Antibiotic Susceptibility and Resistance Genes in Oral Clinical Isolates of Prevotella intermedia, Prevotella nigrescens, and Prevotella melaninogenica
by
,
Yormaris Castillo
1
,
Nathaly Andrea Delgadillo
1,
Yineth Neuta
1,
Andrés Hernández
2,
Tania Acevedo
2,
Edwin Cárdenas
2,
Andrea Montaño
2,
Gloria Inés Lafaurie
1 and 
Diana Marcela Castillo
1,*
1
Unidad de Investigación Básica Oral-UIBO, Vicerrectoría de Investigaciones, Facultad de Odontología, Universidad El Bosque, 110121 Bogotá, Colombia
2
Facultad de Odontología, Universidad El Bosque, 110121 Bogotá, Colombia
*
Author to whom correspondence should be addressed.
Antibiotics 2022, 11(7), 888; https://doi.org/10.3390/antibiotics11070888
Submission received: 31 May 2022
/
Revised: 22 June 2022
/
Accepted: 24 June 2022
/
Published: 4 July 2022
(This article belongs to the Special Issue Antimicrobial Strategies against Oral Pathogenic Bacteria and Biofilm)
Abstract
:The Prevotella genus is a normal constituent of the oral microbiota, and is commonly isolated from mechanically treated polymicrobial infections. However, antibiotic treatment is necessary for some patients. This study compared the antibiotic susceptibility and the presence of resistance genes in clinical oral isolates of P. intermedia, P. nigrescens, and P. melaninogenica. Antibiotic susceptibility was assessed using the agar dilution method. PCR confirmed the species and resistance gene frequency in the Prevotella species. The frequencies of species P. intermedia, P. nigrescens, and P. melaninogenica were 30.2%, 45.7%, and 24.1%, respectively. No isolates of P. intermedia were resistant to amoxicillin/clavulanic acid, tetracycline, or clindamycin. P. nigrescens and P. melaninogenica were resistant to amoxicillin/clavulanic acid and tetracycline at frequencies of 40% and 20%, respectively. P. intermedia was resistant to metronidazole at a frequency of 30%, P. nigrescens at 20%, and P. melaninogenica at 40%. P. nigrescens and P. melaninogenica were resistant to 50% and 10% clindamycin, respectively. The gene most frequently detected was tetQ, at 43.3%, followed by tetM at 36.6%, blaTEM at 26.6%, ermF at 20%, cfxA, cfxA2, and nimAB at 16.6%, and nimAEFI at 3.3%. P. nigrescens was the species with the highest resistance to antibiotics such as amoxicillin/clavulanic acid, amoxicillin, and clindamycin, in addition to being the species with the largest number of genes compared to P. intermedia and P. melaninogenica.
1. Introduction
Prevotella is a genus of Gram-negative, strictly anaerobic bacteria present in the normal oral microenvironment; in polymicrobial oral infections, Prevotella species can function as opportunistic pathogens [1]. In the oral cavity, this genus is associated with chronic periodontitis, pulpal infections, and abscesses of dental or periodontal origin [2,3]. Such infections are treated by eradicating the etiological factors (including the infectious component) through either mechanical instrumentation, the use of chemical elements, or the use of physical agents. Thus, as an adjunctive therapy to mechanical devices, antibiotic treatment plays an essential role in the management of oral infections. The availability of such treatments has led to the development of resistance in Prevotella to the main antibacterial drugs used in dental practice [4].
Antibiotics from the group of beta-lactams are the first choice for treating oral infections, and tetracyclines and macrolides are the second choices. These antibiotics can eradicate most bacteria, and the incidence of adverse reactions is low. Currently, the antimicrobial susceptibility patterns of Prevotella species are not well understood, and existing reports have focused primarily on evaluating resistance to the beta-lactam antibiotics, which are preferred in dental practice. However, the use of combination therapy is increasing over time, leading to resistance to other families of antibiotics. The resistance of Prevotella to beta-lactam antibiotics was reported in 33% of cases, and resistance to clindamycin (CC) was found in 3% of cases [4]. Furthermore, the frequency of amoxicillin (AMX) resistance increased from 30% to 60% between 2011 and 2013 [5,6].
Few researchers have investigated the prevalence of antibiotic resistance genes in Prevotella isolated from human clinical specimens. In 2000, the presence of the tetQ gene was reported in the genera Prevotella and Porphyromonas; this gene confers resistance to antibiotics such as tetracyclines. In infections with anaerobic or protozoal organisms, metronidazole the treatment of choice. Its mechanism of action involves the formation of nitrous radicals that are toxic to these microorganisms. The presence of the drug may cause the expression of the nim gene and its allelic variants, leading to the production of enzymes that prevent the drug from forming nitrous radicals, and contributing to resistance to the drug [7,8]. A 2019 study generated great interest by reporting the prevalence of cfxA (50.5%), tetQ (30.3%), ermF (9.1%), and nim (1.0%) in Prevotella [9].
No studies have linked the effects of antibiotic resistance genes and susceptibility in vitro in isolates from the oral environment. Therefore, it is of great clinical importance to evaluate the presence of genes associated with antibiotic resistance and to make a comparative analysis of their effects and expression patterns by evaluating antibiotic susceptibility in the Prevotella genus, considering its importance in the oral cavity. In addition to the limited published scientific literature on the presence of these genetic components and their relationship with antibiotic susceptibility in these microorganisms, it is essential to have up-to-date epidemiological data on the importance of antibiotic therapy in dental practice. This study aimed to compare the antibiotic susceptibility and presence of resistance genes in Prevotella intermedia, Prevotella nigrescens, and Prevotella melaninogenica.
2. Results
2.1. Frequency of P. intermedia, P. nigrescens, and P. melaninogenica
Five hundred pure and viable isolates of Prevotella spp. were recovered; these were the general sample units. These were used to identify P. intermedia, P. nigrescens, and P. melaninogenica. A sample unit of 162 isolates corresponding to the identified species was used for all analyses (n = 162). Species confirmation was performed using conventional PCR. The species were identified at the following frequencies: P. intermedia 30.2% (n = 49), P. nigrescens 45.7% (n = 74), and P. melaninogenica 24.1% (n = 39).
Isolates were classified by periodontal clinical diagnosis; P. nigrescens and P. melaninogenica were identified in all clinical diagnosis types, including healthy, gingivitis, and periodontitis. In total, 90% of the P. intermedia isolates were in the periodontitis group. The species most associated with healthy states was P. melaninogenica 40% (Table 1).
2.2. Evaluation of Antibiotic Susceptibility in Isolates of P. intermedia, P. nigrescens, and P. melaninogenica
Table 2 and Figure 1 show the global antimicrobial resistance to the antibiotics AMX, amoxicillin/clavulanic acid (AMC), metronidazole (MTZ), tetracycline (TE), and CC by agar dilution method, according to the Clinical and Laboratory Standards Institute (CLSI) 2016 [10] standards for the determination of antibiotic susceptibility.
Of the isolates of P. intermedia (n = 10), P. nigrescens (n = 10), and P. melaninogenica (n = 10), 20%, 80%, and 30%, respectively, were resistant to AMX. No isolate of P. intermedia was resistant to AMC, TE, or CC. P. nigrescens and P. melaninogenica were resistant to 40% AMC and 20% TE. For MTZ, P. intermedia was resistant to a concentration of 30%, P. nigrescens to a concentration of 20%, and P. melaninogenica to a concentration of 40%. Finally, P. nigrescens was resistant to 50% CC and P. melaninogenica to 10% CC (Figure 1).
Table 3 shows a total of 30 Prevotella isolates and 10 isolates of each species. Different patterns of antibiotic resistance were also observed. For all species, 43.3% (n = 13) were resistant to β-lactam antibiotics such as AMX, and 26.6% (n = 8) were resistant to AMC. Additionally, 13.3% (n = 4) of the isolates were resistant to TE and 30% (n = 9) of the isolates were resistant to MTZ. For lincosamides, 20% (n = 6) of isolates were resistant to CC.
In the 30 Prevotella isolates evaluated, the inhibition range was 0.25–64 µg/mL for AMX; the minimum inhibitory concentration MIC50 was <0.5 µg/mL, while the MIC90 was 32 µg/mL. For AMC, the inhibition range was 0.25–64 µg/mL; the MIC50 was 1 µg/mL; and the MIC90 was 32 µg/mL. For TE, an inhibition range of 0.25–64 µg/mL was observed, the MIC50 was <2 µg/mL, and the MIC 90 was 16 µg/mL. For MTZ, the inhibition range was 0.25–64 µg/mL; the MIC50 was 1 µg/mL; and the MIC90 was >64 µg/mL. For CC, the inhibition range was 0.25–64 µg/mL; the MIC50 was 0.25 µg/mL; and the MIC90 > 64 µg/mL (Table 3).
2.3. Prevalence of Resistance Genes in P. intermedia, P. nigrescens, and P. melaninogenica
Table 4 shows the prevalence of resistance genes in the 30 isolates. Genes associated with resistance to β-lactam antibiotics (such as cfxA, cfxA2, and blaTEM), to tetracyclines (such as tetM and tetQ), to macrolides and CC (such as ermF), and to nitroimidazoles (such as nimAB and nimAEFI) were detected in isolates of P. intermedia, P. nigrescens, and P. melaninogenica. The most frequently detected genes were tetQ (in 43.3% of isolates), tetM (in 36.6% of isolates), blaTEM (in 26.6% of isolates), ermF (in 20% of isolates), cfxA, cfxA2, and nimAB (in 16.6% of isolates), and nimAEFI (in 3.3% of isolates).
In P. intermedia, the TE resistance genes tetQ and tetM were detected most frequently (40%), followed by blaTEM (20%) and nimAB (10%). However, cfxA, cfxA2, and nimAEFI were not detected. For P. nigrescens, tetQ was detected in 70% of isolates, cfxA, blaTEM and ermF in 40% of isolates, tetM and nimAB in 30% of isolates, and less frequently, cfxA2 in 10% of isolates. In P. melaninogenica, tetM and cfxA2 were detected most frequently (40%), followed by blaTEM, tetQ, and ermF (20%), and cfxA and nimAB (10%). nimAEFI was not detected.
The general frequency of resistance genes in the 162 isolates was analyzed and is included in the supplementary materials (Table S1).
2.4. Genotype–Phenotype Relationship of P. intermedia, P. nigrescens, and P. melaninogenica Isolates
The heatmap shows the genotype–phenotype relationships of the 30 isolates of Prevotella, and genes grouped by antibiotic class demarcated by gene names: cfxA, cfxA2, and blaTEM (β-lactam); TetM and TetQ (tetracyclines); ermF (macrolide-lincosamide); nimAB and nimAEFI (nitroimidazole). The different colors indicate: gene present and phenotype observed (red), gene present but phenotype not observed (orange), gene absent and phenotype observed (yellow), and gene absent and phenotype not observed (green) (Figure 2).
In this study, approximately 43.3% (13 out of 30) of the Prevotella isolates were simultaneously resistant to more than two antibiotics. Of the thirty isolates of Prevotella analyzed, a total of nine isolates did not show resistance to any of the antibiotics evaluated (30%), eight isolates were resistant to at least one antibiotic (26.6%), ten isolates showed resistance to at least two antibiotics (33.3%) and three were resistant to three antibiotics (10%).
P. intermedia showed a sensitive phenotype without genes associated with resistance, except for isolates 4 and 8, which presented a phenotype and genotype associated with resistance to beta-lactams and nitroimidazoles, respectively. Although isolates 9 and 10 did not present any resistance genes, they presented resistance to β-lactams and nitroimidazole.
In P. nigrescens, six of the ten isolates have genes for resistance to beta-lactams, tetracyclines, and lincosamides and they were alsoresistant to these antibiotics. They are indicated by a yellow profile, where resistant isolates predominate without the observed genotype. None of these isolates presented a phenotype resistant to nitroimidazoles.
Finally, in the isolates of P. melaninogenica, isolate 2 was the only one that did not present a resistant genotype and phenotype. Five species isolates have a beta-lactam and nitroimidazole resistant phenotype and genotype. In contrast, most of the isolates have a resistant phenotype for one of the three families of antibiotics evaluated, but do not present a genotype.
3. Discussion
The most frequently prescribed antibiotics in dentistry are beta-lactams, like penicillin, and amoxicillin. These antibiotics remain the most practical option to prescribe to adults for odontogenic infections. It is estimated that more than 75% of antimicrobial prescriptions are made inappropriately, and only about 50% of the patients take their medicines correctly. The widespread use of antimicrobial therapy, which is often unnecessary and inaccurate, may affect the development of microbial resistance [11].
This study investigated the extent of antibiotic susceptibility in Prevotella species isolated from the oral cavity, and the frequency of resistance genes present in these species. Prevotella species, members of the oral microbiota, are anaerobic and difficult to culture. In the 500 isolates analyzed, P. nigrescens was the most prevalent species, supporting previous work which isolated this species more frequently, followed by P. intermedia and P. melaninogenica [12,13,14]. However, the present study also detected other species at low frequencies, such as P. buccae, P. denticola, and P. disiens. These species are generally a part of the normal oral microbiota, and frequently participate in oral infections. In periodontal abscesses, 70% of the isolates corresponded to the genus Prevotella, and ermF, cfxA, and nim were frequently detected [12].
The results of the present study confirm that Prevotella could be an important reservoir of antibiotic resistance genes, such as cfxA, cfxA2, blaTEM, tetM, tetQ, ermF, and nim, which are associated with resistance to the antibiotics that are used as the first and second choices in dentistry, such as beta-lactams, macrolides, and lincosamides [4,15,16]. Additionally, the presence of these genes is related to the phenotypic results of antibiotic susceptibility.
Beta-lactamase production can be encoded by several genes, such as cfxA/cfxA2, cblA, cepA, cfiA, and blaTEM [11]. Different isolates with a resistant phenotype were presented, but they did not carry the evaluated genes. This resistance is likely mediated by other genes or allelic variants of the cfx gene, such as cfxA3 or cfxA6 [17], or other mechanisms that were not evaluated here. The antimicrobial resistance (AMR) phenotypic profiles with identified AMR genes also have been reported between the presence of ermF, and decreased susceptibility to azithromycin and resistance to clindamycin [18]. Isolates 3, 6, and 9 of P. nigrescens, presented a direct genotype–phenotype relationship due to the presence of the ermF gene and phenotypic resistance to clindamycin. (Figure 2).
Isolates with the presence of the evaluated genes and a sensitive phenotype were observed. These are considered essential targets, as antibiotic exposure could be a risk factor for transcribing these resistance-associated genes. These genes can be transferred to other bacteria through conjugative transposons that are activated in the presence of antibiotics. The use of antibiotics in clinical dental practice has increased, favoring the environmental pressure exerted by this increase. Antibiotic resistance among periodontal bacteria, such as Prevotella spp., needs to be monitored [2].
Antibiotic susceptibility was determined and correlated with resistance genes, and P. nigrescens was the species with the highest resistance to antibiotics such as AMX, AMC, and CC, compared to P. intermedia and P. melaninogenica [19,20]. In Colombia, Ardila et al. [21] evaluated antibiotic susceptibility to AMX, MTZ, and CC and found resistance in 35.5%, 26.6%, and 22.22% of P. intermedia/nigrescens isolates, respectively. The isolates were 100% sensitive to amoxycillin/clavulanic acid. However, antibiotic resistance in isolates of the genus Prevotella has increased, resulting in resistance to AMC. These results may be related to the high frequency of the antibiotic-resistant genes cfxA, cfxA2, and blaTEM, which have been detected in these species; these results are consistent with those reported in previous studies [22,23].
Only two isolates (heat map P.i-8 and P.m-7) of the thirty evaluated presented a phenotype and genotype resistant to metronidazole, which may be a good indicator of efficacy in current therapy. However, it is important to monitor those isolates with the genotype present and no resistance, and those that do not have the genotype present and are resistant to metronidazole, because this is the antibiotic of choice for infections involving anaerobic microorganisms.
Current evidence regarding antibiotic prescription for oral infectious processes is still scarce, limiting its management and favoring empirical prescription. Antibiotic resistance continues to be a public health problem [24]; it has increased in oral microorganisms to the extent that selective pressure is exerted at the genomic level in these species. Both in Colombia and worldwide, there are no epidemiological surveillance programs for antibiotic resistance in oral bacteria, and resistance continues to increase at an alarming rate.
This work constitutes one of the first advances in the current state of antibiotic resistance and gene frequency in species of the Prevotella genus in Colombia. It could serve as a basis for the future development of antibiotic management guidelines in dental practice for infections of odontogenic origin.
4. Materials and Methods
4.1. Population and Samples
In this study, we obtained 500 in vitro isolates of Prevotella spp; of these, 162 isolates correspond to P. intermedia, P. nigrescens, and P. melaninogenica. However, only 30 isolates were evaluated, 10 of each of the most frequent species in the oral cavity, since this genus is strictly anaerobic and, due to the rigor of the phenotypic method, it was not possible to include all of the isolates. All isolates come from the strain collection of the Oral Microbiology Laboratory of the Institute Unit of Oral Basic Investigation (UIBO). These were obtained from subgingival and other oral samples from patients who attended a consultation at the dental clinics of El Bosque University (Bogotá, Colombia).
4.2. Microbiological Cultures and Species Identification
Each isolate was grown in supplemented Brucella agar (0.3% Bacto agar, 0.2% yeast extract, 5% defibrinated sheep blood, 0.2% hemolyzed blood, 0.0005% hemin, and 0.00005% menadione (BBL Microbiology Systems, Cockeysville, MD, USA)) and incubated at 37 °C for 7 days under anaerobic conditions for the recovery of Prevotella spp. (Anaerogen, Oxoid, Hampshire, UK) [25].
4.3. Species Identification and Detection of Resistance Genes
P. intermedia, P. nigrescens, and P. melaninogenica were detected using a conventional PCR according to the recommendations of Ashimoto et al. [26]; the sequences of the primers are shown in Table 5.
The identification of each microorganism was confirmed by the presence of its amplification products on agarose gel electrophoresis at a concentration of 1.5% in Tris-acetate-EDTA (TAE) with 0.5 μg/mL of ethidium bromide. The bands were visualized using a transilluminator (Gel Doc XR+, BioRad) with ultraviolet light at 300 nm.
4.4. In Vitro Antibiotic Susceptibility Testing
For the determination of antibiotic susceptibility, the agar dilution method was used in this study, following the standards of the CLSI [10].
Supplemented Brucella agar (0.3% Bacto agar, 0.2% yeast extract, 5% defibrinated sheep blood, 0.2% hemolyzed blood, 0.0005% hemin, and 0.00005% menadione (BBB Microbiology Systems, Cockeysville, MD, USA)) was prepared with concentrations of antibiotics from 0.25, 0.5, 1, 2, 4, 8, 16, and 32 µg/mL up to 64 µg/mL. Antibiotics CC, TE, gentamicin, AMX, AMC, and MTZ were evaluated.
Isolates of P. intermedia, P. nigrescens, and P. melaninogenica were spectrophotometrically adjusted (λ = 620 nm) to a concentration of 1 × 108 bacteria/mL (optical density). These inocula were used to determine the MIC of each antibiotic evaluated in this study. Subsequently, the culture plates inoculated with each isolate in each of the different antibiotic concentrations were incubated at 37 °C for 7 days in anaerobiosis (Thermo Scientific: AnaeroGen Oxiod Ltd., Basingstoke, UK; Anaerobic indicator BR0055B, Oxiod Ltd., Basingstoke, UK). After incubation, MIC values for each antibiotic were evaluated in the P. intermedia, P. nigrescens, and P. melaninogenica isolates, with their respective dilutions. The first agar box with an antibiotic concentration at which no bacterial growth was observed was determined as the MIC. The reference strains B. fragilis ATCC 25285, P. intermedia ATCC 25611, P. nigrescens ATCC 33561, and P. melaninogenica ATCC 25845 were used as the internal controls.
4.5. Gene Detection
The presence of cfxA and cfxA2 was determined by conventional PCR, as previously described by Fosse et al. [27]. The blaTEM gene was detected according to the protocol specified by Ioannidis et al. [28]. To determine the presence of tetM and tetQ genes, the protocol specified by Lacroix et al. was used with some modifications [29,30]; the nimAB/AEFI gene was also identified using this method. The reaction occurred in a final volume of 25 µL, of which 5 µL corresponded to the sample and 20 µL to the reaction mixture containing 1X PCR buffer (1.0 mM KCl, 10 mM Tris-HCl (pH 9, 0 to 25 °C), 2.0 mM MgCl2, and 0.1% Triton® X-100); 0.04 IU Taq DNA polymerase (Promega, Madison, WI, USA); 1.5 mM MgCl2; 0.02 mM of each deoxyribonucleotide and 2 µM of each primer. To determine the presence of the ermF gene, the protocol described by Reig et al. [31] was implemented.
4.6. Statistical Analysis
Databases were built in Microsoft Office Professional Plus Excel 2013 and were used to calculate the frequencies of P. intermedia, P. nigrescens, and P. melaninogenica, the frequency of resistance genes, and antibiotic resistance (MIC 50 and MIC 90) to perform a descriptive analysis and express results in percentage data.
5. Conclusions
P. nigrescens was the species with the highest level of resistance to antibiotics such as AMC, AMX, and CC; it also possessed resistance genes at a higher frequency compared to P. intermedia and P. melaninogenica. AMX was the antibiotic to which the species were least susceptible; it was followed by AMC, CC, and MTZ. This information may be relevant for the management and treatment of oral infections caused by Prevotella.
Supplementary Materials
The following supporting information can be downloaded at: https://www.mdpi.com/article/10.3390/antibiotics11070888/s1, Table S1: Frequency of genes cfxA, cfxA2, blaTEM, tetM, tetQ, ermF, nimAB and nimAEFI in 162 oral isolates of P. intermedia, P. nigrescens, y P. melaninogenica
Author Contributions
Conceptualization, Y.C., N.A.D., Y.N., G.I.L. and D.M.C.; methodology, Y.C., N.A.D., Y.N., A.H., T.A., E.C., A.M. and D.M.C.; formal analysis, Y.C., N.A.D., Y.N., G.I.L. and D.M.C.; investigation, Y.C., N.A.D., Y.N., G.I.L. and D.M.C., data curation, Y.C., N.A.D., Y.N., G.I.L. and D.M.C.; writing—original draft preparation, Y.C., N.A.D., Y.N., G.I.L. and D.M.C.; writing—review and editing, Y.C., N.A.D., Y.N., G.I.L. and D.M.C.; project administration, D.M.C.; funding acquisition, Y.C. and D.M.C. All authors have read and agreed to the published version of the manuscript.
Funding
This study was funded by an IADR-División Colombia awardJohnson & Johnson, 2016 Bogotá, Colombia and Universidad El Bosque.
Institutional Review Board Statement
This study was carried out on clinical isolates stored in the UIBO Institute Oral Microbiology Laboratory strain collection. The strains were isolated from patients with different oral clinical conditions in previous studies at the UIBO Institute and were donated for studies of this type. As it is a research based on donated insulation, it does not require institutional ethics approval for this study specifically.
Informed Consent Statement
This study does not require informed consent, since it was carried out using bacteria stored in the strain collection of the Oral Microbiology Laboratory of the UIBO Institute.
Data Availability Statement
Not applicable.
Acknowledgments
We acknowledge Carlos Cruz, Alejandra Murillo, Camilo Sarmiento, Bibiana Vanessa, Diaztagle Cadena, Leidy Marcela Muñoz Gamboa, and students from the School of Dentistry for assisting in this study.
Conflicts of Interest
The authors declare no conflict of interest.
References
- Krom, B.P.; Kidwai, S.; Ten Cate, J.M. Candida and other fungal species: Forgotten players of healthy oral microbiota. J. Dent. Res. 2014, 93, 445–551. [Google Scholar] [CrossRef] [PubMed]
- Xie, Y.; Chen, J.; He, J.; Miao, X.; Xu, M.; Wu, X.; Xu, B.; Yu, L.; Zhang, W. Antimicrobial Resistance and Prevalence of Resistance Genes of Obligate Anaerobes Isolated From Periodontal Abscesses. J. Periodontol. 2014, 85, 327–334. [Google Scholar] [CrossRef] [PubMed]
- Lafaurie, G.I.; Contreras, A.; Barón, A.; Botero, J.; Mayorga-Fayad, I.; Jaramillo, A.; Giraldo, A.; González, F.; Mantilla, S.; Botero, A.; et al. Demographic, clinical, and microbial aspects of chronic and aggressive periodontitis in Colombia: A multicenter study. J. Periodontol. 2007, 78, 629–639. [Google Scholar] [CrossRef]
- Arredondo, A.; Blanc, V.; Mor, C.; Nart, J.; León, R. Azithromycin and erythromycin susceptibility and macrolide resistance genes in Prevotella from patients with periodontal disease. Oral Dis. 2019, 25, 860–867. [Google Scholar] [CrossRef] [PubMed]
- Bancescu, G.; Didilescu, A.; Bancescu, A.; Bari, M. Antibiotic susceptibility of 33 Prevotella strains isolated from Romanian patients with abscesses in head and neck spaces. Anaerobe 2015, 35, 41–44. [Google Scholar] [CrossRef] [PubMed]
- Dubreuil, L.; Veloo, A.C.; Sóki, J.; ESCMID Study Group for Anaerobic Infections (ESGAI). Correlation between antibiotic resistance and clinical outcome of anaerobic infections; mini-review. Anaerobe 2021, 72, 102463. [Google Scholar] [CrossRef] [PubMed]
- Veloo, A.C.; van Winkelhoff, A.J. Antibiotic susceptibility profiles of anaerobic pathogens in The Netherlands. Anaerobe 2015, 31, 19–24. [Google Scholar] [CrossRef]
- Arzese, A.R.; Tomasetig, L.; Botta, G.A. Detection of tetQ and ermF antibiotic resistance genes in Prevotella and Porphyromonas isolates from clinical specimens and resident microbiota of humans. J. Antimicrob. Chemother. 2000, 45, 577–582. [Google Scholar] [CrossRef] [Green Version]
- Alauzet, C.; Mory, F.; Teyssier, C.; Hallage, H.; Carlier, J.P.; Grollier, G.; Lozniewski, A. Metronidazole resistance in Prevotella spp. and description of a new nim gene in Prevotella baroniae. Antimicrob. Agents Chemother. 2010, 54, 60–64. [Google Scholar] [CrossRef] [Green Version]
- Clinical and Laboratory Standards Institute (CLSI). Performance Standards for Antimicrobial Susceptibility Testing, 26th ed.; CLSI Supplement M100S; Clinical and Laboratory Standards Institute: Wayne, PA, USA, 2016; ISBN 1–56238–923–8. [Google Scholar]
- De Lima, B.R.; Nicoloso, G.F.; Fatturi-Parolo, C.C.; Ferreira, M.B.C.; Montagner, F.; Casagrande, L. Prevotella strains and lactamic resistance gene distribution in different oral environments of children with pulp necrosis. Int. Endod. J. 2018, 51, 1196–1204. [Google Scholar] [CrossRef]
- Veloo, A.C.M.; Baas, W.H.; Haan, F.J.; Coco, J.; Rossen, J.W. Prevalence of antimicrobial resistance genes in Bacteroides spp. and Prevotella spp. Dutch clinical isolates. Clin. Microbiol. Infect. 2019, 25, 1156.e9–1156.e13. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Lie, M.A.; van der Weijden, G.A.; Timmerman, M.F.; Loos, B.G.; van Steenbergen, T.J.; van der Velden, U. Occurrence of Prevotella intermedia and Prevotella nigrescens in relation to gingivitis and gingival health. J. Clin. Periodontol. 2001, 28, 189–193. [Google Scholar] [CrossRef] [PubMed]
- Pianeta, R.; Iniesta, M.; Castillo, D.M.; Lafaurie, G.I.; Sanz, M.; Herrera, D. Characterization of the Subgingival Cultivable Microbiota in Patients with Different Stages of Periodontitis in Spain and Colombia. A Cross-Sectional Study. Microorganisms 2021, 9, 1940. [Google Scholar] [CrossRef] [PubMed]
- Toprak, N.U.; Akgul, O.; Sóki, J.; Soyletir, G.; Nagy, E. ESCMID Study Group for Anaerobic Infections (ESGAI). Detection of beta-lactamase production in clinical Prevotella species by MALDI-TOF MS method. Anaerobede 2020, 65, 102240. [Google Scholar] [CrossRef]
- Arredondo, A.; Blanc, V.; Mor, C.; Nart, J.; León, R. Resistance to β-lactams and distribution of β-lactam resistance genes in subgingival microbiota from Spanish patients with periodontitis. Clin. Oral Investig. 2020, 24, 4639–4648. [Google Scholar] [CrossRef]
- Binta, B.; Patel, M. Detection of cfxA2, cfxA3, and cfxA6 genes in beta-lactamase producing oral anaerobes. J. Appl. Oral Sci. 2016, 24, 142–147. [Google Scholar] [CrossRef] [Green Version]
- Webb, K.A.; Olagoke, O.; Baird, T.; Neill, J.; Pham, A.; Wells, T.J.; Ramsay, K.A.; Bell, S.C.; Sarovich, D.S.; Price, E.P. Genomic diversity and antimicrobial resistance of Prevotella species isolated from chronic lung disease airways. Microb. Genom. 2022, 8, 000754. [Google Scholar] [CrossRef]
- Kulik, E.M.; Lenkeit, K.; Chenaux, S.; Meyer, J. Antimicrobial susceptibility of periodontopathogenic bacteria. J. Antimicrob. Chemother. 2008, 61, 1087–1091. [Google Scholar] [CrossRef] [Green Version]
- Sanai, Y.; Persson, G.R.; Starr, J.R.; Luis, H.S.; Bernardo, M.; Leitao, J.; Roberts, M.C. Presence and antibiotic resistance of Porphyromonas gingivalis, Prevotella intermedia, and Prevotella nigrescens in children. J. Clin. Periodontol. 2002, 29, 929–934. [Google Scholar] [CrossRef]
- Ardila, C.M.; Granada, M.I.; Guzmán, I.C. Antibiotic resistance of subgingival species in chronic periodontitis patients. J. Perodont. Res. 2010, 45, 557–563. [Google Scholar] [CrossRef]
- Scornec, H.; Bellanger, X.; Guilloteau, H.; Groshenry, G.; Merlin, C. Inducibility of Tn916 conjugative transfer in Enterococcus faecalis by subinhibitory concentrations of ribosome-targeting antibiotics. J. Antimicrob. Chemother. 2017, 72, 2722–2728. [Google Scholar] [CrossRef] [PubMed]
- Fernández-Canigia, L.; Cejas, D.; Gutkind, G.; Radice, M. Detection and genetic characterization of β-lactamases in Prevotella intermedia and Prevotella nigrescens isolated from oral cavity infections and peritonsillar abscesses. Anaerobe 2015, 33, 8–13. [Google Scholar] [CrossRef] [PubMed]
- Haque, M.; Sartelli, M.; Haque, S.Z. Dental Infection and Resistance—Global Health Consequences. Dent. J. 2019, 7, 22. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Mayorga-Fayad, I.; Lafaurie, G.; Contreras, A.; Castillo, D.M.; Barón, A.; del Rosario, A.M. Microflora subgingival en periodontitis crónica y agresiva en Bogotá, Colombia: Un acercamiento epidemiológico. Biomédica 2007, 27, 21–33. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Ashimoto, A.; Chen, C.; Bakker, I.; Slots, J. Polymerase chain reaction detection of 8 putative periodontal pathogens in subgingival plaque of gingivitis and advanced periodontitis lesions. Oral Microbiol. Immunol. 1996, 11, 266–273. [Google Scholar] [CrossRef] [PubMed]
- Fosse, T.; Madinier, I.; Hannoun, L.; Giraud-Morin, C.; Hitzig, C.; Charbit, Y.; Ourang, S. High prevalence of cfxA β-lactamase in aminopenicillin-resistant Prevotella strains isolated from periodontal pockets. Oral Microbiol. Immunol. 2002, 17, 85–88. [Google Scholar] [CrossRef]
- Ioannidis, I.; Sakellari, D.; Spala, A.; Arsenakis, M.; Konstantinidis, A. Prevalence of tetM, tetQ, nim and bla TEM genes in the oral cavities of Greek subjects: A pilot study. J. Clin. Periodontol. 2009, 36, 569–574. [Google Scholar] [CrossRef]
- Lacroix, J.M.; Walker, C.B. Detection and incidence of the tetracycline resistance determinant tet(M) in the microflora associated with adult periodontitis. J. Periodontol. 1995, 66, 102–108. [Google Scholar] [CrossRef]
- Lacroix, J.M.; Walker, C.B. Detection and prevalence of the tetracycline resistance determinant tetQ in the microbiota associated with adult periodontitis. Oral Microbiol. Immunol. 1996, 11, 282–288. [Google Scholar] [CrossRef]
- Reig, M.; Galan, J.C.; Fernando Baquero, F.; Perez, J.C. Macrolide Resistance in Peptostreptococcus spp. Mediated by ermTR: Possible Source of Macrolide-Lincosamide-Streptogramin, B. Resistance in Streptococcus pyogenes. Antimicrob. Agents Chemother. 2001, 45, 630–632. [Google Scholar] [CrossRef] [Green Version]
Figure 1.
Frequency of resistance of Prevotella nigrescens, P. intermedia, and P. melaninogenica to the antibiotics evaluated.
Figure 1.
Frequency of resistance of Prevotella nigrescens, P. intermedia, and P. melaninogenica to the antibiotics evaluated.
Figure 2.
Heat map of the summary of the genotype–phenotype relationships of the P. intermedia, P. nigrescens, and P. melaninogenica isolates.
Figure 2.
Heat map of the summary of the genotype–phenotype relationships of the P. intermedia, P. nigrescens, and P. melaninogenica isolates.
Table 1.
Distribution of isolates by species and periodontal diagnosis.
| Healthy (%) | Gingivitis (%) | Periodontitis (%) | |
|---|---|---|---|
| P. melaninogenica | 40 | 30 | 30 |
| P. nigrescens | 10 | 40 | 50 |
| P. intermedia | 0 | 10 | 90 |
Table 2.
Global resistance and minimum inhibitory concentration (MIC) ranges, MIC50, and MIC90 against Prevotella nigrescens, P. intermedia, and P. melaninogenica.
Table 2.
Global resistance and minimum inhibitory concentration (MIC) ranges, MIC50, and MIC90 against Prevotella nigrescens, P. intermedia, and P. melaninogenica.
| Global Resistance | |||||
|---|---|---|---|---|---|
| Antibiotics | n | Range 1 (µg/mL) | MIC 50 2 (µg/mL) | MIC 90 3 (µg/mL) | R |
| n (%) | |||||
| AMX | 30 | <0.25–>64 | 0.5 | 32 | 13 (43.3) |
| AMC | 30 | <0.25–>64 | 1 | 16 | 8 (26.6) |
| TE | 30 | <0.25–>64 | 2 | 16 | 4 (13.3) |
| CC | 30 | <0.25–>64 | 0.25 | >64 | 6 (20) |
| MTZ | 30 | <0.25–>64 | 1 | >64 | 9 (30) |
AMX: amoxicillin; AMC: amoxicillin/clavulanic acid; TE: tetracycline; CC: clindamycin; MTZ: metronidazole. 1. Antimicrobial range in which inhibition was detected (µg/mL); 2. Minimum Inhibitory Concentration for 50% of isolates; 3. Minimum Inhibitory Concentration for 90% of isolates; S/R sensitivity and resistance range (µg/mL) according to the CLSI (Clinical & Laboratory Standards Institute, 2016) [10] for each antibiotic evaluated.
Table 3.
Minimum inhibitory concentration (MIC) ranges and MIC50 and MIC90 for the tested antimicrobial drugs against Prevotella nigrescens, P. intermedia, and P. melaninogenica in oral isolates.
Table 3.
Minimum inhibitory concentration (MIC) ranges and MIC50 and MIC90 for the tested antimicrobial drugs against Prevotella nigrescens, P. intermedia, and P. melaninogenica in oral isolates.
| Prevotella intermedia | |||||
| Antibiotics | n | Range 1 (µg/mL) | MIC 50 2 (µg/mL) | MIC 90 3 (µg/mL) | R |
| n (%) | |||||
| AMX | 10 | <0.25–8 | <0.25 | 4 | 2 (20) |
| AMC | 10 | <0.25–2 | <0.25 | 1 | 0 |
| TE | 10 | <0.25–4 | <0.25 | 4 | 0 |
| CC | 10 | <0.25–4 | <0.25 | 1 | 0 |
| MTZ | 10 | <0.25–>64 | 1 | >64 | 3 (30) |
| Prevotella nigrescens | |||||
| Antibiotics | n | Range 1 (µg/mL) | MIC 50 2 (µg/mL) | MIC 90 3 (µg/mL) | R |
| n (%) | |||||
| AMX | 10 | <0.25–>64 | 16 | 64 | 8 (80) |
| AMC | 10 | 0.5–>64 | 4 | 64 | 4 (40) |
| TE | 10 | <0.25–16 | 2 | 16 | 2 (20) |
| CC | 10 | <0.25–>64 | 1 | >64 | 5 (50) |
| MTZ | 10 | <0.25–64 | 1 | 32 | 2 (20) |
| Prevotella melaninogenica | |||||
| Antibiotics | n | Range 1 (µg/mL) | MIC 50 2 (µg/mL) | MIC 90 3 (µg/mL) | R |
| n (%) | |||||
| AMX | 10 | <0.25–32 | 0.25 | 16 | 3 (30) |
| AMC | 10 | <0.25–64 | 2 | 32 | 4 (40) |
| TE | 10 | <0.5–>64 | 2 | 64 | 2 (20) |
| CC | 10 | <0.25-64 | 0.25 | 1 | 1 (10) |
| MTZ | 10 | <0.25–>64 | 2 | >64 | 4 (40) |
AMX: amoxicillin; AMC: amoxicillin/clavulanic acid; TE: tetracycline; CC: clindamycin; MTZ: metronidazole. 1 Antimicrobial range in which inhibition was detected (µg/mL); 2 Minimum Inhibitory Concentration for 50% of isolates; 3 Minimum Inhibitory Concentration for 90% of isolates; S/R sensitivity and resistance range in (µg/mL) according to the CLSI (Clinical & Laboratory Standards Institute, 2016) [10] for each antibiotic evaluated.
Table 4.
Frequency of genes cfxA, cfxA2, blaTEM, tetM, tetQ, ermF, nimAB, and nimAEFI in 30 oral isolates of Prevotella intermedia, P. nigrescens, and P. melaninogenica.
Table 4.
Frequency of genes cfxA, cfxA2, blaTEM, tetM, tetQ, ermF, nimAB, and nimAEFI in 30 oral isolates of Prevotella intermedia, P. nigrescens, and P. melaninogenica.
| Bacteria | n | cfxA F (%) | cfxA2 F (%) | blaTEM F (%) | tetM F (%) | tetQ F (%) | nimAB F (%) | nimAEFI F (%) | ermF (%) |
|---|---|---|---|---|---|---|---|---|---|
| P. intermedia | 10 | 0 | 0 | 2 (20) | 4 (40) | 4 (40) | 1 (10) | 0 | 0 |
| P. nigrescens | 10 | 4 (40) | 1 (10) | 4 (40) | 3 (30) | 7 (70) | 3 (30) | 1 (10) | 4 (40) |
| P. melaninogenica | 10 | 1 (10) | 4 (40) | 2 (20) | 4 (40) | 2 (20) | 1 (10) | 0 | 2 (20) |
| Total | 30 | 5 (16, 6) | 5 (16, 6) | 8 (26, 6) | 11 (36, 6) | 13 (43, 3) | 5 (16, 6) | 1 (3, 3) | 6 (20) |
Table 5.
Primer sequences for detecting species and resistance genes.
| Gen | Sequence (5′→3′) | Amplicon Size (bp) | Reference |
|---|---|---|---|
| 16S—P. intermedia * | TTTGTTGGGGAGTAAAGCGGG TCAACATCTCTGTATCCTGCGT | 575 | [26] |
| 16S—P. nigrescens * | ATGAAACAAAGGTTTTCCGGTAAG CCCACGTCTCTGTGGGCTGCGA | 804 | [26] |
| 16S—P. melaninogenica * | TACAATGGAGAGTTTGATCC CGATCCTTGCGGTCACGGAC | 1453 | This study |
| cfxA ** | GCAAGTGCAGTTTAAGATT GCTTTAGTTTGCATTTTCATC | 934 | [27] |
| cfxA2 ** | CAAAGYGACAAYAATGCCTGCG TSACGAAGRCGGCWAT | 426 | [27] |
| BlaTEM † | ATGAGTATTCAACATTTCCG CCAATGCTTAATCAGTGAGG | 858 | [28] |
| tetM†† | GACACGCCAGGACATATGG TGCTTTCCTCTTGTTCGAG | 397 | [29] |
| tetQ ** | GGCTTCTACGACATCTATTA CATCAACATTTATCTCTCTG | 755 | [30] |
| ermF | TTTCGGGTCAGCACTTTACTA ACTTTCAGGACCTACCTCATA | 476 | [31] |
| nimAB†† | GGCTACAAGCAGCATGTC TGCATACTTTGCTCTTC | 377 | This study |
| nimAEFI†† | TGCATACTTTGCTCTTC ATGTTCAGAGAAATGCGGCG | 455 | This study |
* Species positive control: DNA of P. intermedia ATCC 25611, P. nigrescens ATCC 33561, and P. melaninogenica ATCC 25845. Positive gene controls: ** Bacteroides fragilis ATCC 25285 (cfxA, cfxA2, tetQ), † Escherichia coli ATCC 25922 (blaTEM), †† Fusobacterium nucleatum ATCC 25586 tetM, nimAB/AEFI; negative control: molecular grade water.
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
MDPI and ACS Style
Castillo, Y.; Delgadillo, N.A.; Neuta, Y.; Hernández, A.; Acevedo, T.; Cárdenas, E.; Montaño, A.; Lafaurie, G.I.; Castillo, D.M. Antibiotic Susceptibility and Resistance Genes in Oral Clinical Isolates of Prevotella intermedia, Prevotella nigrescens, and Prevotella melaninogenica. Antibiotics 2022, 11, 888. https://doi.org/10.3390/antibiotics11070888
AMA Style
Castillo Y, Delgadillo NA, Neuta Y, Hernández A, Acevedo T, Cárdenas E, Montaño A, Lafaurie GI, Castillo DM. Antibiotic Susceptibility and Resistance Genes in Oral Clinical Isolates of Prevotella intermedia, Prevotella nigrescens, and Prevotella melaninogenica. Antibiotics. 2022; 11(7):888. https://doi.org/10.3390/antibiotics11070888
Chicago/Turabian StyleCastillo, Yormaris, Nathaly Andrea Delgadillo, Yineth Neuta, Andrés Hernández, Tania Acevedo, Edwin Cárdenas, Andrea Montaño, Gloria Inés Lafaurie, and Diana Marcela Castillo. 2022. "Antibiotic Susceptibility and Resistance Genes in Oral Clinical Isolates of Prevotella intermedia, Prevotella nigrescens, and Prevotella melaninogenica" Antibiotics 11, no. 7: 888. https://doi.org/10.3390/antibiotics11070888
APA StyleCastillo, Y., Delgadillo, N. A., Neuta, Y., Hernández, A., Acevedo, T., Cárdenas, E., Montaño, A., Lafaurie, G. I., & Castillo, D. M. (2022). Antibiotic Susceptibility and Resistance Genes in Oral Clinical Isolates of Prevotella intermedia, Prevotella nigrescens, and Prevotella melaninogenica. Antibiotics, 11(7), 888. https://doi.org/10.3390/antibiotics11070888
Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.
