Parallel Detection of the Unamplified Carbapenem Resistance Genes blaNDM-1 and blaOXA-1 Using a Plasmonic Nano-Biosensor with a Field-Portable DNA Extraction Method
Abstract
1. Introduction
2. Materials and Methods
2.1. Materials
2.2. Bacterial Cultures
2.3. Oligonucleotide Probe Design and PCR Verification
2.4. GNP Synthesis and Modification
2.5. Biosensor Design, Principle, and Optimization
2.6. DNA Extraction Methods
2.7. Selectivity and Limit of Detection Testing
2.8. Statistical Analysis
3. Results
3.1. Optimization of Biosensor DNA Probes with DNA Extracted with and Without a Commercial Extraction Kit
3.2. Selectivity Testing of Pure Bacterial Culture DNA Extracted with and Without a Commercial Extraction Kit
3.3. Limit of Detection Testing
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Tang, K.W.K.; Millar, B.C.; Moore, J.E. Antimicrobial Resistance (AMR). Br. J. Biomed. Sci. 2023, 80, 11387. [Google Scholar] [CrossRef] [PubMed]
- Naghavi, M.; Vollset, S.E.; Ikuta, K.S.; Swetschinski, L.R.; Gray, A.P.; Wool, E.E.; Robles Aguilar, G.; Mestrovic, T.; Smith, G.; Han, C.; et al. Global Burden of Bacterial Antimicrobial Resistance 1990–2021: A Systematic Analysis with Forecasts to 2050. Lancet 2024, 404, 1199–1226. [Google Scholar] [CrossRef]
- Prestinaci, F.; Pezzotti, P.; Pantosti, A. Antimicrobial Resistance: A Global Multifaceted Phenomenon. Pathog. Glob. Health 2015, 109, 309–318. [Google Scholar] [CrossRef]
- Ventola, C.L. The Antibiotic Resistance Crisis: Part 1: Causes and Threats. Pharm. Ther. 2015, 40, 277–283. [Google Scholar]
- Isaacson, R.E.; Torrence, M.E. The Role of Antibiotics in Agriculture: This Report Is Based on a Colloquium Sponsored by the American Academy of Microbiology Held 2–4 November 2001, in Santa Fe, New Mexico; American Academy of Microbiology Colloquia Reports; American Society for Microbiology: Washington, DC, USA, 2002. [Google Scholar]
- Spellberg, B.; Gilbert, D.N. The Future of Antibiotics and Resistance: A Tribute to a Career of Leadership by John Bartlett. Clin. Infect. Dis. 2014, 59, S71–S75. [Google Scholar] [CrossRef] [PubMed]
- Walsh, C.T.; Wright, G. Introduction: Antibiotic Resistance. Chem. Rev. 2005, 105, 391–394. [Google Scholar] [CrossRef]
- Knapp, K.M.; English, B.K. Carbapenems. Semin. Pediatr. Infect. Dis. 2001, 12, 175–185. [Google Scholar] [CrossRef]
- Meletis, G. Carbapenem Resistance: Overview of the Problem and Future Perspectives. Ther. Adv. Infect. 2016, 3, 15–21. [Google Scholar] [CrossRef] [PubMed]
- Codjoe, F.; Donkor, E. Carbapenem Resistance: A Review. Med. Sci. 2017, 6, 1. [Google Scholar] [CrossRef] [PubMed]
- Mills, M.C.; Lee, J. The Threat of Carbapenem-Resistant Bacteria in the Environment: Evidence of Widespread Contamination of Reservoirs at a Global Scale. Environ. Pollut. 2019, 255, 113143. [Google Scholar] [CrossRef]
- Pereira, A.L.; De Oliveira, P.M.; Faria-Junior, C.; Alves, E.G.; De Castro E Caldo Lima, G.R.; Da Costa Lamounier, T.A.; Haddad, R.; De Araújo, W.N. Environmental Spreading of Clinically Relevant Carbapenem-Resistant Gram-Negative Bacilli: The Occurrence of blaKPC-or-NDM Strains Relates to Local Hospital Activities. BMC Microbiol. 2022, 22, 6. [Google Scholar] [CrossRef]
- Cacace, D.; Fatta-Kassinos, D.; Manaia, C.M.; Cytryn, E.; Kreuzinger, N.; Rizzo, L.; Karaolia, P.; Schwartz, T.; Alexander, J.; Merlin, C.; et al. Antibiotic Resistance Genes in Treated Wastewater and in the Receiving Water Bodies: A Pan-European Survey of Urban Settings. Water Res. 2019, 162, 320–330. [Google Scholar] [CrossRef]
- Feng, J.; Xiang, Q.; Ma, J.; Zhang, P.; Li, K.; Wu, K.; Su, M.; Li, R.; Hurley, D.; Bai, L.; et al. Characterization of Carbapenem-Resistant Enterobacteriaceae Cultured From Retail Meat Products, Patients, and Porcine Excrement in China. Front. Microbiol. 2021, 12, 743468. [Google Scholar] [CrossRef]
- Urase, T.; Goto, S.; Sato, M. Monitoring Carbapenem-Resistant Enterobacterales in the Environment to Assess the Spread in the Community. Antibiotics 2022, 11, 917. [Google Scholar] [CrossRef]
- Huang, E.; Yang, X.; Leighton, E.; Li, X. Carbapenem Resistance in the Food Supply Chain. J. Food Prot. 2023, 86, 100108. [Google Scholar] [CrossRef] [PubMed]
- Tamma, P.D.; Simner, P.J. Phenotypic Detection of Carbapenemase-Producing Organisms from Clinical Isolates. J. Clin. Microbiol. 2018, 56, e01140-18. [Google Scholar] [CrossRef] [PubMed]
- The JPIAMR AMR-RDT Working Group on Antimicrobial Resistance and Rapid Diagnostic Testing; Van Belkum, A.; Bachmann, T.T.; Lüdke, G.; Lisby, J.G.; Kahlmeter, G.; Mohess, A.; Becker, K.; Hays, J.P.; Woodford, N.; et al. Developmental Roadmap for Antimicrobial Susceptibility Testing Systems. Nat. Rev. Microbiol. 2019, 17, 51–62. [Google Scholar] [CrossRef] [PubMed]
- Jonasson, E.; Matuschek, E.; Kahlmeter, G. The EUCAST Rapid Disc Diffusion Method for Antimicrobial Susceptibility Testing Directly from Positive Blood Culture Bottles. J. Antimicrob. Chemother. 2020, 75, 968–978. [Google Scholar] [CrossRef] [PubMed]
- Matuschek, E.; Brown, D.F.J.; Kahlmeter, G. Development of the EUCAST Disk Diffusion Antimicrobial Susceptibility Testing Method and Its Implementation in Routine Microbiology Laboratories. Clin. Microbiol. Infect. 2014, 20, O255–O266. [Google Scholar] [CrossRef] [PubMed]
- Li, K.; Zhong, W.; Li, P.; Ren, J.; Jiang, K.; Wu, W. Antibacterial Mechanism of Lignin and Lignin-Based Antimicrobial Materials in Different Fields. Int. J. Biol. Macromol. 2023, 252, 126281. [Google Scholar] [CrossRef] [PubMed]
- Schumacher, A.; Vranken, T.; Malhotra, A.; Arts, J.J.C.; Habibovic, P. In Vitro Antimicrobial Susceptibility Testing Methods: Agar Dilution to 3D Tissue-Engineered Models. Eur. J. Clin. Microbiol. Infect. Dis. 2018, 37, 187–208. [Google Scholar] [CrossRef]
- Lozano, G.E.; Beatriz, S.R.; Cervantes, F.M.; María, G.N.P.; Francisco, J.M.C. Low Accuracy of the McFarland Method for Estimation of Bacterial Populations. Afr. J. Microbiol. Res. 2018, 12, 736–740. [Google Scholar] [CrossRef]
- Hrabák, J.; Walková, R.; Studentová, V.; Chudácková, E.; Bergerová, T. Carbapenemase Activity Detection by Matrix-Assisted Laser Desorption Ionization-Time of Flight Mass Spectrometry. J. Clin. Microbiol. 2011, 49, 3222–3227. [Google Scholar] [CrossRef]
- Girlich, D.; Poirel, L.; Nordmann, P. Value of the Modified Hodge Test for Detection of Emerging Carbapenemases in Enterobacteriaceae. J. Clin. Microbiol. 2012, 50, 477–479. [Google Scholar] [CrossRef] [PubMed]
- Pasteran, F.; Tijet, N.; Melano, R.G.; Corso, A. Simplified Protocol for Carba NP Test for Enhanced Detection of Carbapenemase Producers Directly from Bacterial Cultures. J. Clin. Microbiol. 2015, 53, 3908–3911. [Google Scholar] [CrossRef] [PubMed]
- Coorevits, L.; Boelens, J.; Claeys, G. Direct Susceptibility Testing by Disk Diffusion on Clinical Samples: A Rapid and Accurate Tool for Antibiotic Stewardship. Eur. J. Clin. Microbiol. Infect. Dis. 2015, 34, 1207–1212. [Google Scholar] [CrossRef]
- Gajic, I.; Kabic, J.; Kekic, D.; Jovicevic, M.; Milenkovic, M.; Mitic Culafic, D.; Trudic, A.; Ranin, L.; Opavski, N. Antimicrobial Susceptibility Testing: A Comprehensive Review of Currently Used Methods. Antibiotics 2022, 11, 427. [Google Scholar] [CrossRef]
- Zhuang, Q.; Guo, H.; Peng, T.; Ding, E.; Zhao, H.; Liu, Q.; He, S.; Zhao, G. Advances in the Detection of β-Lactamase: A Review. Int. J. Biol. Macromol. 2023, 251, 126159. [Google Scholar] [CrossRef]
- Mayrhofer, S.; Domig, K.J.; Mair, C.; Zitz, U.; Huys, G.; Kneifel, W. Comparison of Broth Microdilution, Etest, and Agar Disk Diffusion Methods for Antimicrobial Susceptibility Testing of Lactobacillus acidophilus Group Members. Appl. Environ. Microbiol. 2008, 74, 3745–3748. [Google Scholar] [CrossRef]
- Galhano, B.S.P.; Ferrari, R.G.; Panzenhagen, P.; De Jesus, A.C.S.; Conte-Junior, C.A. Antimicrobial Resistance Gene Detection Methods for Bacteria in Animal-Based Foods: A Brief Review of Highlights and Advantages. Microorganisms 2021, 9, 923. [Google Scholar] [CrossRef]
- Yang, S.; Rothman, R.E. PCR-Based Diagnostics for Infectious Diseases: Uses, Limitations, and Future Applications in Acute-Care Settings. Lancet Infect. Dis. 2004, 4, 337–348. [Google Scholar] [CrossRef]
- Bagger, F.O.; Borgwardt, L.; Jespersen, A.S.; Hansen, A.R.; Bertelsen, B.; Kodama, M.; Nielsen, F.C. Whole Genome Sequencing in Clinical Practice. BMC Med. Genom. 2024, 17, 39. [Google Scholar] [CrossRef]
- Liébana-Martos, C. Indications, Interpretation of Results, Advantages, Disadvantages, and Limitations of MALDI-TOF. In The Use of Mass Spectrometry Technology (MALDI-TOF) in Clinical Microbiology; Elsevier: Amsterdam, The Netherlands, 2018; pp. 75–86. ISBN 978-0-12-814451-0. [Google Scholar]
- Rychert, J. Benefits and Limitations of MALDI-TOF Mass Spectrometry for the Identification of Microorganisms. J. Infect. 2019, 2, 1–5. [Google Scholar] [CrossRef]
- Sawa, T.; Kooguchi, K.; Moriyama, K. Molecular Diversity of Extended-Spectrum β-Lactamases and Carbapenemases, and Antimicrobial Resistance. J. Intensive Care 2020, 8, 13. [Google Scholar] [CrossRef] [PubMed]
- Che, T.; Bethel, C.R.; Pusztai-Carey, M.; Bonomo, R.A.; Carey, P.R. The Different Inhibition Mechanisms of OXA-1 and OXA-24 β-Lactamases Are Determined by the Stability of Active Site Carboxylated Lysine. J. Biol. Chem. 2014, 289, 6152–6164. [Google Scholar] [CrossRef] [PubMed]
- Hammami, I.; Alabdallah, N.M.; Jomaa, A.A.; Kamoun, M. Gold Nanoparticles: Synthesis Properties and Applications. J. King Saud. Univ.—Sci. 2021, 33, 101560. [Google Scholar] [CrossRef]
- Saha, K.; Agasti, S.S.; Kim, C.; Li, X.; Rotello, V.M. Gold Nanoparticles in Chemical and Biological Sensing. Chem. Rev. 2012, 112, 2739–2779. [Google Scholar] [CrossRef] [PubMed]
- Ahirwar, R.; Nahar, P. Development of a Label-Free Gold Nanoparticle-Based Colorimetric Aptasensor for Detection of Human Estrogen Receptor Alpha. Anal. Bioanal. Chem. 2016, 408, 327–332. [Google Scholar] [CrossRef]
- Feng, Y.; Xue, G.; Feng, J.; Yan, C.; Cui, J.; Gan, L.; Zhang, R.; Zhao, H.; Xu, W.; Li, N.; et al. Rapid Detection of New Delhi Metallo-β-Lactamase Gene Using Recombinase-Aided Amplification Directly on Clinical Samples From Children. Front. Microbiol. 2021, 12, 691289. [Google Scholar] [CrossRef] [PubMed]
- Colom, K.; Perez, J.; Alonso, R.; Fernandez-Aranguiz, A.; Larino, E.; Cisterna, R. Simple and Reliable Multiplex PCR Assay for Detection of blaTEM, blaSHV and blaOXA-1 Genes in Enterobacteriaceae. FEMS Microbiol. Lett. 2003, 223, 147–151. [Google Scholar] [CrossRef] [PubMed]
- Anderson, M.J.; Torres-Chavolla, E.; Castro, B.A.; Alocilja, E.C. One Step Alkaline Synthesis of Biocompatible Gold Nanoparticles Using Dextrin as Capping Agent. J. Nanopart Res. 2011, 13, 2843–2851. [Google Scholar] [CrossRef]
- ImageJ. Available online: https://imagej.net/ij/ (accessed on 28 January 2025).
- Huang, X.; El-Sayed, M.A. Gold Nanoparticles: Optical Properties and Implementations in Cancer Diagnosis and Photothermal Therapy. J. Adv. Res. 2010, 1, 13–28. [Google Scholar] [CrossRef]
- Catanzaro, L.; Scardaci, V.; Scuderi, M.; Condorelli, M.; D’Urso, L.; Compagnini, G. Surface Plasmon Resonance of Gold Nanoparticle Aggregates Induced by Halide Ions. Mater. Chem. Phys. 2023, 308, 128245. [Google Scholar] [CrossRef]
- Fernández-Ponce, C.; Muñoz-Miranda, J.P.; De Los Santos, D.M.; Aguado, E.; García-Cozar, F.; Litrán, R. Influence of Size and Surface Capping on Photoluminescence and Cytotoxicity of Gold Nanoparticles. J. Nanopart Res. 2018, 20, 305. [Google Scholar] [CrossRef]
- Findlay, J.; Poirel, L.; Kessler, J.; Kronenberg, A.; Nordmann, P. New Delhi Metallo-β-Lactamase–Producing Enterobacterales Bacteria, Switzerland, 2019–2020. Emerg. Infect. Dis. 2021, 27, 2628–2637. [Google Scholar] [CrossRef] [PubMed]
- Jha, N.G.; Dkhar, D.S.; Singh, S.K.; Malode, S.J.; Shetti, N.P.; Chandra, P. Engineered Biosensors for Diagnosing Multidrug Resistance in Microbial and Malignant Cells. Biosensors 2023, 13, 235. [Google Scholar] [CrossRef] [PubMed]
- Miller, W.R.; Arias, C.A. ESKAPE Pathogens: Antimicrobial Resistance, Epidemiology, Clinical Impact and Therapeutics. Nat. Rev. Microbiol. 2024, 22, 598–616. [Google Scholar] [CrossRef] [PubMed]
- Vaseghi, A.; Safaie, N.; Bakhshinejad, B.; Mohsenifar, A.; Sadeghizadeh, M. Detection of Pseudomonas Syringae Pathovars by Thiol-Linked DNA–Gold Nanoparticle Probes. Sens. Actuators B Chem. 2013, 181, 644–651. [Google Scholar] [CrossRef]
- Boodoo, C.; Dester, E.; David, J.; Patel, V.; Kc, R.; Alocilja, E.C. Multi-Probe Nano-Genomic Biosensor to Detect S. aureus from Magnetically-Extracted Food Samples. Biosensors 2023, 13, 608. [Google Scholar] [CrossRef]
- Majdinasab, M.; Aminlari, M.; Sheikhi, M.H.; Niakousari, M.; Shekarforoosh, S. Detection of inv A Gene of Salmonella by DNA-Gold Nanoparticles Biosensor and Its Comparison with PCR. J. Exp. Nanosci. 2013, 8, 223–239. [Google Scholar] [CrossRef]
- Liandris, E.; Gazouli, M.; Andreadou, M.; Čomor, M.; Abazovic, N.; Sechi, L.A.; Ikonomopoulos, J. Direct Detection of Unamplified DNA from Pathogenic Mycobacteria Using DNA-Derivatized Gold Nanoparticles. J. Microbiol. Methods 2009, 78, 260–264. [Google Scholar] [CrossRef]
- Gupta, N. DNA Extraction and Polymerase Chain Reaction. J. Cytol. 2019, 36, 116–117. [Google Scholar] [CrossRef] [PubMed]
- Josefsen, M.H.; Andersen, S.C.; Christensen, J.; Hoorfar, J. Microbial Food Safety: Potential of DNA Extraction Methods for Use in Diagnostic Metagenomics. J. Microbiol. Methods 2015, 114, 30–34. [Google Scholar] [CrossRef] [PubMed]
- Khan, D.; Thomas, S.-A.; Tientcheu, P.-E.; Suso, S.M.S.; Dupont, C.; Kwambana-Adams, B.; Mohammed, N.I.; Nicol, M.P.; Antonio, M. Comparison of DNA Concentration and Bacterial Pathogen PCR Detection When Using Two DNA Extraction Kits for Nasopharyngeal/Oropharyngeal Samples. PLoS ONE 2023, 18, e0289557. [Google Scholar] [CrossRef] [PubMed]
- Queipo-Ortuño, M.I.; De Dios Colmenero, J.; Macias, M.; Bravo, M.J.; Morata, P. Preparation of Bacterial DNA Template by Boiling and Effect of Immunoglobulin G as an Inhibitor in Real-Time PCR for Serum Samples from Patients with Brucellosis. Clin. Vaccine Immunol. 2008, 15, 293–296. [Google Scholar] [CrossRef]
- Ribeiro Junior, J.C.; Tamanini, R.; Soares, B.F.; Oliveira, A.M.D.; Silva, F.D.G.; Silva, F.F.D.; Augusto, N.A.; Beloti, V. Efficiency of Boiling and Four Other Methods for Genomic DNA Extraction of Deteriorating Spore-Forming Bacteria from Milk. Semin. Ciências Agrárias SCA 2016, 37, 3069. [Google Scholar] [CrossRef]
- Liu, W.; Zou, D.; Li, Y.; Wang, X.; He, X.; Wei, X.; Shao, C.; Li, X.; Shang, W.; Yu, K.; et al. Sensitive and Rapid Detection of the New Delhi Metallo-Beta-Lactamase Gene by Loop-Mediated Isothermal Amplification. J. Clin. Microbiol. 2012, 50, 1580–1585. [Google Scholar] [CrossRef]
- Dimitrakopoulou, M.-E.; Stavrou, V.; Kotsalou, C.; Vantarakis, A. Boiling Extraction Method VS Commercial Kits for Bacterial DNA Isolation from Food Samples. J. Food Sci. Nutr. Res. 2020, 3, 311–319. [Google Scholar] [CrossRef]
- Becker, L.; Steglich, M.; Fuchs, S.; Werner, G.; Nübel, U. Comparison of Six Commercial Kits to Extract Bacterial Chromosome and Plasmid DNA for MiSeq Sequencing. Sci. Rep. 2016, 6, 28063. [Google Scholar] [CrossRef]
- Yao, Y.; Imirzalioglu, C.; Falgenhauer, L.; Falgenhauer, J.; Heinmüller, P.; Domann, E.; Chakraborty, T. Plasmid-Mediated Spread of Carbapenem Resistance in Enterobacterales: A Three-Year Genome-Based Survey. Antibiotics 2024, 13, 682. [Google Scholar] [CrossRef] [PubMed]
- Hammoudi Halat, D.; Ayoub Moubareck, C. The Current Burden of Carbapenemases: Review of Significant Properties and Dissemination among Gram-Negative Bacteria. Antibiotics 2020, 9, 186. [Google Scholar] [CrossRef]
- Ouellette, M.; Bissonnette, L.; Roy, P.H. Precise Insertion of Antibiotic Resistance Determinants into Tn21-like Transposons: Nucleotide Sequence of the OXA-1 Beta-Lactamase Gene. Proc. Natl. Acad. Sci. USA 1987, 84, 7378–7382. [Google Scholar] [CrossRef]
- Kadibalban, A.S.; Landan, G.; Dagan, T. The Extent and Characteristics of DNA Transfer between Plasmids and Chromosomes. Curr. Biol. 2024, 34, 3189–3200.e5. [Google Scholar] [CrossRef] [PubMed]
- Abe, R.; Akeda, Y.; Sugawara, Y.; Matsumoto, Y.; Motooka, D.; Iida, T.; Hamada, S. Carbapenem Triggers Dissemination of Chromosomally Integrated Carbapenemase Genes via Conjugative Plasmids in Escherichia coli. mSystems 2023, 8, e0127522. [Google Scholar] [CrossRef] [PubMed]
- Wang, Y.; Batra, A.; Schulenburg, H.; Dagan, T. Gene Sharing among Plasmids and Chromosomes Reveals Barriers for Antibiotic Resistance Gene Transfer. Phil. Trans. R. Soc. B 2022, 377, 20200467. [Google Scholar] [CrossRef]












| Detection Method | Time Required | Advantages | Disadvantages | Sources |
|---|---|---|---|---|
| Modified Hodge test | 24–48 h | High sensitivity, simple procedure | Lack of specificity, time-consuming | [25] |
| Carba NP | 2 h | Rapid, high specificity | Inconsistent sensitivities | [26] |
| Traditional AST | 24–48 h | Inexpensive, quantitative or qualitative | Laborious, error-prone methods, time-consuming | [27,28,29,30,31] |
| PCR-based methods | 4–6 h | High sensitivity and specificity, no culture time needed | Expensive, complicated procedure, sensitive to experimental conditions | [10,32] |
| WGS | ~2 d | Accurate, sensitive | Complex data analysis, expensive, time-consuming | [33] |
| MALDI-TOF | 4 h | Rapid, inexpensive, simple procedure | Lack of specificity, database limitations, prolonged incubation time | [24,34,35] |
| CR Gene | Probe and Primer Sequences (5′ to 3′) | Length (bp) | Tm (°C) |
|---|---|---|---|
| blaNDM-1 | |||
| Probe 1: CAACACAGCCTGACTTTCGCCGCCAATGGCTGGGTCGAACCAGCAACCGC | 50 | 74.4 | |
| Probe 2: TGGCCCGCTCAAGGTATTTTACCCCGGCCCCGGCCACACCAGTGACAATA | 50 | 74.5 | |
| F-Primer: ATGGAATTGCCCAATATTAT [41] | 20 | 55.6 | |
| R-Primer: TCAGCGCAGCTTGTCGGCCA [41] | 20 | 71.0 | |
| blaOXA-1 | |||
| Probe: CGATGCATCCACAAACGCTGAAATTGCTCAATTCAATAAAGCAAAGTGTG | 50 | 66.2 | |
| F-Primer: ATATCTCTACTGTTGCATCTCC [42] | 22 | 59.3 | |
| R-Primer: AAACCCTTCAAACCATCC [42] | 18 | 57.5 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Kao, K.; Alocilja, E.C. Parallel Detection of the Unamplified Carbapenem Resistance Genes blaNDM-1 and blaOXA-1 Using a Plasmonic Nano-Biosensor with a Field-Portable DNA Extraction Method. Biosensors 2025, 15, 112. https://doi.org/10.3390/bios15020112
Kao K, Alocilja EC. Parallel Detection of the Unamplified Carbapenem Resistance Genes blaNDM-1 and blaOXA-1 Using a Plasmonic Nano-Biosensor with a Field-Portable DNA Extraction Method. Biosensors. 2025; 15(2):112. https://doi.org/10.3390/bios15020112
Chicago/Turabian StyleKao, Kaily, and Evangelyn C. Alocilja. 2025. "Parallel Detection of the Unamplified Carbapenem Resistance Genes blaNDM-1 and blaOXA-1 Using a Plasmonic Nano-Biosensor with a Field-Portable DNA Extraction Method" Biosensors 15, no. 2: 112. https://doi.org/10.3390/bios15020112
APA StyleKao, K., & Alocilja, E. C. (2025). Parallel Detection of the Unamplified Carbapenem Resistance Genes blaNDM-1 and blaOXA-1 Using a Plasmonic Nano-Biosensor with a Field-Portable DNA Extraction Method. Biosensors, 15(2), 112. https://doi.org/10.3390/bios15020112
