Molecular Detection, Serotyping, and Antibiotic Resistance of Shiga Toxigenic Escherichia coli Isolated from She-Camels and In-Contact Humans in Egypt
Abstract
1. Introduction
2. Results
3. Discussion
4. Materials and Methods
4.1. Study Area and Animals
4.2. Sampling
4.3. Isolation and Identification of E. coli
4.4. Serotyping
4.5. Procedures for Determination of O-Antigen Group
4.6. PCR Template Preparation
4.7. Antibiotic Susceptibility
4.8. Statistical Analysis
Author Contributions
Funding
Institutional Review Board Statement
Acknowledgments
Conflicts of Interest
References
- Hussein, J.; Schuberth, H.J. Recent advances in camel immunology. Front. Immunol. 2020, 11, 614150. [Google Scholar] [CrossRef] [Scilit]
- Bekele, T.; Zeleke, M.; Baars, R. Milk production performance of the one-humped camel (Camelus dromedarius) under pastoral management in semi-arid eastern Ethiopia. Livest. Prod. Sci. 2002, 76, 37–44. [Google Scholar] [CrossRef] [Scilit]
- Yagil, R. Cosmeceuticals: Camel and other milk—Natural skin maintenance. In Complementary and Alternative Medicine: Breakthroughs in Research and Practice; IGI Global: Hershey, PA, USA, 2019; pp. 95–124. [Google Scholar]
- Bashir, M.E.A.A. Studies on Clinical, Aetiological and Antibiotic Susceptibility of Mastitis in She-Camel Camelus dromedarius in Butane Area, Sudan. Ph.D. Thesis, Sudan University of Science and Technology, Khartoum, Sudan, 2014. [Google Scholar]
- Husein, A.; Haftu, B.; Hunde, A.; Tesfaye, A. Prevalence of camel (Camelus dromedaries) mastitis in jijiga town, Ethiopia. Afr. J. Agric. Res. 2013, 8, 3113–3120. [Google Scholar]
- Jilo, K.; Galgalo, W.; Mata, W. Camel mastitis: A review. MOJ Eco Environ. Sci. 2017, 2, 00034. [Google Scholar] [CrossRef] [Scilit]
- Shaheen, M.A.; Dapgh, A.N.; Kamel, E.; Ali, S.F.; Khairy, E.A.; Abuelhag, H.A.; Hakim, A.S. Advanced molecular characterization of enteropathogenic Escherichia coli isolated from diarrheic camel neonates in Egypt. Vet. World 2021, 14, 85–91. [Google Scholar] [CrossRef] [Scilit]
- Abdulkadhim, M. Prevalence of methicillin resistance staphylococcus aureus in cattle and she-camels milk at Al-Qadisyia province. Al-Anbar J. Vet. Sci. 2012, 5, 63–67. [Google Scholar]
- Abeer, A.; Gouda, A.; Dardir, H.; Ibrahim, A. Prevalence of some milk-borne bacterial pathogens threatening camel milk consumers in Egypt. Global Vet 2012, 8, 76–82. [Google Scholar]
- Saleh, S.K.; Al-Ramadhan, G.; Faye, B. Monitoring of monthly SCC in she-camel in relation to milking practice, udder status and microbiological contamination of milk. Emir. J. Food Agric. 2013, 25, 403–408. [Google Scholar] [CrossRef] [Scilit]
- Bessalah, S.; Fairbrother, J.M.; Salhi, I.; Vanier, G.; Khorchani, T.; Seddik, M.M.; Hammadi, M. Antimicrobial resistance and molecular characterization of virulence genes, phylogenetic groups of Escherichia coli isolated from diarrheic and healthy camel-calves in Tunisia. Comp. Immunol. Microbiol. Infect. Dis. 2016, 49, 1–7. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Alhendi, A.B. Common diseases of camels (Camelus dromedari) in eastern province of Saudi Arabia. Pak. Vet. J. 2000, 20, 97–99. [Google Scholar]
- Carvalho, I.; Tejedor-Junco, M.T.; Gonzalez-Martin, M.; Corbera, J.A.; Silva, V.; Igrejas, G.; Torres, C.; Poeta, P. Escherichia coli producing extended-spectrum beta-lactamases (es) from domestic camels in the canary islands: A one health approach. Animals 2020, 10, 1295. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Gyles, C.L. Shiga toxin-producing Escherichia coli: An overview. J. Anim. Sci. 2007, 85, E45–E62. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kaper, J.B.; Karmali, M.A. The continuing evolution of a bacterial pathogen. Proc. Natl. Acad. Sci. USA 2008, 105, 4535–4536. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kaddu-Mulindwa, D.; Aisu, T.; Gleier, K.; Zimmermann, S.; Beutin, L. Occurrence of Shiga toxin-producing Escherichia coli in fecal samples from children with diarrhea and from healthy zebu cattle in Uganda. Int. J. Food Microbiol. 2001, 66, 95–101. [Google Scholar] [CrossRef] [Scilit]
- FAO. Shiga Toxin-Producing Escherichia coli (Stec) and Food: Attribution, Characterization and Monitoring; World Health Organization: Geneva, Switzerland, 2019. [Google Scholar]
- El-Sayed, A.; Ahmed, S.; Awad, W. Do camels (Camelus dromedarius) play an epidemiological role in the spread of Shiga toxin-producing Escherichia coli (stec) infection? Trop. Anim. Health Prod. 2008, 40, 469–473. [Google Scholar] [CrossRef] [Scilit]
- Moore, J.; McCalmont, M.; Xu, J.; Nation, G.; Tinson, A.; Crothers, L.; Harron, D. Prevalence of faecal pathogens in calves of racing camels (Camelus dromedarius) in the United Arab emirates. Trop. Anim. Health Prod. 2002, 34, 283. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Fadlelmula, A.; Al-Hamam, N.A.; Al-Dughaym, A.M. A potential camel reservoir for extended-spectrum beta-lactamase-producing Escherichia coli causing human infection in Saudi Arabia. Trop. Anim. Health Prod. 2016, 48, 427–433. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Carvalho, I.; Silva, N.; Carroll, J.; Silva, V.; Currie, C.; Igrejas, G.; Poeta, P. Antibiotic resistance: Immunity-acquired resistance: Evolution of antimicrobial resistance among extended-spectrum β-lactamases and carbapenemases in Klebsiella pneumoniae and Escherichia coli. Antibiot. Drug Resist. 2019, 239–259. [Google Scholar]
- Diab, M.S.; Zaki, R.S.; Ibrahim, N.A.; El Hafez, M.S.A. Prevalence of multidrug resistance non-typhoidal salmonellae isolated from layer farms and humans in Egypt. World Vet. J. 2019, 9, 280–288. [Google Scholar] [CrossRef] [Scilit]
- Clement, M.; Olabisi, M.; David, E.; Issa, M. Veterinary pharmaceuticals and antimicrobial resistance in developing countries. In Veterinary Medicine and Pharmaceuticals; IntechOpen: London, UK, 2019. [Google Scholar]
- Erskine, R.; Walker, R.; Bolin, C.; Bartlett, P.; White, D. Trends in antibacterial susceptibility of mastitis pathogens during a seven-year period. J. Dairy Sci. 2002, 85, 1111–1118. [Google Scholar] [CrossRef] [Scilit]
- Oliver, S.P.; Murinda, S.E.; Jayarao, B.M. Impact of antibiotic use in adult dairy cows on antimicrobial resistance of veterinary and human pathogens: A comprehensive review. Foodborne Pathog. Dis. 2011, 8, 337–355. [Google Scholar] [CrossRef] [Scilit]
- Massé, J.; Lardé, H.; Fairbrother, J.M.; Roy, J.-P.; Francoz, D.; Dufour, S.; Archambault, M. Prevalence of antimicrobial resistance and characteristics of Escherichia coli isolates from fecal and manure pit samples on dairy farms in the province of Québec, Canada. Front. Vet. Sci. 2021, 8, 438. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Dego, O.K. Current status of antimicrobial resistance and prospect for new vaccines against major bacterial bovine mastitis pathogens. In Animal Reproduction in Veterinary Medicine; IntechOpen: London, UK, 2020. [Google Scholar]
- Seligsohn, D.; Nyman, A.K.; Younan, M.; Sake, W.; Persson, Y.; Bornstein, S.; Maichomo, M.; de Verdier, K.; Morrell, J.M.; Chenais, E. Subclinical mastitis in pastoralist dairy camel herds in Isiolo, Kenya: Prevalence, risk factors, and antimicrobial susceptibility. J. Dairy Sci. 2020, 103, 4717–4731. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Mutua, J.; Gao, C.; Bebora, L.; Mutua, F. Antimicrobial resistance profiles of bacteria isolated from the nasal cavity of camels in Samburu, Nakuru, and Isiolo counties of Kenya. J. Vet. Med. 2017, 2017, 6. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Suheir, I. Some Bacterial Species, Mycoplasma and Fungal Isolates Associated with Camel Mastitis. Master’s Thesis, University of Khartoum, Khartoum, Sudan, 2004. [Google Scholar]
- Miara, M.D.; Bendif, H.; Ait Hammou, M.; Teixidor-Tonneau, I. Ethnobotanical survey of medicinal plants used by nomadic peoples in the Algerian steppe. J. Ethnopharmacol. 2018, 219, 248–256. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Owusu, E.; Ahorlu, M.M.; Afutu, E.; Akumwena, A.; Asare, G.A. Antimicrobial activity of selected medicinal plants from a sub-Saharan African country against bacterial pathogens from post-operative wound infections. Med. Sci. 2021, 9, 23. [Google Scholar]
- Aziz, M.A.; Khan, A.H.; Adnan, M.; Ullah, H. Traditional uses of medicinal plants used by indigenous communities for veterinary practices at Bajaur Agency, Pakistan. J. Ethnobiol. Ethnomed. 2018, 14, 1–18. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- CLSI. Performance Standards for Antimicrobial Susceptibility Testing; Twenty-Fifth Informational Supplement; CLSI document M100-S25; Clinical and Laboratory Standards Institute: Wayne, PA, USA, 2015. [Google Scholar]
- Balemi, A.; Gumi, B.; Amenu, K.; Girma, S.; Gebru, M.; Tekle, M.; Ríus, A.A.; D’Souza, D.H.; Agga, G.E.; Kerro Diego, O. Prevalence of mastitis and antibiotic resistance of bacterial isolates from CMT positive milk samples obtained from dairy cows, camels, and goats in two pastoral districts in southern Ethiopia. Animals 2021, 11, 1530. [Google Scholar] [CrossRef] [Scilit]
- Alizade, H.; Hosseini Teshnizi, S.; Azad, M.; Shoji, S.; Gouklani, H.; Davoodian, P.; Ghanbarpour, R. An overview of diarrheagenic Escherichia coli in Iran: A systematic review and meta-analysis. J. Res. Med. Sci. 2019, 24, 23. [Google Scholar]
- Galal, H.; Hakim, A.; Dorgham, S. Phenotypic and virulence genes screening of Escherichia coli strains isolated from different sources in delta Egypt. Life Sci. J. 2013, 10, 352–361. [Google Scholar]
- Osman, K.M.; Mustafa, A.M.; Elhariri, M.; Abdelhamid, G.S. The distribution of Escherichia coli serovars, virulence genes, gene association and combinations and virulence genes encoding serotypes in pathogenic e. Coli recovered from diarrhoeic calves, sheep and goat. Transbound Emerg. Dis. 2013, 60, 69–78. [Google Scholar] [CrossRef] [Scilit]
- Hakim, A.S.; Omara, S.T.; Same, S.M.; Fouad, E.A. Serotyping, antibiotic susceptibility, and virulence genes screening of Escherichia coli isolates obtained from diarrheic buffalo calves in Egyptian farms. Vet. World 2017, 10, 769. [Google Scholar] [CrossRef] [Scilit]
- Abo Hashem, M.; Ibrahim, S.; Goda, A.S.; Enany, M. Diversity of microorganisms associated to she camels’ subclinical and clinical mastitis in South Sinai, Egypt. Suez Canal Vet. Med. J. SCVMJ 2020, 25, 307–319. [Google Scholar] [CrossRef] [Scilit]
- Al Humam, N.A. Special biochemical profiles of Escherichia coli strains isolated from humans and camels by the Vitek 2 automated system in al-ahsa, Saudi Arabia. Afr. J. Microbiol. Res. 2016, 10, 783–790. [Google Scholar]
- El-Hewairy, H.; Awad, W.; Ibrahim, A. Serotyping and molecular characterization of Escherichia coli isolated from diarrheic and in-contact camel calves. Egypt. J. Comp. Pathol. Clin. Pathol. 2009, 22, 216–233. [Google Scholar]
- Al-Ajmi, D.; Rahman, S.; Banu, S. Occurrence, virulence genes, and antimicrobial profiles of Escherichia coli o157 isolated from ruminants slaughtered in al ain, united Arab emirates. BMC Microbiol. 2020, 20, 210. [Google Scholar] [CrossRef] [Scilit]
- Mohammed, H.O.; Stipetic, K.; Salem, A.; McDonough, P.; Chang, Y.F.; Sultan, A. Risk of Escherichia coli o157: H7, non-o157 Shiga toxin-producing Escherichia coli, and campylobacter spp. In food animals and their products in Qatar. J. Food Prot. 2015, 78, 1812–1818. [Google Scholar] [CrossRef] [Scilit]
- Baschera, M.; Cernela, N.; Stevens, M.J.A.; Liljander, A.; Jones, J.; Corman, V.M.; Nuesch-Inderbinen, M.; Stephan, R. Shiga toxin-producing Escherichia coli (stec) isolated from fecal samples of African dromedary camels. One Health 2019, 7, 100087. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Adamu, M.S.; Ugochukwu, I.C.I.; Idoko, S.I.; Kwabugge, Y.A.; Abubakar, N.S.; Ameh, J.A. Virulent gene profile and antibiotic susceptibility pattern of Shiga toxin-producing Escherichia coli (stec) from cattle and camels in Maiduguri, north-eastern Nigeria. Trop. Anim. Health Prod. 2018, 50, 1327–1341. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- EL-Alfy, S.M.; Ahmed, S.F.; Selim, S.A.; Aziz, M.H.A.; Zakaria, A.M.; Klena, J.D. Prevalence and characterization of Shiga toxin o157 and non-o157 enterohemorrhagic Escherichia coli isolated from different sources in Ismailia, Egypt. Afr. J. Microbiol. Res. 2013, 7, 2637–2645. [Google Scholar]
- Ramadan, H.; Awad, A.; Ateya, A. Detection of phenotypes, virulence genes and phylotypes of avian pathogenic and human diarrheagenic Escherichia coli in Egypt. J. Infect. Dev. Ctries 2016, 10, 584–591. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Persson, S.; Olsen, K.E.; Scheutz, F.; Krogfelt, K.A.; Gerner-Smidt, P. A method for fast and simple detection of major diarrhoeagenic Escherichia coli in the routine diagnostic laboratory. Clin. Microbiol. Infect. 2007, 13, 516–524. [Google Scholar] [CrossRef] [Scilit]
- Monaghan, A.; Byrne, B.; Fanning, S.; Sweeney, T.; McDowell, D.; Bolton, D.J. Serotypes and virulence profiles of non-o157 Shiga toxin-producing Escherichia coli isolates from bovine farms. Appl. Environ. Microbiol. 2011, 77, 8662–8668. [Google Scholar] [CrossRef] [Scilit]
- Moses, A.; Egwu, G.; Ameh, J. Antimicrobial-resistant pattern of e. Coli o157 isolated from human, cattle and surface water samples in northeast Nigeria. J. Vet. Adv. 2012, 2, 209–215. [Google Scholar]
- Bakhtiari, N.M.; Fazlara, A.; Jorge, H. Risk of Shiga toxin-producing Escherichia coli infection in humans due to consuming unpasteurized dairy products. Int. J. Enteric. Pathog. 2018, 6, 14–17. [Google Scholar] [CrossRef] [Scilit]
- Yamasaki, E.; Watahiki, M.; Isobe, J.; Sata, T.; Nair, G.B.; Kurazono, H. Quantitative detection of Shiga toxins directly from stool specimens of patients associated with an outbreak of enterohemorrhagic Escherichia coli in Japan—Quantitative Shiga toxin detection from stool during ehec outbreak. Toxins 2015, 7, 4381–4389. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Sethulekshmi, C.; Latha, C.; Anu, C. Occurrence and Quantification of Shiga Toxin-Producing Escherichia coli from Food Matrices. Vet. World 2018, 11, 104–111. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Angulo, F.J.; Steinmuller, N.; Demma, L.; Bender, J.B.; Eidson, M.; Angulo, F.J. Outbreaks of enteric disease associated with animal contact: Not just a foodborne problem anymore. Clin. Infect. Dis. 2006, 43, 1596–1602. [Google Scholar] [CrossRef] [Scilit]
- Ranjbar, R.; Masoudimanesh, M.; Dehkordi, F.S.; Jonaidi-Jafari, N.; Rahimi, E. Shiga (Vero)-toxin-producing Escherichia coli isolated from the hospital foods; virulence factors, o-serogroups and antimicrobial resistance properties. Antimicrob. Resist. Infect. Control 2017, 6, 4. [Google Scholar] [CrossRef] [Scilit]
- Rashid, M.; Kotwal, S.K.; Malik, M.; Singh, M. Prevalence, genetic profile of virulence determinants and multidrug resistance of Escherichia coli isolates from foods of animal origin. Vet. World 2013, 6, 139–142. [Google Scholar] [CrossRef] [Scilit]
- Mashak, Z. Virulence genes and phenotypic evaluation of the antibiotic resistance of Vero toxin-producing Escherichia coli recovered from milk, meat, and vegetables. Jundishapur J. Microbiol. 2018, 11, e62288. [Google Scholar] [CrossRef] [Scilit]
- Aly, S.M.; Albutti, A. Antimicrobials use in aquaculture and their public health impact. J. Aquac. Res. Dev. 2014, 5, 1. [Google Scholar]
- Shrivastava, S.R.; Shrivastava, P.S.; Ramasamy, J. World health organization releases global priority list of antibiotic-resistant bacteria to guide research, discovery, and development of new antibiotics. J. Med. Soc. 2018, 32, 76. [Google Scholar] [CrossRef] [Scilit]
- Diab, M.S.; Ibrahim, N.A.; Elnaker, Y.F.; Zidan, S.A.; Saad, M.A. Molecular detection of staphylococcus aureus enterotoxin genes isolated from mastitic milk and humans in el-behira, Egypt. Int. J. One Health 2021, 7, 70–77. [Google Scholar] [CrossRef] [Scilit]
- Abdo, S.E.; Gewaily, M.S.; Abo-Al-Ela, H.G.; Almere, R.; Soliman, A.A.; Elkomy, A.H.; Dawood, M.A.O. Vitamin c rescues inflammation, immunosuppression, and histopathological alterations induced by chlorpyrifos in Nile tilapia. Environ. Sci. Pollut. Res. 2021, 28, 28750–28763. [Google Scholar] [CrossRef] [Scilit]
- Wenz, J.; Barrington, G.; Garry, F.; Ellis, R.; Magnuson, R. Escherichia coli isolates’ serotypes, genotypes, and virulence genes and clinical coliform mastitis severity. J. Dairy Sci. 2006, 89, 3408–3412. [Google Scholar] [CrossRef] [Scilit]
- De Verdier, K.; Nyman, A.; Greko, C.; Bengtsson, B. Antimicrobial resistance and virulence factors in Escherichia coli from Swedish dairy calves. Acta Vet. Scand. 2012, 54, 2. [Google Scholar] [CrossRef] [Scilit]
- Scaria, J.; Warnick, L.D.; Kaneene, J.B.; May, K.; Teng, C.H.; Chang, Y.F. Comparison of phenotypic and genotypic antimicrobial profiles in Escherichia coli and salmonella enterica from the same dairy cattle farms. Mol. Cell Probes 2010, 24, 325–345. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Momtaz, H.; Farzan, R.; Rahimi, E.; Safarpoor Dehkordi, F.; Sound, N. Molecular characterization of Shiga toxin-producing Escherichia coli isolated from ruminant and donkey raw milk samples and traditional dairy products in Iran. Sci. World J. 2012, 2012, 231342. [Google Scholar] [CrossRef] [Scilit]
- Ranjbar, R.; Safarpoor Dehkordi, F.; Sakhaei Shahreza, M.H.; Rahimi, E. Prevalence, identification of virulence factors, o-serogroups and antibiotic resistance properties of Shiga-toxin-producing Escherichia coli strains isolated from raw milk and traditional dairy products. Antimicrob. Resist. Infect. Control 2018, 7, 53. [Google Scholar] [CrossRef] [Scilit]
- Ababu, A.; Endashaw, D.; Fesseha, H. Isolation and antimicrobial susceptibility profile of Escherichia coli o157: H7 from raw milk of dairy cattle in holeta district, central Ethiopia. Int. J. Microbiol. 2020, 2020, 6626488. [Google Scholar] [CrossRef] [Scilit]
- Hoque, M.N.; Das, Z.C.; Talukder, A.K.; Alam, M.S.; Rahman, A.N. Different screening tests and milk somatic cell count for the prevalence of subclinical bovine mastitis in Bangladesh. Trop. Anim. Health Prod. 2015, 47, 79–86. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Quinn, P.J.; Markey, B.K.; Leonard, F.C.; Hartigan, P.; Fanning, S.; Fitzpatrick, E. Veterinary Microbiology and Microbial Disease; John Wiley & Sons: Hoboken, NJ, USA, 2011. [Google Scholar]
- Kok, T.; Worswich, D.; Gowans, E. Some serological techniques for microbial and viral infections. In Practical Medical Microbiology; Collee, J., Fraser, A., Marmion, B., Simmons, A., Eds.; Churchill Livingstone: Edinburgh, UK, 1996. [Google Scholar]
- Paton, J.C.; Paton, A.W. Pathogenesis and diagnosis of Shiga toxin-producing Escherichia coli infections. Clin. Microbiol. Rev. 1998, 11, 450–479. [Google Scholar] [CrossRef] [Scilit] [PubMed]
| Milk | 180 she-camels | Total (34/180) = 18.9% |
| Clinical mastitis 15 (8.3%) | ||
| Subclinical 19 (10.6%) | ||
| 720 milk samples per quarter level (180 animals ∗ 4 quarters) | Clinical mastitis 43 (5.9%) | |
| subclinical 71 (9.9%) | ||
| Fecal Samples | 180 | Diarrhea 9 (5%) |
| Normal 171 (95%) |
| Types of Mastitis | Separate (no 72) | Mixed Breeding (no 108) | Chi-Square Value | p-Value | ||
|---|---|---|---|---|---|---|
| No. | % | No. | % | |||
| Clinical mastitis | 3 | 4.1 | 12 | 11.1 | 6.58 | 0.04 |
| Subclinical mastitis | 4 | 5.6 | 15 | 13.9 | ||
| Total | 7 | 9.7 | 27 | 25 | ||
| Camel Samples | E. coli Conventional Isolation | STEC (PCR)/Total Cases | STEC (PCR)/E. coli Isolates | |||
|---|---|---|---|---|---|---|
| No. | % | No. | % | No. | % | |
| Clinical mastitis/quarter n = 43 | 11 | 25.6 | 3 | 6.9 | 3 | 27.3 |
| Subclinical/quarter n= 71 | 14 | 19.7 | 6 | 8.5 | 6 | 42.9 |
| Total/quarter n = 114 | 25 | 21.9 | 9 | 7.9 | 9 | 36 |
| Diarrhea n = 9 | 4 | 44.4 | 1 | 11.1 | 1 | 25 |
| Normal feces n = 171 | 21 | 12.3 | 3 | 1.8 | 3 | 14.3 |
| Total n = 180 | 25 | 13.9 | 4 | 2.2 | 4 | 16 |
| Human Samples | E. coli Conventional Isolation | STEC (PCR)/Total Cases | STEC (PCR)/E. coli Isolates | |||
|---|---|---|---|---|---|---|
| No. | % | No. | % | No. | % | |
| Contact n = 26 | 6 | 23.2 | 1 | 3.8 | 1 | 16.7 |
| Non-contact n = 78 | 29 | 37.2 | 10 | 12.8 | 10 | 34.5 |
| Total n = 104 | 35 | 33.7 | 11 | 10.6 | 11 | 31.4 |
| Chi-square value | 1.73 | 1.66 | 1.66 | |||
| p-value | 0.19 | 0.18 | 0.18 | |||
| Hot Climate | Cold Climate | |
|---|---|---|
| Clinical mastitis | 0 | 3 |
| subclinical | 1 | 5 |
| Diarrhea | 0 | 1 |
| Normal feces | 0 | 0 |
| Human isolates | 1 | 10 |
| Species | Serotypes of STEC | |||||
|---|---|---|---|---|---|---|
| O26 (%) | O45 (%) | O103 (%) | O121 (%) | O145 (%) | O111 (%) | |
| Camel isolates n= 13 | 3 (6) | 1 (2) | 1 (2) | 2 (4) | 3 (6) | 3 (6) |
| Human isolates n = 11 | 4 (11.4) | 3 (8.6) | 2 (5.7) | 0 | 2 (5.7) | 0 |
| Total n = 24 | 7 | 4 | 3 | 2 | 5 | 3 |
| Species | Virulence Genes | ||||||||
|---|---|---|---|---|---|---|---|---|---|
| stx1 | stx2 | stx1 & stx2 | eae | hlyA | stx1 + eae | stx2 + eae | stx1 & stx2 + eae | ||
| STEC Camel isolates (13) | No. | 6 | 3 | 4 | 4 | 0 | 3 | 1 | 0 |
| % | 46.2 | 23.1 | 30.7 | 30.7 | 0 | 23.1 | 7.7 | 0 | |
| STEC human isolates (11) | No. | 4 | 5 | 1 | 5 | 3 | 1 | 2 | 1 |
| % | 36 | 45.5 | 9 | 45.5 | 27.3 | 9 | 18.1 | 9 | |
| Antibacterial Agent | No. of Resistance among Camel Isolates | No. of Resistance among Human Isolates | ||||||
|---|---|---|---|---|---|---|---|---|
| No. | R (%) | I (%) | S (%) | No. | R (%) | I (%) | S (%) | |
| Streptomycin | 13 | 1(7.7) | 2(15.4) | 10(77) | 11 | 5 (45.5) | 5(45.5) | 1(9) |
| Gentamycin | 1(7.7) | 4(30.8) | 8(61.5) | 8 (72.7) | 1(9) | 2(18.2) | ||
| Clindamycin | 0(0) | 1(7.7) | 12(92.3) | 7 (63.6) | 2(18.2) | 2(18.2) | ||
| Amoxicillin | 0(0) | 2(15.4) | 11(84.6) | 9 (81.8) | 1(9) | 1(9) | ||
| Ampicillin | 1(7.7) | 3(23.1) | 9(69.2) | 4 (36.4) | 1(9) | 6(54.5) | ||
| Oxytetracycline | 7(53.8) | 4(30.8) | 2(15.4) | 2 (18.2) | 4(36.4) | 5(45.5) | ||
| Ciprofloxacin | 1(7.7) | 3(23.1) | 9(69.2) | 7 (63.6) | 1(9) | 3(27.3) | ||
| Target Gene | Primer Sequence (5′–3′) | Fragment Size (bp) | [72] |
| stx1 | F: ATAAATCGCCATTCGTTGACTAC R: AGAACGCCCACTGAGATCATC | 180 | |
| stx2 | F: GGCACTGTCTGAAACTGCTCC R: TCGCCAGTTATCTGACATTCTG | 255 | |
| eae | F: GACCCGGCACAAGCATAAGC R: CCACCTGCAGCAACAAGAGG | 384 | |
| hlyA | F: GCATCACAAGCGTACGTTCC R: AATGAGCCAAGCTGGTTAAGCT | 534 |
| Antimicrobial Agent | Disk Content | Zone Diameter Interpretive Criteria (Nearest Whole mm) | ||
|---|---|---|---|---|
| Clindamycin | 2 μg | S | I | R |
| Ampicillin | 10 μg | ≥19 | 16–18 | ≤15 |
| Gentamycin | 10 μg | ≥17 | 14–16 | ≤13 |
| Streptomycin | 10 μg | ≥15 | 13–14 | ≤12 |
| Tetracycline | 30 μg | ≥15 | 12–14 | ≤11 |
| Ciprofloxacin | 5 μg | ≥15 | 12–14 | ≤11 |
| Amoxycillin | 30 μg | ≥31 | 21–30 | ≤20 |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Diab, M.S.; Tarabees, R.; Elnaker, Y.F.; Hadad, G.A.; Saad, M.A.; Galbat, S.A.; Albogami, S.; Hassan, A.M.; Dawood, M.A.O.; Shaaban, S.I. Molecular Detection, Serotyping, and Antibiotic Resistance of Shiga Toxigenic Escherichia coli Isolated from She-Camels and In-Contact Humans in Egypt. Antibiotics 2021, 10, 1021. https://doi.org/10.3390/antibiotics10081021
Diab MS, Tarabees R, Elnaker YF, Hadad GA, Saad MA, Galbat SA, Albogami S, Hassan AM, Dawood MAO, Shaaban SI. Molecular Detection, Serotyping, and Antibiotic Resistance of Shiga Toxigenic Escherichia coli Isolated from She-Camels and In-Contact Humans in Egypt. Antibiotics. 2021; 10(8):1021. https://doi.org/10.3390/antibiotics10081021
Chicago/Turabian StyleDiab, Mohamed Said, Reda Tarabees, Yasser F. Elnaker, Ghada A. Hadad, Marwa A. Saad, Salah A. Galbat, Sarah Albogami, Aziza M. Hassan, Mahmoud A. O. Dawood, and Sabah Ibrahim Shaaban. 2021. "Molecular Detection, Serotyping, and Antibiotic Resistance of Shiga Toxigenic Escherichia coli Isolated from She-Camels and In-Contact Humans in Egypt" Antibiotics 10, no. 8: 1021. https://doi.org/10.3390/antibiotics10081021
APA StyleDiab, M. S., Tarabees, R., Elnaker, Y. F., Hadad, G. A., Saad, M. A., Galbat, S. A., Albogami, S., Hassan, A. M., Dawood, M. A. O., & Shaaban, S. I. (2021). Molecular Detection, Serotyping, and Antibiotic Resistance of Shiga Toxigenic Escherichia coli Isolated from She-Camels and In-Contact Humans in Egypt. Antibiotics, 10(8), 1021. https://doi.org/10.3390/antibiotics10081021

