | + | + | + | ND | |||
| 7 | 3-1 | Carrot | Aeromonas spp. | + | ND | ||||
| 8 | 3-2 | ND | + | ND | |||||
| 9 | 3-3 | Enterobacter spp. | + | AmpC (ACT) ACT-51v | |||||
| 10 | 4-1 | Leaf lettuce | ND | + | ND | ||||
| 11 | 4-2 | Enterobacter spp. | + | AmpC (ACT) ACT-2v | |||||
| 12 | 4-3 | Aeromonas spp. | + | AmpC (MOX) MOX-12v | |||||
| 13 | 4-4 | ND | + | ND | |||||
| 14 | 5-1 | Italian parsley | ND | + | ND | ||||
| 15 1 | 5-4 | Klebsiella pneumoniae | + | + | + | + | + | SHV, TEM, CTXM, aac(6’)-Ib, OXA-9 (NDM-1) | |
| 16 | 6-1 | Oka hijiki | Pseudomonas spp. | + | + | ND | |||
| 17 | 6-2 | ND | + | ND | |||||
| 18 | 6-3 | Pseudomonas spp. | + | + | ND | ||||
| 19 | 7-1 | # Banana 1 | Klebsiella pneumoniae | + | SHV (SHV-27) | ||||
| 20 | 7-2 | Klebsiella variicola | + | SHV (LEN-19v) | |||||
| 21 | 7-4 | Klebsiella variicola | + | SHV (LEN-19v) | |||||
| 221 | 8-1 | Baby leaf mix | Klebsiella pneumoniae | + | + | + | + | + | SHV, TEM, CTX-M, aac(6’)-Ib,OXA-9 (NDM-1) |
| 231 | 8-2 | Acinetobacter baumannii | + | + | + | + | + | AmpC (ADC) ADC-25, intI1 | |
| 24 | 8-3 | Pseudomonas spp. | + | + | ND | ||||
| 25 | 9-1 | Salad mix | ND | + | ND | ||||
| 26 | 9-2 | Kosakonia spp. | + | + | + | ND | |||
| 27 | 9-3 | Enterobacter spp. | + | AmpC (ACT) CMAEv | |||||
| 28 | 9-5 | ND | + | ND | |||||
| 29 | 9-6 | Enterobacter spp. | + | AmpC (ACT) CMAEv | |||||
| 30 | 10-1 | Red spinach | Enterobacter spp. | + | AmpC (ACT) CMAEv | ||||
| 31 | 11-1 | Radish | Klebsiella oxytoca | + | OXY-1nv | ||||
| 32 | 11-2 | Enterobacter spp. | + | + | + | AmpC (ACT) CMAEnv | |||
| 33 | 12-1 | Mizuna | ND | + | ND | ||||
| 34 | 12-2 | ND | + | ND | |||||
| 35 | 13-1 | # Banana 2 | Acinetobacter spp. | + | + | AmpC (ADC) ADCnv | |||
| 36 | 13-2 | Enterobacter spp. | + | + | + | AmpC (ACT) ACT-9 | |||
| 37 | 14-1 | Tomato | ND | + | ND | ||||
| 38 | 14-2 | ND | + | ND | |||||
| 39 | 14-3 | ND | + | ND | |||||
| 40 | 15-1 | Green paprika | Klebsiella variicola | + | SHV (LEN-27v) | ||||
| 41 | 15-2 | Proteus vulgaris | + | + | CTX-Mw HugA | ||||
| 42 | 15-3 | Acinetobacter pittii | + | + | AmpC (ADC) ADCnv | ||||
| 43 | 16-1 | Eggplant | Klebsiella variicola | + | SHV (LEN-25) | ||||
| 44 | 16-2 | Acinetobacter baumannii | + | + | AmpC (ADC) ADCnv | ||||
| 45 | 16-3 | Klebsiella pneumoniae | + | SHV (SHV-11v, BSBL) | |||||
| 46 | 17-1 | Cucumber | Klebsiella variicola | + | SHV (LEN-16) | ||||
| 47 | 17-2 | Klebsiella oxytoca | + | CTX-M (OXY-2) | |||||
| 48 | 18-1 | Onion | Kosakonia spp. | + | ND | ||||
| 49 | 18-2 | ND | + | ND | |||||
| 50 | 19-1 | Potato | Klebsiella spp. | + | OXY-1-2 | ||||
| 51 | 19-2 | Klebsiella variicola | + | SHV (LEN-13) | |||||
| 52 | 19-3 | Klebsiella aerogenes | + | AmpC (ND) CMAEv | |||||
| 53 | 20-1 | Sweet green pepper | Klebsiella pneumoniae | + | SHV (SHV-11) | ||||
| 54 | 21-1 | Purple pepper | Klebsiella spp. | + | OXY-6nv | ||||
| 55 | 21-2 | Serratia marcescens | + | + | ND | ||||
1 Detailed analysis of these 3 isolates by complete genome sequencing can be found in reference [19]. 2 ND indicates not determined. 3 The (+) sign indicates good growth on the corresponding medium. 4 The letters (v) and (nv) after β-lactamase indicate a variant and novel variant, respectively. CMAE indicates CMY2/MIR/ACT/EC family plasmid-mediated AmpC β-lactamases.
Table 8.
Features of the Gram-negative isolates grown on MacConkey plates containing 100 μg/mL ampicillin from 27 non-organic (ANO: 54 isolates) vegetables and fruits.
Table 8.
Features of the Gram-negative isolates grown on MacConkey plates containing 100 μg/mL ampicillin from 27 non-organic (ANO: 54 isolates) vegetables and fruits.
| No. | Strain ANO | Source (# Imported) | Identification by 16S rRNA Sequencing 1 | Growing on LB Agar Medium Supplemented with 2 | Genotype Eicosa (Octa) Plex PCR 3 | ||||
|---|---|---|---|---|---|---|---|---|---|
| AMP 100 24 h | MER 4 24 h | MER 1 24 h | CTX 4 24 h | CAZ 16 24 h | |||||
| 1 | 1-1 | Apple 1 | Enterobacter spp. | + | + | AmpC-CS (ACT) ACT-16 | |||
| 2 | 1-2 | Enterobacter spp. | + | + | AmpC-CS (ACT) ACT-16 | ||||
| 3 | 2-1 | Persimmon 1 | Pseudomonas spp. | + | + | + | + | ND | |
| 4 | 3-1 | Tomato1 | Pseudomonas Spp. | + | + | + | ND | ||
| 5 | 4-1 | Cucumber 1 | Klebsiella pneumoniae | + | + | SHV-41v | |||
| 6 | 4-2 | ND | + | ND | |||||
| 7 | 5-1 | Grape | Enterobacter spp. | + | AmpC-CS (ACTw) ACT-61v | ||||
| 8 | 5-2 | Enterobacter spp. | + | AmpC-CS (ACTw) ACT-61v | |||||
| 9 | 6-1 | Shimeji | Klebsiella michiganensis | + | + | AmpC-CS (ACT) CMAEv | |||
| 10 | 6-2 | Enterobacter spp. | + | AmpC-CS (ND) CMAEnv | |||||
| 11 | 7-1 | Hakusai | Enterobacter spp. | + | + | + | + | AmpC-CS (ACT) ACT-64, intI1 | |
| 12 | 7-2 | Pseudomonas alcaligenes | + | + | + | + | + | ND | |
| 13 | 8-2 | Apple 2 | Citrobacter freundii | + | + | + | AmpC-CS (ND) CMAEnv | ||
| 14 | 9-1 | Pear 1 | Pseudomonas putida | + | + | ND | |||
| 15 | 9-2 | ND | + | + | ND | ||||
| 16 | 9-4 | ND | + | + | ND | ||||
| 17 | 9-5 | ND | + | + | ND | ||||
| 18 | 10-2 | Persimmon 2 | Enterobacter spp. | + | + | + | AmpC-CS (ACT) CMAE | ||
| 19 | 10-3 | Citrobacter spp. | + | + | + | AmpC-CS (ND) CMAEnv | |||
| 20 | 11-1 | # Kiwi | Pseudomonas spp. | + | + | + | AmpC-CS (ND) AmpCnv | ||
| 21 | 11-3 | Rahnella aquatilis | + | + | CTX-M (RANH-2, ESBL) | ||||
| 22 | 12-1 | Pear 2 | Kosakonia spp. | + | ND | ||||
| 23 | 12-2 | Kosakonia spp. | + | ND | |||||
| 24 | 12-3 | ND | + | ND | |||||
| 25 | 14-1 | Tomato 2 | Pseudomonas spp. | + | + | + | ND | ||
| 26 | 14-2 | Pantoea ananatis | + | + | ND | ||||
| 27 | 14-3 | Pantoea ananatis | + | + | ND | ||||
| 28 | 17-1 | Potato 1 | Klebsiella pneumoniae | + | SHV-1v | ||||
| 29 | 18-1 | Cucumber 2 | Enterobacter cloacae | + | + | + | AmpC-CS (ACT) CMAE | ||
| 30 | 18-2 | Enterobacter spp. | + | + | TEM-1, AmpC-CS (ACT) ACT-32, intI1 | ||||
| 31 | 18-3 | Klebsiella pneumoniae | + | SHV-1v | |||||
| 32 | Single | Enterobacter spp. | + | AmpC-CS (ACT) AZECL-32 | |||||
| 33 | 19-1 | Tomato 3 | ND | + | ND | ||||
| 34 | 19-2 | ND | + | ND | |||||
| 35 | 19-3 | Enterobacter spp. | + | AmpC-CS (ACT) ACT-32 | |||||
| 36 | 20-2 | Potato 2 | Pseudomonas spp. | + | + | ND | |||
| 37 | 20-3 | Pseudomonas spp. | + | + | ND | ||||
| 38 | 21-1 | Green paprika 1 | ND | + | ND | ||||
| 39 | 21-2 | ND | + | ND | |||||
| 40 | 21-3 | Pseudomonas fulva | + | + | + | ND | |||
| 41 | 21-4 | Pseudomonas fulva | + | + | + | ND | |||
| 42 | 22-1 | Korean lettuce | Enterobacter spp. | + | + | + | + | AmpC-CS (ACT) ACT-51v | |
| 43 | 22-3 | Pseudomonas spp. | + | + | + | ND | |||
| 44 | 23-1 | Lettuce | Klebsiella pneumoniae | + | + | SHV-1 | |||
| 45 | 24-1 | # Gold kiwi | Enterobacter cloacae | + | + | + | AmpC-CS (ACT) CMAE | ||
| 46 | 24-2 | Enterobacter cloacae | + | + | + | AmpC-CS (ACT) CMAE | |||
| 47 | 24-3 | Enterobacter cloacae | + | AmpC-CS (ACT) CMAE | |||||
| 48 | 25-1 | Persimmon 3 | ND | + | ND | ||||
| 49 | 25-2 | Klebsiella pneumoniae | + | SHV-1v | |||||
| 50 | 25-3 | ND | + | ND | |||||
| 51 | 26-2 | Green paprika 2 | Pseudomonas spp. | + | + | + | + | ND | |
| 52 | 26-3 | Pseudomonas spp. | + | + | + | + | ND | ||
| 53 | 27-1 | Paprika | Enterobacter cloacae | + | + | + | AmpC-CS (ACT) CMAE | ||
| 54 | 27-2 | Pseudomonas putida | + | + | + | + | ND | ||
1 ND indicates not determined. 2 The (+) sign indicates good growth on the corresponding medium. 3 The letters (v) and (nv) after β-lactamase indicate a variant and novel variant, respectively. CMAE indicates CMY2/MIR/ACT/EC family plasmid-mediated AmpC β-lactamases.
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
MDPI and ACS Style
Soliman, A.M.; Nariya, H.; Tanaka, D.; Shimamoto, T.; Shimamoto, T. A Novel Single-Tube Eicosaplex/Octaplex PCR System for the Detection of Extended-Spectrum β-Lactamases, Plasmid-Mediated AmpC β-Lactamases, and Integrons in Gram-Negative Bacteria. Antibiotics 2023, 12, 90. https://doi.org/10.3390/antibiotics12010090
AMA Style
Soliman AM, Nariya H, Tanaka D, Shimamoto T, Shimamoto T. A Novel Single-Tube Eicosaplex/Octaplex PCR System for the Detection of Extended-Spectrum β-Lactamases, Plasmid-Mediated AmpC β-Lactamases, and Integrons in Gram-Negative Bacteria. Antibiotics. 2023; 12(1):90. https://doi.org/10.3390/antibiotics12010090
Chicago/Turabian StyleSoliman, Ahmed M., Hirofumi Nariya, Daiki Tanaka, Toshi Shimamoto, and Tadashi Shimamoto. 2023. "A Novel Single-Tube Eicosaplex/Octaplex PCR System for the Detection of Extended-Spectrum β-Lactamases, Plasmid-Mediated AmpC β-Lactamases, and Integrons in Gram-Negative Bacteria" Antibiotics 12, no. 1: 90. https://doi.org/10.3390/antibiotics12010090
Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.
