Next Article in Journal
Outcomes of Beta-Lactam Allergic and Non-Beta-Lactam Allergic Patients with Intra-Abdominal Infection: A Case–Control Study
Next Article in Special Issue
Antimicrobial Consumption in the Livestock Sector in Bhutan: Volumes, Values, Rates, and Trends for the Period 2017–2021
Previous Article in Journal
Effect of PAS-LuxR Family Regulators on the Secondary Metabolism of Streptomyces
Previous Article in Special Issue
Antibiotic Use in European Pig Production: Less Is More
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Antibiotics
Volume 11
Issue 12
10.3390/antibiotics11121784
antibiotics-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Protective Effects of Combined Utilization of Quercetin and Florfenicol on Acute Hepatopancreatic Necrosis Syndrome Infected Litopenaeus vannamei

by
Qianqian Zhai
1,2,
Zhiqiang Chang
1,2,
Jitao Li
1,2 and
Jian Li
1,2,*
1
Key Laboratory for Sustainable Utilization of Marine Fisheries Resources, Ministry of Agriculture and Rural Affairs, Yellow Sea Fisheries Research Institute, Chinese Academy of Fishery Sciences, Qingdao 266071, China
2
Function Laboratory for Marine Fisheries Science and Food Production Processes, Qingdao National Laboratory for Marine Science and Technology, Qingdao 266237, China
*
Author to whom correspondence should be addressed.
Antibiotics 2022, 11(12), 1784; https://doi.org/10.3390/antibiotics11121784
Submission received: 19 October 2022 / Revised: 3 December 2022 / Accepted: 7 December 2022 / Published: 9 December 2022
(This article belongs to the Special Issue Antibiotics Use in Farms)
Browse Figures
Versions Notes

Abstract

:
This study aimed to determine the immunity, survival rate, and disease resistance of Litopenaeus vannamei treated using quercetin and florfenicol alone or in combination, after infection with acute hepatopancreatic necrosis syndrome caused by Vibrio parahaemolyticus (VPAHPND). After infection with VPAHPND, different types of feed were given to the shrimp for 5 days, including a control diet (drug-free), florfenicol only diet (15 mg/kg), quercetin only diet (400 mg/kg), a low-dose florfenicol/quercetin combined diet (200 mg/kg quercetin + 7.0 mg/kg florfenicol), a moderate-dose florfenicol/quercetin combined diet (400 mg/kg quercetin + 15 mg/kg florfenicol), and a high-dose florfenicol/quercetin combined diet (800 mg/kg quercetin + 30 mg/kg florfenicol). The cumulative mortality of shrimp was significantly reduced in the drug combination groups compared with either drug used alone (p < 0.05). The density of Vibrio was significantly lower and the immune parameters were significantly increased in the drug combination groups compared with either drug used alone (p < 0.05). Moreover, in the drug combination groups, the hepatopancreas tubules showed better integrity and structure compared with those when either drug was used alone. Therefore, compared with single drug treatment, the florfenicol and quercetin combination enhanced disease resistance, survival, and immune activity of VPAHPND-infected shrimp. When the combination treatment is used, the dosage of florfenicol can be reduced and a better therapeutic effect is obtained.

1. Introduction

As the main aquacultured shrimp worldwide, Litopenaeus vannamei (Penaeus vannamei) is also the most produced shrimp in China [1,2]. However, L. vannamei is facing the threat of various large-scale bacterial and viral disease outbreaks because of the accelerated development of intensive farming, and the environmental destruction caused by it. For example, in recent years, shrimp production has been severely threatened by acute hepatopancreatic necrosis disease (AHPND), a new bacterial disease caused mainly by Vibrio parahaemolyticus (VPAHPND). VPAHPND cells contain Pir toxin-like proteins encoded by two genes (pirA- and pirB-like), whose activities cause severe mortality in farmed shrimp [3]. Studies have reported that AHPND causes damage to shrimp hepatopancreas cells via the proliferation of VPAHPND and Pir secretion into the shrimp’s stomach [4].
Up to now, the prevention and control of shrimp disease has employed a variety of methods, among which the most widely used and effective method is the use of antibiotics [5]. Antibiotic overuse can cause drug residues and environmental pollution, leading to the emergence of bacterial resistance [6,7]. There is increasing public concern about the overuse of antibiotics, prompting people to look for safer and more environmentally friendly drugs. Under these circumstances, traditional Chinese medicine has attracted attention because of its environmental friendliness and safety [8,9]. Moreover, the resources for Chinese traditional medicines are abundant and easy to obtain, and their content of active substances is rich [10,11]. Chinese herbal medicines and antibiotics work in different ways, such that their combinations can improve the treatment effect of various diseases and can decrease the emergence of antibiotic resistance [12]. Therefore, to produce an improved therapeutic effect and ameliorate the damage resulting from the use of large amounts of antibiotics, combinations of antibiotics and Chinese herbal medicines have become a research focus in recent years.
As a third generation of chloramphenicol antibiotic, florfenicol mainly exerts antibacterial effects by binding the bacterial 50 s ribosomal subunit [13]. Florfenicol is non-toxic, shows great antibacterial activity, and has few side effects; therefore, it is used widely to prevent and treat aquaculture animal diseases [14]. As a major class of phytochemicals (flavonoids), quercetin is found in high levels in fruits and vegetables, such as cherries, red grapes, apples, onions, broccoli, cabbage, kale, and tea [15,16,17]. Quercetin has many biological activities such as anti-inflammatory, antioxidant, anti-tumor, and immune activities [18,19]. Adding quercetin to the diets of aquaculture animals improved their immunity and antioxidant capacity [20,21,22]. Thus, aquaculture animals’ disease resistance could involve both florfenicol and quercetin. However, whether these two drugs in combination could increase shrimp disease resistance compared with either drug used alone, or allow the dose reduction of florfenicol, is not yet known.
Therefore, this study aimed to investigate the effect of the combination of florfenicol and quercetin on L. vannamei immunity, survival, and the morphology of the hepatopancreas after VPAHPND infection. We hope that our findings will provide a practical basis to treat bacterial diseases of aquaculture animals using combinations of antibiotics and Chinese herbal medicine.

2. Materials and Methods

2.1. Experimental Diets and Treatment

Qingdao Debon Pharmaceutical Company (Qingdao, China) provided florfenicol (purity ≥ 98%). Shanghai Yuanye Biological Technology Co., Ltd. (Shanghai, China) provided quercetin (purity > 98%).
Table 1 details the formulation of the control feed and various medicated (florfenicol and quercetin) feeds used in the experiment. To ensure the growth of L. vannamei, the basic diet contained 431 g/kg crude protein and 73 g/kg crude fat. Florfenicol and quercetin at various doses replaced cellulose in the feed in the following experimental groups: VPAHPND infection only group (0 mg/kg), quercetin only group (400 mg/kg), florfenicol only group (15 mg/kg), low-dose combination (LDC) group (200 mg/kg quercetin and 7.0 mg/kg florfenicol), moderate-dose combination (MDC) group (400 mg/kg quercetin and 15 mg/kg florfenicol), high-dose combination (HDC) group (800 mg/kg quercetin and 30 mg/kg florfenicol), and control group (0 mg/kg) [23,24,25]. The ingredients were ground and filtered through a 200 μm filter. Thereafter, the mixed powder was combined with tap water and fish oil to make a dough. Finally, a meat grinder was used to extrude the dough, which was heated for 30 min at 90 °C, dried without light, formed into pellets, and kept at −20 °C for subsequent experiments.

2.2. Bacterial Culture

L. vannamei displaying symptoms of AHPND, the source of the VPAHPND strain, (No. 20130629002S01) were kindly provided by Yellow Sea Fisheries Research Institute (Qingdao, China) and cultured as described previously [25]. The bacterial plate counting method was used to assess the bacterial abundance in the culture media. A final VPAHPND density of 107 CFU/mL was obtained by serial dilutions in PBS.

2.3. Experimental Animals

Qingdao Ruiz Group Co., Ltd., Qingdao, China, provided the experimental shrimp used in this study, which weighed 4.55 ± 0.26 g. Before the experiment, the shrimp were acclimated for one week in 200 L plastic reservoirs and fed with the basic diet, under controlled breeding environment conditions of pH 8.1 ± 0.1, water temperature 24 ± 0.5 °C, and salinity 33%.

2.4. Experiment Design and Sampling

The 1365 shrimp were divided into 3 batches. Batch 1 (350 shrimp) was divided into 7 experimental groups as defined in Section 2.1, with 50 shrimp in each group. The experiment was set up in three replicates. Except for the control group, the other 6 groups received 10 μL of VPAHPND intramuscularly at the concentration of 107 CFU/mL (the 24 h half lethal concentration). Then, all the groups received the appropriate feed (Table 2) immediately. At 0, 0.5, 1, 3, and 5 days post infection (dpi), we recorded the RPS of the drugs and the cumulative shrimp mortality rate. Batch 2 (105 shrimp) were divided into the same 7 groups (n = 15 per group). On the fifth dpi, the 7 groups of shrimp were anatomized to obtain their hepatopancreases. The hepatopancreas samples were subjected to fixation using Davidson solution before histological analysis. Batch 3 (210 shrimp) were split into the same 7 groups and used to assess the VPAHPND hepatopancreas density and to evaluate the immune parameters. From each group of shrimp, 6 were selected randomly at 0, 0.5, 1, 3, and 5 dpi, and pairs of shrimp were used as one specimen; therefore, at each sampling time there were 3 specimens in each group. A syringe containing anticoagulant was used to extract the shrimp hemolymph. The hemolymph was separated into 2 parts: one was used to calculate the total hemocyte count and the hemocyanin’s concentration; the other was centrifuged at 3000× g for 10 min to separate the hemocyte from the plasma. The obtained plasma was stored at −20 °C for later determination of the immune enzyme and antibacterial activities. The RNA was prepared from the obtained hemocyte using Trizol reagent for detecting immune-related gene expression.

2.5. Shrimp Survival Assay

The dead shrimp in each group were recorded at 0, 0.5, 1, 3, and 5 dpi. to calculate the cumulative mortality (%) and the (RPS, %) were calculated as described previously [25].

2.6. The Density of VPAHPND in Hepatopancreas

The obtained hepatopancreas from each group were ground in PBS in a sterile environment. Then, 100 μL of the ground hepatopancreas tissue solution was spread on a thiosulfate–citrate–bile-salt–sucrose (TCBS) agar plate, cultured at 28 °C for 24 h, and the colonies were counted to calculate the hepatopancreas VPAHPND density.

2.7. Immune Parameters Assessment

2.7.1. Total Hemocyte Counts

Under a light microscope, a hemocytometer was used to count the hemolymph cells mixed with the anticoagulant to calculate the total hemocyte count (THC, cells/mL hemolymph). The anticoagulant was formulated as Zhai et al. described [25].

2.7.2. Hemocyanin Determination

To determine the concentration of hemocyanin (HEM), 100 μL of the mixture of hemolymph and anticoagulant was mixed with 900 μL sterile water and measured according to the method used previously [25].

2.7.3. Antibacterial Activity

Bacterial colonies on solid medium were washed off using sterile PBS and collected. The technique of Hultmark et al. was used to determine the antibacterial activity of the hemolymph [26].

2.7.4. Activities of Immunity-Related Enzymes

The shrimp acellular hemolymph phenol oxidase (PO) activity was determined according to a previously reported method [27]. Superoxide dismutase (SOD), glutathione peroxidase (GSH-Px), iysozyme (LZM), alkaline phosphatase (AKP) and acid phosphatase (ACP) activities were measured using commercial kits (Institute of Biological Engineering, Nanjing, China). The Bradford method was used to determine the protein content in hemolymph.

2.7.5. Expression of Immunity-Related Genes

Total hemocyte RNA was isolated and a real-time PCR was performed to detect expression of immunity-associated genes including Tlr (encoding toll-like receptor), Lzm, Lec (encoding lectin), Cru (encoding crustin), CatB (encoding cathepsin B), and Alf (encoding anti-lipopolysaccharide factor) as described previously [28]. The primers for PCR are listed in Table 2.

2.8. HE Staining

After fixing in Davidson solution for 24 h, the hepatopancreases were transferred into 70% ethanol. Paraffin-embedded hepatopancreas was sliced into sections of 5 μm thickness and used for HE staining. The histological changes were observed under a light microscope (Olympus BX60, Olympus, Tokyo, Japan).

2.9. Statistical Analysis

The data are expressed in the form of the mean ± SD. SPSS 19.0 (IBM Corp., Armonk, NY, USA) was used for the statistical analysis of the data. One-way analysis of variance (ANOVA) and Duncan’s multiple range test were used to analyze the significant differences among different groups. The main effects of florfenicol and quercetin and their combinations in terms of immune parameters, Vibrio density, protection ratio, and cumulative mortality were assessed using two-way ANOVA.

3. Results

3.1. Survival and RPS of Shrimp

During the experiments, the control shrimp showed no disease symptoms. The florfenicol and quercetin only groups showed higher survival than the VPAHPND infection only group (p < 0.05; Figure 1). The shrimp survival rates and RPS of the drug combination groups were higher than those after treatment with either drug alone (p < 0.05; Figure 1). Moreover, the survival rate and RPS increased drug dose-dependently.

3.2. Hepatopancreatic VPAHPND Clearance

The VPAHPND density in the hepatopancreas of the infection only, florfenicol, quercetin, LDC, MDC, and HDC groups decreased by 24.65%, 31.07%, 37.35%, 44.59%, 52.38%, and 55.74% respectively at 0.5 dpi, and decreased by 47.75%, 52.27%, 58.59%, 65.80%, 71.83%, and 76.94%, respectively, at 1 dpi. At 3 dpi, the hepatopancreatic VPAHPND density of the infection only, florfenicol, quercetin, LDC, MDC, and HDC groups decreased to 30.63, 26.47, 19.42, 15.32, 8.46, and 5.97 × 105 CFU/mL, respectively. At 5 dpi, VPAHPND was almost completely cleared from the shrimp hepatopancreas in the MDC and HDC groups (Figure 2).

3.3. THC and HEM Levels and Antimicrobial Activity in Shrimp

At 0.5 dpi, the THC level reached its lowest value in the VPAHPND infection only group. During the experiment, the THC levels in the infection only group, florfenicol only group, and quercetin only group were always significantly lower than those in the control group. In the drug combination groups, the THC level showed a gradually increasing trend, approaching the level of the control group at the end of the experiment. Moreover, significantly lower THC levels were observed in the infection only group, the florfenicol only group, and the quercetin only group than those in the drug combination groups (Figure 3A). The shrimp HEM concentration showed a trend of first increasing and then decreasing over the course of the experiment, being the highest at 1 dpi. In the drug combination groups, the HEM concentration was significantly higher than that in the infection only group, the florfenicol group, and the quercetin group. Moreover, in the drug combination groups, the HEM levels increased dose-dependently (Figure 3B). In all experimental groups, the antibacterial activity in shrimp was highest at 0.5 and 1 dpi, and then decreased gradually. However, significantly higher antibacterial activities were observed in the drug combination groups than those in the infection only group, the florfenicol only group, and the quercetin only group throughout the experimental period (Figure 3C).

3.4. Immunity-Related Enzyme Activities in Acellular Hemolymph

Compared with that in the control group, the PO activity in all the groups decreased after VPAHPND infection. The drug combination groups showed higher PO activities than those in the infection only group, the florfenicol only group, and the quercetin only group. Moreover, in the drug combination groups, the PO activity increased dose-dependently (Figure 4A). After feeding with the drug-containing diets, significantly higher activities of SOD, GSH-Px, and LZM were observed in the drug combination groups compared with those in the infection only group, the florfenicol only group, and the quercetin only group (p < 0.05), and their activities also increased with increased drug doses (Figure 4B–D). In all the drug treatment groups, the activities of AKP and ACP peaked at 0.5 and 1 dpi, respectively. In the infection only group and the control group, the activities of ACP and AKP were similar at 3 and 5 dpi, respectively (p > 0.05; Figure 4E,F). However, compared with those in the control and infection only groups, higher ACP and AKP activities were observed in the drug treatment groups (p < 0.05). Furthermore, in the drug combination groups, the activities of ACP and AKP were higher compared with those after treatment with either drug alone, and the increase was drug dose-dependent.

3.5. Immunity-Related Gene Expression Profiles in Hemocytes

At all experimental time points, Alf and Cru expression levels in hemocytes increased, peaking at 1 dpi. Alf and Cru expression levels were significantly higher in the drug combination groups compared with those after treatment with either drug alone throughout the experimental period (p < 0.05; Figure 5A,C). Except in the control group, the expression level of CatB in hemocytes increased in all the experimental groups. Moreover, in the drug combination groups, CatB expression was significantly higher than in the florfenicol and quercetin only groups (p < 0.05; Figure 5B). Lec expression in the drug treatment groups was significantly higher than that in the control group at all experimental time points, except that Lec expression in the florfenicol only group did not differ significantly from that in the control group at 5 dpi (p < 0.05; Figure 5D). From 0.5 to 3 dpi, the expression level of Lzm in all experimental groups increased significantly. Except in the drug combination groups, the expression of Lzm in the remaining experimental groups decreased to the level of the control group by 5 dpi (p < 0.05; Figure 5E). Tlr expression showed a trend of first decreasing and then increasing, reaching a peak at 5 dpi (Figure 5F). In addition, at all experimental time points, the expression levels of Lec, Lzm, and Tlr were significantly higher in the drug combination groups than in the florfenicol only and quercetin only groups.

3.6. Analysis of the Hepatopancreas Histology

VPAHPND infection disrupted the structural integrity of the hepatopancreatic tubules in comparison with that in the control group, accompanied by massive shedding and rupture of hepatopancreatic tubules epithelial cells. The use of either drug alone improved the hepatopancreatic tubules’ structural integrity, and increased the number of the epithelial cells in intact hepatopancreatic tubules. The combined drug treatment improved the structure of the hepatopancreas tubules to a greater extent than either drug alone, and showed combined drug dose-dependency (Figure 6).
Moreover, for the immune parameters, Vibrio density, RPS, and cumulative mortality, we observed significant interactions (p < 0.05) between florfenicol and quercetin in shrimp (Table 3).

4. Discussion

Virulent strains of VPAHPND contain a 70 kbp plasmid (pVA1) that encodes a homolog of photorhabdus insect-associated (Pir) toxins PirA and PirB [3,5]. The Pir toxin secreted by VPAHPND can damage shrimp hepatopancreatic cells [29]. VPAHPND infection causes hepatopancreatic epithelial cells to be exfoliated or become necrotic, leading to shrimp hepatopancreatic atrophy, which is mostly fatal to shrimp [30].
For a long time, antibiotics have been the most commonly used method to treat bacterial infections in shrimp aquaculture. Unfortunately, the long-term, high-level use of antibiotics has led to drug residues and drug resistance. However, the combined use of traditional Chinese medicine with antibiotics, could not only reduce the problems caused by antibiotics, but also can enhance the immunity of the animals.
In the human diet, the main source of antioxidants is plant flavonoids which have various biological functions, such as anticancer, anti-inflammatory, and antibacterial abilities [31]. As a lipophilic compound, quercetin exists mainly in various fruit and vegetables in a glycosylated form, and is the most common flavonoid in human food [32]. In addition to its anticancer, antiviral, antibacterial, and anti-inflammatory effects, quercetin also has good antioxidant activity and free radical scavenging effects [33]. Previous studies have shown that quercetin is closely related to immune responses and disease resistance in aquatic animals [20,21,22]. Therefore, in this study, the anti-infective effect of quercetin combined with florfenicol in VPAHPND-infected L. vannamei was evaluated, and the combined effect of the two drugs was compared with the effect of quercetin or florfenicol used alone.
Accordingly, feeding shrimp with a diet containing quercetin and florfenicol effectively reduced the cumulative mortality of L. vannamei infected with VPAHPND. Moreover, quercetin and florfenicol in combination was more effective than either drug used alone. Flavonoids can enhance the immunity and resistance to infection of animals [22]. Therefore, the above results might reflect the antibacterial function of quercetin and its non-specific immunity enhancement in L. vannamei.
As invertebrates, shrimp rely mainly on humoral and cellular innate immunity to recognize and kill invading pathogens [34,35]. In this study, we observed that the clearance rate of VPAHPND was higher in the drug combination groups and the florfenicol and quercetin alone groups than that in the infection only group. Moreover, the drug combination groups had the best effect among all the treatment groups, indicating that a diet comprising quercetin combined with florfenicol resulted in improved shrimp resistance to VPAHPND infection, which might benefit from the antibacterial activity of florfenicol and the immunological activity of quercetin.
In shrimp that have been exposed to infectious pathogens, the risk of secondary infection might be increased by decreased THC levels [36]. Our results revealed a quercetin and florfenicol combination-mediated increase in shrimp THC levels. The increase in the THC level indicated enhanced disease resistance of shrimp, suggesting that quercetin might enhance the immunity of shrimp by promoting the proliferation and phagocytosis of hemocytes in shrimp. Similar results were observed for THC levels when Sargasso polysaccharide was fed to Fenneropenaeus chinensis and polysaccharides derived from Durio zibethinus were fed to giant tiger shrimp [37,38].
HEM enhances the defense ability of shrimp against pathogens with its antibacterial and antiviral activities [39]. Previous research showed that the concentration of HEM decreased after shrimp were infected with pathogens [40]. In this study, the HEM level in the drug combination groups was markedly higher than those in the groups treated with either drug alone; therefore, the drug combination could significantly enhance the ability of shrimp to resist pathogenic infection.
The antimicrobial peptides contained in the hemolymph of shrimp have antibacterial activity. An increased antimicrobial peptide content can enhance the shrimp’s ability to resist pathogenic infection [41]. In this study we found that, compared with the infection only group, the antibacterial activities in the drug treatment groups were significantly higher. More importantly, the drug combination groups showed significantly higher antibacterial activity compared with those in the groups treated with either drug alone. This means that the drug combination induced higher antibacterial activity in shrimp.
The main immune-related enzymes in shrimp are PO, SOD, GSH-Px, LZM, ACP, and AKP. Previous studies showed that, after infection with Vibrio alginolyticus, the PO activity in shrimp first decreased and then gradually returned to normal levels, and the PO activity in VPAHPND-infected shrimp showed a similar trend in this study [42]. In addition, a previous study found that the levels of SOD and GSH-Px in shrimp were significantly increased after L. vannamei were infected with WSSV [43]. The activity of LZM in shrimp increased significantly after Portunus trituberculatus were infected with Vibrio alginolyticus, and the activities of ACP and AKP were elevated after Exopalaemon carinicauda were infected with WSSV [44]. The above studies showed that immune-related enzymes in shrimp play an important role in responding to pathogenic infections. Our study showed that the activities of the six enzymes were higher in the LDC group than in the groups treated with either drug alone, indicating that, under the premise of achieving better therapeutic effects, the use of the florfenicol could be reduced when quercetin and florfenicol were used in combination.
The activation of an innate immune response is marked by the pattern recognition receptors (PRRs) recognizing pathogens [45]. As an important PRR, lectin can enhance the phagocytic activity of hemocytes and the agglutination reaction of bacteria resulting from the invasion of VPAHPND [46,47]. In this study, Lec expression increased in shrimp hemocytes post VPAHPND infection. Moreover, the Lec level in the groups treated with the combined drugs was significantly higher than that in the groups treated with either drug alone, which indicated that the shrimp in the drug combination groups had stronger disease resistance. In invertebrate innate immunity, the Toll signaling pathway is the most important signaling pathway that participates in pathogen identification and defense. The transmembrane glycoprotein, TLR, is an important functional factor in the Toll signaling pathway. In innate immunity, the PRR TLR plays an important role in the identification of pathogens in innate immunity. As a transmembrane glycoprotein, TLR has a transmembrane domain and an extracellular N-terminal region that is rich in leucine repeat sequences (LRRs). LRRs recognize pathogen-related molecular patterns (PAMPs), while the intracellular C-terminus contains a Toll/interleukin-1 receptor (TIR) domain that is required for downstream signal transduction [48,49]. ALF, crustin, and LZM are important AMPs with broad-spectrum antimicrobial effects [50,51,52]. Thus, TLR, ALF, crustin, and LZM all play important roles in shrimp pathogen resistance. Interestingly, the expression levels of Tlr, Alf, Cru, and Lzm in the drug combination groups were higher than those in the groups treated with either drug alone. CatB is a cathepsin and is involved in antigen processing in antigen-presenting cells [53,54]. A previous study showed that the CatB expression in WSSV-infected F. chinensis increased [55]. In this study, hemocyte CatB expression was also upregulated after L. vannamei infection with VPAHPND. Moreover, CatB expression in the drug combination groups exceeded that in the groups treated with either drug alone, which meant that the drug combination groups have higher anti-infection ability.
The shrimp’s hepatopancreas is VPAHPND’s target organ. After infection with VPAHPND, the hepatopancreatic tubule epithelial cells are ruptured, and their nuclei become deformed, condensed, or disappear. The hepatopancreas will undergo diffuse necrosis, eventually leading to hepatopancreatic atrophy with VPAHPND infection [4,56]. Herein, we demonstrated an improved hepatopancreatic structure in the shrimp treated with the drugs compared with those only infected with VPAHPND. Moreover, the hepatopancreatic structure showed more improvement in the drug combination groups than in the groups treated with either drug alone. This indicated that shrimp resistance to VPAHPN was enhanced by treatment with the drugs in combination. This might be related to the antibacterial activity and immune enhancement function of quercetin.

5. Conclusions

In conclusion, compared with florfenicol or quercetin used alone, the combined use of the two drugs significantly improved the survival rate, drug protection, bacterial clearance, and immune parameters including the antibacterial actions, as well as the THC and HEM levels, the GSH-Px, PO, SOD, LZM, ACP, and AKP enzyme activities in the hemolymph, and the Alf, CatB, Cru, Lec, and Lzm mRNA expression in L. vannamei hemocytes within 5 dpi. The hepatopancreas histology was also improved in the drug combination groups. Moreover, florfenicol and quercetin interacted significantly, affecting the above indicators. The results showed that shrimp disease resistance improved when florfenicol and quercetin were used in combination. Therefore, under the premise of obtaining better therapeutic effects, a combination with quercetin can reduce the use of florfenicol and reduce antibiotic pollution in shrimp and the environment, thereby decreasing the occurrence of drug resistance.

Author Contributions

Data curation, Q.Z.; Formal analysis, Q.Z.; Funding acquisition, Q.Z. and J.L. (Jian Li); Investigation, Q.Z.; Methodology, Q.Z., Z.C. and J.L. (Jitao Li); Resources, Q.Z., Z.C., J.L. (Jitao Li) and J.L. (Jian Li); Supervision, J.L. (Jian Li); Writing—original draft, Q.Z.; Writing—review and editing, Z.C., J.L. (Jitao Li) and J.L. (Jian Li). All authors have read and agreed to the published version of the manuscript.

Funding

This work was supported by the National Natural Science Foundation of China (grant number 32102845); the National Key R & D Program of China (grant number 2019YFD0900403); the Natural Science Foundation of Shandong Province, P. R. China (grant number ZR2019QC015); the China Agriculture Research System of MOF and MARA (grant number CARS-48); and the Central Public-interest Scientific Institution Basal Research Fund, CAFS (grant numbers 2020TD46 and 2021GH05).

Institutional Review Board Statement

The study was conducted in accordance with the Declaration of Helsinki, and Approved by the Ethics Committee of the Yellow Sea Fisheries Research Institute, Chinese Academy of Fishery Sciences.

Informed Consent Statement

Not applicable.

Data Availability Statement

Not applicable.

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. Li, F.H.; Xiang, J.H. Signaling pathways regulating innate immune responses in shrimp. Fish Shellfish Immunol. 2013, 34, 973–980. [Google Scholar] [CrossRef]
  2. MOA (Fisheries Bureau, Ministry of Agriculture). China Fishery Statistics Yearbook 2021; China Agriculture Press: Beijing, China, 2021; pp. 21–36. [Google Scholar]
  3. Han, J.E.; Tang, K.F.; Tran, L.H.; Lightner, D.V. Photorhabdus insect-related (Pir) toxin-like genes in a plasmid of Vibrio parahaemolyticus, the causative agent of acute hepatopancreatic necrosis disease (AHPND) of shrimp. Dis. Aquat. Org. 2015, 113, 33–40. [Google Scholar] [CrossRef] [Green Version]
  4. Tran, L.; Nunan, L.; Redman, R.M.; Mohney, L.L.; Pantoja, C.R.; Fitzsimmons, K.; Lightner, D.V. Determination of the infectious nature of the agent of acute hepatopancreatic necrosis syndrome affecting penaeid shrimp. Dis. Aquat. Org. 2013, 105, 45–55. [Google Scholar] [CrossRef] [PubMed]
  5. Rico, A.; Phu, T.M.; Satapornvanit, K.; Min, J.; Shahabuddin, A.M.; Henriksson, P.J.G.; Murray, F.J.; Little, D.C.; Dalsgaard, A.; Van den Brink, P.J. Use of veterinary medicines, feed additives and probiotics in four major internationally traded aquaculture species farmed in Asia. Aquaculture 2013, 412–413, 231–243. [Google Scholar] [CrossRef] [Green Version]
  6. Reilly, A.; Käferstein, F. Food safety hazards and the application of the principles of the hazard analysis and critical control point (HACCP) system for their control in aquaculture production. Aquac. Res. 1997, 28, 735–752. [Google Scholar] [CrossRef]
  7. Harikrishnan, R.; Balasundaram, C.; Dharaneedharan, S.; Moon, Y.G.; Kim, M.C.; Kim, J.S.; Heo, M.S. Effect of plant active compounds on immune response and disease resistance in Cirrhina mrigala infected with fungal fish pathogen, Aphanomyces invadans. Aquac. Res. 2009, 40, 1170–1181. [Google Scholar] [CrossRef]
  8. Chang, J. Medicinal herbs: Drugs or dietary supplements? Biochem. Pharmacol. 2000, 59, 211–219. [Google Scholar] [CrossRef] [PubMed]
  9. Sivaram, V.; Babu, M.M.; Immanuel, G.; Murugadass, S.; Citarasu, T.; Marian, M.P. Growth and immune response of juvenile greasy groupers (Epinephelus tauvina) fed with herbal antibacterial active principle supplemented diets against Vibrio harveyi infections. Aquaculture 2004, 237, 9–20. [Google Scholar] [CrossRef]
  10. Bulfon, C.; Volpatti, D.; Galeotti, M. Current research on the use of plant-derived products in farmed fish. Aquac. Res. 2015, 46, 513–551. [Google Scholar] [CrossRef]
  11. Awad, E.; Awaad, A. Role of medicinal plants on growth performance and immune status in fish. Fish Shellfish Immunol. 2017, 67, 40–54. [Google Scholar] [CrossRef]
  12. Fitzgerald, J.B.; Schoeberl, B.; Nielsen, U.B.; Sorger, P.K. Systems biology and combination therapy in the quest for clinical efficacy. Nat. Chem. Biol. 2006, 2, 458–466. [Google Scholar] [CrossRef]
  13. Plumb, D. Florfenicol, in Plumb D (Ed.): Veterinary Drug Handbook, 5th ed.; Iowa State Press: Ames, IA, USA, 2004; pp. 335–336. [Google Scholar]
  14. Gaunt, P.; Endris, R.; Khoo, L.; Leard, A.T.; Jack, S.; Santucci, T.; Katz, T.; Radecki, S.V.; Simmons, R. Preliminary Assessment of the Tolerance and Efficacy of Florfenicol against Edwardsiella ictaluri Administered in Feed to Channel Catfish. J. Aquat. Anim. Health 2003, 15, 239–247. [Google Scholar] [CrossRef]
  15. Anand David, A.V.; Arulmoli, R.; Parasuraman, S. Overviews of Biological Importance of Quercetin: A Bioactive Flavonoid. Pharmacogn. Rev. 2016, 10, 84–89. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  16. Almeida, A.F.; Borge, G.I.A.; Piskula, M.; Tudose, A.; Tudoreanu, L.; Valentova, K.; Williamson, G.; Santos, C.N. Bioavailability of Quercetin in Humans with a Focus on Interindividual Variation. Compr. Rev. Food Sci. Food Saf. 2018, 17, 714–731. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  17. Rauf, A.; Imran, M.; Khan, I.A.; Ur-Rehman, M.; Gilani, S.A.; Mehmood, Z.; Mubarak, M.S. Anticancer potential of quercetin: A comprehensive review. Phytother. Res. 2018, 32, 2109–2130. [Google Scholar] [CrossRef] [PubMed]
  18. Crespo, I.; García-Mediavilla, M.V.; Gutiérrez, B.; Sánchez-Campos, S.; Tuñón, M.J.; González-Gallego, J. A comparison of the effects of kaempferol and quercetin on cytokine-induced pro-inflammatory status of cultured human endothelial cells. Br. J. Nutr. 2008, 100, 968–976. [Google Scholar] [CrossRef] [Green Version]
  19. Xu, D.; Hu, M.J.; Wang, Y.Q.; Cui, Y.L. Antioxidant Activities of Quercetin and Its Complexes for Medicinal Application. Molecules 2019, 24, 1123. [Google Scholar] [CrossRef] [Green Version]
  20. Bhattacharjee, P.; Borah, A.; Das, S. Quercetin-induced amelioration of deltamethrin stress in freshwater teleost, Channa punctata: Multiple biomarker analysis. Comp. Biochem. Phys. C 2020, 227, 108626. [Google Scholar] [CrossRef]
  21. Sahoo, P.K.; Pradhan, L.K.; Aparna, S.; Agarwal, K.; Banerjee, A.; Das, S.K. Quercetin abrogates bisphenol A induced altered neurobehavioral response and oxidative stress in zebrafish by modulating brain antioxidant defence system. Environ. Toxicol. Phar. 2020, 80, 103483. [Google Scholar] [CrossRef]
  22. Wang, J.H.; Zhang, C.N.; Zhang, J.L.; Xie, J.; Xing, Y.F.; Li, Z.F. The effects of quercetin on immunity, antioxidant indices, and disease resistance in zebrafish (Danio rerio). Fish Physiol. Biochem. 2020, 46, 759–770. [Google Scholar] [CrossRef]
  23. ADCC (Agriculture Department Compiling Committee). Handbook of Fishery Drugs; China Agriculture Press: Beijing, China, 2005; pp. 208–209. (In Chinese) [Google Scholar]
  24. Li, J.; Liu, S.L.; Shi, Q.C.; Zhai, S.W. Effects of dietary quercetin on growth performance, serum biochemical indices, non-specific immune indices of Juvenile Tilapia (GIFT Oreochromis niloticus). Feed Ind. 2014, 35, 21–25. (In Chinese) [Google Scholar] [CrossRef]
  25. Zhai, Q.Q.; Chang, Z.Q.; Li, J.T.; Li, J. Effects of combined florfenicol and chlorogenic acid to treat acute hepatopancreatic necrosis disease in Litopenaeus vannamei caused by Vibrio parahaemolyticus. Aquaculture 2022, 47, 737462. [Google Scholar] [CrossRef]
  26. Hultmark, D.; Steiner, H.; Rasmuson, T.; Boman, H.G. Insect immunity. Purification and properties of three inducible bactericidal proteins from hemolymph of immunized pupae of Hyalophora cecropia. Eur. J. Biochem. 1980, 106, 7–16. [Google Scholar] [CrossRef] [PubMed]
  27. Ji, P.F.; Yao, C.L.; Wang, Z.Y. Immune response and gene expression in shrimp (Litopenaeus vannamei) hemocytes and hepatopancreas against some pathogen-associated molecular patterns. Fish Shellfish Immunol. 2009, 27, 563–570. [Google Scholar] [CrossRef] [PubMed]
  28. Zhai, Q.Q.; Li, J. Effectiveness of traditional Chinese herbal medicine, San-Huang-San, in combination with enrofloxacin to treat AHPND-causing strain of Vibrio parahaemolyticus infection in Litopenaeus vannamei. Fish Shellfish Immunol. 2019, 87, 360–370. [Google Scholar] [CrossRef] [PubMed]
  29. Lee, C.T.; Chen, I.T.; Yang, Y.T.; Ko, T.P.; Huang, Y.T.; Huang, J.Y.; Huang, M.F.; Lin, S.J.; Chen, C.Y.; Lin, S.S.; et al. The opportunistic marine pathogen Vibrio parahaemolyticus becomes virulent by acquiring a plasmid that expresses a deadly toxin. Proc. Natl. Acad. Sci. USA 2015, 112, 10798–10803. [Google Scholar] [CrossRef] [Green Version]
  30. Lai, H.C.; Ng, T.H.; Ando, M.; Lee, C.T.; Chen, I.T.; Chuang, J.C.; Mavichak, R.; Chang, S.H.; Yeh, M.D.; Chiang, Y.A. Pathogenesis of acute hepatopancreatic necrosis disease (AHPND) in shrimp. Fish Shellfish Immunol. 2015, 47, 1006–1014. [Google Scholar] [CrossRef]
  31. Umbetova, A.K.; Beyatli, A.; Seitimova, G.A.; Yeskaliyeva, B.K.; Burasheva, G.S. Flavonoids from the Plant Atraphaxis virgata. Chem. Nat. Compd. 2021, 57, 531–533. [Google Scholar] [CrossRef]
  32. Ozga, J.A.; Saeed, A.; Wismer, W.; Reinecke, D.M. Characterization of cyanidin- and quercetin-derived flavonoids and other phenolics in mature Saskatoon fruits (Amelanchier alnifoliaNutt.). J. Agric. Food Chem. 2007, 55, 10414–10424. [Google Scholar] [CrossRef]
  33. Kelly, G.S. Quercetin. Monograph. Altern. Med. Rev. 2011, 16, 172–194. [Google Scholar]
  34. Wang, X.W.; Wang, J.X. Diversity and multiple functions of lectins in shrimp immunity. Dev. Comp. Immunol. 2013, 39, 27–38. [Google Scholar] [CrossRef] [PubMed]
  35. Tassanakajon, A.; Rimphanitchayakit, V.; Visetnan, S.; Amparyup, P.; Somboonwiwat, K.; Charoensapsri, W.; Tang, S. Shrimp humoral responses against pathogens: Antimicrobial peptides and melanization. Dev. Comp. Immunol. 2018, 80, 81–93. [Google Scholar] [CrossRef] [PubMed]
  36. Ge, Q.Q.; Li, J.; Li, J.T.; Wang, J.J.; Li, Z.D. Immune response of Exopalaemon carinicauda infected with an AHPND-causing strain of Vibrio parahaemolyticus. Fish Shellfish Immunol. 2018, 74, 223–234. [Google Scholar] [CrossRef] [PubMed]
  37. Huang, X.; Zhou, H.; Zhang, H. The effect of Sargassum fusiforme polysaccharide extracts on vibriosis resistance and immune activity of the shrimp, Fenneropenaeus chinensis. Fish Shellfish Immunol. 2006, 20, 750–757. [Google Scholar] [CrossRef] [PubMed]
  38. Pholdaeng, K.; Pongsamart, S. Studies on the immunomodulatory effect of polysaccharide gel extracted from Durio zibethinus in Penaeus monodon shrimp against Vibrio harveyi and WSSV. Fish Shellfish Immunol. 2010, 28, 555–561. [Google Scholar] [CrossRef]
  39. Garcia-Carreno, F.L.; Cota, K.; Navarrete del Toro, M.A. Phenoloxidase activity of hemocyanin in whiteleg shrimp Penaeus vannamei: Conversion, characterization of catalytic properties, and role in postmortem melanosis. J. Agric. Food Chem. 2008, 56, 6454–6459. [Google Scholar] [CrossRef]
  40. Song, Y.L.; Yu, C.I.; Lien, T.W.; Huang, C.C.; Lin, M.N. Haemolymph parameters of Pacific white shrimp (Litopenaeus vannamei) infected with Taura syndrome virus. Fish Shellfish Immunol. 2003, 14, 317–331. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  41. Fu, G.; Peng, J.; Wang, Y.; Zhao, S.; Fang, W.; Hu, K.; Shen, J.Y.; Yao, J. Pharmacokinetics and pharmacodynamics of sulfamethoxazole and trimethoprim in swimming crabs (Portunus trituberculatus) and in vitro antibacterial activity against Vibrio: PK/PD of SMZ-TMP in crabs and antibacterial activity against Vibrio. Environ. Toxicol. Pharmacol. 2016, 46, 45–54. [Google Scholar] [CrossRef]
  42. Li, C.C.; Yeh, S.T.; Chen, J.C. The immune response of white shrimp Litopenaeus vannamei following Vibrio alginolyticus injection. Fish Shellfish Immunol. 2008, 25, 853–860. [Google Scholar] [CrossRef]
  43. Chang, Z.Q.; Ge, Q.Q.; Sun, M.; Wang, Q.; Lv, H.Y.; Li, J. Immune responses by dietary supplement with Astragalus polysaccharides in the Pacific white shrimp, Litopenaeus vannamei. Aquacult. Nutr. 2018, 24, 702–711. [Google Scholar] [CrossRef]
  44. Feng, N.N.; Yu, Y.M.; Wen, R.; Zhang, C.R.; Li, F.H. Analysis on the activity of immune related enzymes in survived Exopalaemon carinicauda from WSSV infection. Mar. Sci. 2014, 38, 75–79. [Google Scholar] [CrossRef]
  45. Wang, X.W.; Wang, J.X. Pattern recognition receptors acting in innate immune system of shrimp against pathogen infections. Fish Shellfish Immunol. 2013, 34, 981–989. [Google Scholar] [CrossRef] [PubMed]
  46. Vazquez, L.; Jaramillo, L.; Lascurain, R.; Cooper, E.L.; Rosas, P.; Zenteno, E. Bacterial agglutination by the sialic acid specific serum lectin from Macrobrachium rosenbergii. Comp. Biochem. Phys. B 1996, 113, 355–359. [Google Scholar] [CrossRef]
  47. Marques, M.F.; Barracco, M.A. Lectins, as non-self-recognition factors, in crustaceans. Aquaculture 2000, 191, 23–44. [Google Scholar] [CrossRef]
  48. Funami, K.; Matsumoto, M.; Oshiumi, H.; Akazawa, T.; Yamamoto, A.; Seya, T. The cytoplasmic ‘linker region’ in Toll-like receptor 3 controls receptor localization and signalling. Int. Immunol. 2004, 16, 1143–1154. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  49. Kawai, T.; Akira, S. The role of pattern-recognition receptors in innate immunity: Update on Toll-like receptors. Nat. Immunol. 2010, 11, 373–384. [Google Scholar] [CrossRef] [PubMed]
  50. Burge, E.J.; Madigan, D.J.; Burnett, L.E.; Burnett, K.G. Lysozyme gene expression by hemocytes of Pacific white shrimp, Litopenaeus vannamei, after injection with Vibrio. Fish Shellfish Immunol. 2007, 22, 327–339. [Google Scholar] [CrossRef]
  51. Li, S.; Guo, S.; Li, F.; Xiang, J. Characterization and function analysis of an anti-lipopolysaccharide factor (ALF) from the Chinese shrimp Fenneropenaeus chinensis. Dev. Comp. Immunol. 2014, 46, 349–355. [Google Scholar] [CrossRef]
  52. Lv, X.; Li, S.; Liu, F.; Li, F.; Xiang, J. Identification and function analysis of an anti-lipopolysaccharide factor from the ridgetail prawn Exopalaemon carinicauda. Dev. Comp. Immunol. 2017, 70, 128–134. [Google Scholar] [CrossRef]
  53. Mizuochi, T.; Yee, S.T.; Kasai, M.; Kakiuchi, T.; Muno, D.; Kominami, E. Both cathepsin B and cathepsin D are necessary for processing of ovalbumin as well as for degradation of class II MHC invariant chain. Immunol. Lett. 1994, 43, 189–192. [Google Scholar] [CrossRef]
  54. Li, X.; Meng, X.; Kong, J.; Luo, K.; Luan, S.; Cao, B.; Liu, N.; Pang, J.; Shi, X. Molecular cloning and characterization of a cathepsin B gene from the Chinese shrimp Fenneropenaeus chinensis. Fish Shellfish Immunol. 2013, 35, 1604–1612. [Google Scholar] [CrossRef] [PubMed]
  55. Liu, H.; Jiravanichpaisal, P.; Soderhall, I.; Cerenius, L.; Soderhall, K. Antilipopolysaccharide factor interferes with white spot syndrome virus replication in vitro and in vivo in the crayfish Pacifastacus leniusculus. J. Virol. 2006, 80, 10365–10371. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  56. Nunan, L.; Lightner, D.; Pantoja, C.; Gomez-Jimenez, S. Detection of acute hepatopancreatic necrosis disease (AHPND) in Mexico. Dis. Aquat. Org. 2014, 111, 81–86. [Google Scholar] [CrossRef] [PubMed]
Antibiotics 11 01784 g001 550
Figure 1. The (A) protection rates and (B) cumulative mortality of VPAHPND-infected L. vannamei in each experimental group at different times after drug treatment. One-way ANOVA and Duncan’s multiple range test were used to analyze the significant differences among different groups, and different letters represent significant differences between groups (p < 0.05).
Figure 1. The (A) protection rates and (B) cumulative mortality of VPAHPND-infected L. vannamei in each experimental group at different times after drug treatment. One-way ANOVA and Duncan’s multiple range test were used to analyze the significant differences among different groups, and different letters represent significant differences between groups (p < 0.05).
Antibiotics 11 01784 g001
Antibiotics 11 01784 g002 550
Figure 2. The VPAHPND density in the hepatopancreas of L. vannamei at different times after drug treatment. One-way ANOVA and Duncan’s multiple range test were used to analyze the significant differences among different groups, and different letters represent significant differences between groups (p < 0.05).
Figure 2. The VPAHPND density in the hepatopancreas of L. vannamei at different times after drug treatment. One-way ANOVA and Duncan’s multiple range test were used to analyze the significant differences among different groups, and different letters represent significant differences between groups (p < 0.05).
Antibiotics 11 01784 g002
Antibiotics 11 01784 g003 550
Figure 3. The THC levels (A), HEM levels (B), and antibacterial activity (C) in L. vannamei at different times following drug treatment. One-way ANOVA and Duncan’s multiple range test were used to analyze the significant differences among different groups, and different letters represent significant differences between groups (p < 0.05).
Figure 3. The THC levels (A), HEM levels (B), and antibacterial activity (C) in L. vannamei at different times following drug treatment. One-way ANOVA and Duncan’s multiple range test were used to analyze the significant differences among different groups, and different letters represent significant differences between groups (p < 0.05).
Antibiotics 11 01784 g003
Antibiotics 11 01784 g004 550
Figure 4. Immunity-related enzyme activities in drug-treated L. vannamei. (A) PO, (B) SOD, (C) GSH-Px, (D) LZM, (E) ACP, and (F) AKP in L. vannamei acellular hemolymph after different times of drug treatment. One-way ANOVA and Duncan’s multiple range test were used to analyze the significant differences among different groups, and different letters represent significant differences between groups (p < 0.05).
Figure 4. Immunity-related enzyme activities in drug-treated L. vannamei. (A) PO, (B) SOD, (C) GSH-Px, (D) LZM, (E) ACP, and (F) AKP in L. vannamei acellular hemolymph after different times of drug treatment. One-way ANOVA and Duncan’s multiple range test were used to analyze the significant differences among different groups, and different letters represent significant differences between groups (p < 0.05).
Antibiotics 11 01784 g004
Antibiotics 11 01784 g005 550
Figure 5. Immunity-related factors’ gene expression in drug-treated L. vannamei. (A) Alf, (B) CatB, (C) Cru, (D) Lec, (E) Lzm, and (F) Tlr in L. vannamei hemocytes at different times after drug treatment. One-way ANOVA and Duncan’s multiple range test were used to analyze the significant differences among different groups, and different letters represent significant differences between groups (p < 0.05).
Figure 5. Immunity-related factors’ gene expression in drug-treated L. vannamei. (A) Alf, (B) CatB, (C) Cru, (D) Lec, (E) Lzm, and (F) Tlr in L. vannamei hemocytes at different times after drug treatment. One-way ANOVA and Duncan’s multiple range test were used to analyze the significant differences among different groups, and different letters represent significant differences between groups (p < 0.05).
Antibiotics 11 01784 g005
Antibiotics 11 01784 g006 550
Figure 6. Changes in the histology of drug-treated L. vannamei hepatopancreases at 5 days. (A) Control, (B) infection only, (C) florfenicol, (D) quercetin, (E) LDC, (F) MDC, and (G) HDC group. Scale bar = 50 μm.
Figure 6. Changes in the histology of drug-treated L. vannamei hepatopancreases at 5 days. (A) Control, (B) infection only, (C) florfenicol, (D) quercetin, (E) LDC, (F) MDC, and (G) HDC group. Scale bar = 50 μm.
Antibiotics 11 01784 g006
Table
Table 1. The formula composition of the diets in the experiment.
Table 1. The formula composition of the diets in the experiment.
Groups
ControlInfected OnlyQuercetinFlorfenicolLDCMDCHDC
Ingredients
Fish meal a (g/kg)200.0200.0200.0200.0200.0200.0200.0
Wheat glutens a (g/kg)300.0300.0300.0300.0300.0300.0300.0
Wheat meal a (g/kg)200.0200.0200.0200.0200.0200.0200.0
Cellulose (g/kg)180.0180179.6179.99179.79179.59179.17
Fish oil (g/kg)25.025.025.025.025.025.025.0
Soybean oil (g/kg)25.025.025.025.025.025.025.0
Soybean phospholipids (g/kg)20.020.020.020.020.020.020.0
Gelatin (g/kg)20.020.020.020.020.020.020.0
Choline chloride (g/kg)10.010.010.010.010.010.010.0
Vitamin mix b (g/kg)10.010.010.010.010.010.010.0
Mineral mix c (g/kg)10.010.010.010.010.010.010.0
Quercetin (mg/kg)004000200400800
Florfenicol (mg/kg)000157.01530
Proximate nutrient composition (as fed)
Crude protein (g/kg)431.0431.0431.0431.0431.0431.0431.0
Crude fat (g/kg)73.073.073.073.073.073.073.0
Crude ash (g/kg)68.068.068.068.068.068.068.0
Total energy (kJ/g)16.4416.4416.4416.4416.4416.4416.44
a Fish meal: Crude protein, 689.9 g/kg dry matter, crude fat, 78.1 g/kg dry matter; wheat glutens: crude protein, 790.5 g/kg dry matter; crude fat, 1.8 g/kg dry matter; wheat meal: crude protein, 165.0 g/kg dry matter; crude fat, 15.8 g/kg dry matter. b Vitamin mixture (mg/kg diet): Riboflavin, 45.0 mg; thiamine, 25.0 mg; vitamin K3, 10.0 mg; inositol, 800.0 mg; pyridoxine hydrochloride, 20.0 mg; vitamin B12, 0.1 mg; calcium pantothenate, 60.0 mg; biotin, 1.2 mg; vitamin A, 32.0 mg; vitamin D, 5.0 mg; nicotinic acid, 200.0 mg; folic acid, 20.0 mg; vitamin E, 120.0 mg. c Mineral mix (mg/kg diet): KI, 0.8 mg; NaF, 2.0 mg; NaCl, 100.0 mg; MgSO4, 200.0 mg; CuSO4·5H2O, 10.0 mg; CoCl2·6H2O, 50.0 mg; ZnSO4, 50.0 mg; Fe2(SO4)3, 80.0 mg; Ca(H2PO4)2, 3000.0 mg.
Table
Table 2. Primer information for qPCR used in the experiment.
Table 2. Primer information for qPCR used in the experiment.
PrimerPrimer Sequence (5′-3′)GenBank Accession Number
Tlr-FTGAGAGATGCCCACTGCCTGDQ923424.1
Tlr-RCGCTTGAAGGTTTGTGAGGGAG
Alf-FTGTTCCTGGTGGCACTCTTCGQ227486.1
Alf-RGTCTCCTCGTTCCTCCACAG
Cru-FAACCAGAGACACCTGTTGGCAY488497.1
Cru-RAGAATGAGGGAGGCTTGCAC
Lzm-FTCGAGTCGTCCTTCAACACGAF425673.1
Lzm-RAGACGTTCTTGCCGTAGTCG
Lec-FCGGGATCCATGAAGTTCCTAGCGCCGEF583939.1
Lec-RCGCTCGAGTATATTTCTTGAGGCAAAT
CatB-FCCTCTGTGGTTTTGGATGTAGU571199.1
CatB-RGATGCTGTATGCTTTGCCTC
β-actin-FAGTAGCCGCCCTGGTTGTAF300705.2
β-actin-RAGGATACCTCGCTTGCTCT
Table
Table 3. Two-way ANOVA analysis of cumulative mortality, protection ratio, Vibrio density and immune parameters with florfenicol and quercetin.
Table 3. Two-way ANOVA analysis of cumulative mortality, protection ratio, Vibrio density and immune parameters with florfenicol and quercetin.
0 d0.5 d1 d3 d5 d
FpFpFpFpFp
f0.005 0.196 93.267 0.000 84.533 0.003 270.506 0.002 597.818 0.000
Cumulative mortalityq0.030 0.188 37.363 0.000 51.956 0.001 166.258 0.001 367.430 0.000
f × q0.050 0.185 6.039 0.003 0.894 0.009 2.860 0.014 6.320 0.027
f0.680 0.144 2.556 0.026 87.402 0.013 279.687 0.001 618.109 0.000
Protection ratioq0.115 0.176 29.076 0.000 54.162 0.001 173.319 0.001 383.035 0.000
f × q0.060 0.183 1.005 0.033 7.064 0.027 22.605 0.001 4.485 0.043
f0.009 0.847 254.365 0.000 126.111 0.000 336.524 0.000 9.680 0.010
Vibrio densityq0.001 0.888 101.898 0.000 43.015 0.000 88.474 0.000 4.044 0.062
f × q0.000 0.908 16.471 0.003 10.322 0.009 19.093 0.002 0.225 0.575
f0.077 0.725 6.970 0.022 1.955 0.165 4.817 0.455 4.815 0.045
THCsq0.0770.72579.2970.0000.5750.40813.9670.0047.1940.021
f × q0.187 0.816 2.741 0.110 7.625 0.018 1.552 0.207 0.951 0.305
f0.004 0.865 60.531 0.000 159.490 0.000 148.126 0.000 55.695 0.000
HEMq0.298 0.561 185.007 0.000 454.173 0.000 731.756 0.000 393.622 0.000
f × q0.024 0.805 18.015 0.002 27.887 0.001 8.339 0.015 26.103 0.001
f0.207 0.615 11.409 0.007 0.007 0.846 45.589 0.000 37.403 0.000
Antibacterial activityq0.207 0.615 9.973 0.010 1.385 0.229 199.579 0.000 702.337 0.000
f × q0.207 0.615 6.273 0.027 0.561 0.414 15.581 0.003 25.974 0.001
f0.001 0.890 0.360 0.497 1.125 0.271 13.069 0.005 7.017 0.022
PO activityq0.007 0.853 18.273 0.002 22.375 0.001 82.919 0.000 42.334 0.000
f × q0.011 0.841 1.504 0.213 0.115 0.665 4.471 0.039 0.204 0.589
f0.150 0.656 0.225 0.575 7.653 0.018 82.949 0.000 27.931 0.001
SOD activityq0.025 0.802 3.792 0.068 10.656 0.008 182.416 0.000 38.814 0.000
f × q0.013 0.834 1.172 0.263 10.821 0.008 0.126 0.654 3.592 0.075
f0.021 0.812 16.397 0.003 17.254 0.002 94.145 0.000 114.238 0.000
GSH-Px activityq0.008 0.852 25.453 0.001 34.565 0.000 187.856 0.000 221.828 0.000
f × q0.050 0.762 10.680 0.008 14.396 0.004 5.835 0.032 2.126 0.150
f0.006 0.858 9.263 0.012 18.371 0.002 13.245 0.005 26.161 0.001
LZM activityq0.000 0.898 20.739 0.001 36.595 0.000 31.422 0.000 102.075 0.000
f × q0.007 0.853 1.969 0.163 7.939 0.016 11.225 0.007 11.276 0.007
f0.000 0.897 12.535 0.006 112.852 0.000 161.979 0.000 110.784 0.000
ACP activityq0.000 0.897 35.606 0.000 349.793 0.000 710.563 0.000 499.029 0.000
f × q0.008 0.850 11.229 0.007 27.126 0.001 55.475 0.000 53.592 0.000
f0.002 0.879 23.603 0.001 44.391 0.000 75.945 0.000 71.283 0.000
AKP activityq0.019 0.818 68.846 0.000 112.016 0.000 150.743 0.000 170.969 0.000
f × q0.002 0.879 16.289 0.003 18.241 0.002 52.947 0.000 39.405 0.000
f0.116 0.686 54.434 0.000 310.115 0.000 55.365 0.000 55.063 0.000
Alf expressionq0.116 0.686 101.094 0.000 1168.187 0.000 168.119 0.000 124.353 0.000
f × q0.013 0.834 37.731 0.000 238.163 0.000 41.080 0.000 39.807 0.000
f0.052 0.758 95.303 0.000 94.525 0.000 138.370 0.000 95.035 0.000
CatB expressionq0.052 0.758 528.251 0.000 214.873 0.000 513.988 0.000 389.612 0.000
f × q0.000 0.909 92.325 0.000 84.915 0.000 127.617 0.000 89.241 0.000
f0.052 0.758 69.401 0.000 108.255 0.000 68.537 0.000 69.328 0.000
Cru expressionq0.052 0.758 200.568 0.000 179.874 0.000 199.446 0.000 135.883 0.000
f × q0.000 0.909 39.513 0.000 52.957 0.000 40.079 0.000 46.409 0.000
f0.000 0.909 55.345 0.000 66.504 0.000 70.715 0.000 82.324 0.000
Lec expressionq0.000 0.909 106.820 0.000 245.946 0.000 297.324 0.000 227.333 0.000
f × q0.052 0.758 40.208 0.000 52.042 0.000 57.150 0.000 66.246 0.000
f0.013 0.833 8.292 0.015 8.615 0.014 5.177 0.040 1.989 0.161
Lzm expressionq0.116 0.685 7.275 0.020 65.155 0.000 12.109 0.005 0.405 0.476
f × q0.116 0.685 3.732 0.070 4.846 0.043 1.791 0.180 1.108 0.275
f0.000 0.909 73.174 0.000 140.643 0.000 71.193 0.000 49.602 0.000
Tlr expressionq0.045 0.767 1291.659 0.000 1349.896 0.000 516.204 0.000 474.346 0.000
f × q0.045 0.767 67.100 0.000 93.076 0.000 40.728 0.000 36.800 0.000
Note: f, florfenicol; q, quercetin; f × q indicates interactive effect of florfenicol and quercetin. F and p refer to F and p values of two-way ANOVA analysis respectively.
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Share and Cite

MDPI and ACS Style

Zhai, Q.; Chang, Z.; Li, J.; Li, J. Protective Effects of Combined Utilization of Quercetin and Florfenicol on Acute Hepatopancreatic Necrosis Syndrome Infected Litopenaeus vannamei. Antibiotics 2022, 11, 1784. https://doi.org/10.3390/antibiotics11121784

AMA Style

Zhai Q, Chang Z, Li J, Li J. Protective Effects of Combined Utilization of Quercetin and Florfenicol on Acute Hepatopancreatic Necrosis Syndrome Infected Litopenaeus vannamei. Antibiotics. 2022; 11(12):1784. https://doi.org/10.3390/antibiotics11121784

Chicago/Turabian Style

Zhai, Qianqian, Zhiqiang Chang, Jitao Li, and Jian Li. 2022. "Protective Effects of Combined Utilization of Quercetin and Florfenicol on Acute Hepatopancreatic Necrosis Syndrome Infected Litopenaeus vannamei" Antibiotics 11, no. 12: 1784. https://doi.org/10.3390/antibiotics11121784

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop