Lateral Flow Assay for Preeclampsia Screening Using DNA Hairpins and Surface-Enhanced Raman-Active Nanoprobes Targeting hsa-miR-17-5p
Abstract
1. Introduction
2. Materials and Method
2.1. Polyacrylamide Gel Electrophoresis (PAGE)
2.2. Synthesis of SERS-Active Silica-Coated Gold Nanostar (SiO2-AuNS) Nanoprobes
2.2.1. Gold Nanostar (AuNS) Synthesis
2.2.2. Raman Reporter Conjugation and Silica Shell Formation
2.2.3. DNA and Streptavidin Functionalization of the SiO2-AuNS Nanoprobes
2.3. Characterization of the Nanoprobes
2.4. Fabrication of Paper-Based Lateral Flow System and Sample Setup
2.5. Quantification of SERS and Colorimetric Signals on the LFA System
2.6. Preparation and Extraction of Cell-Free miRNAs from Spiked Human Serum Samples
2.7. Reverse Transcription Quantitative Polymerase Chain Reaction (RT-qPCR) of hsa-miR-17-5p Levels in Serum Samples
2.8. Statistical Analysis of RT-qPCR, Colorimetric, and SERS-Based Measurements Using the Statistical Package for Social Science (SPSS)
3. Results and Discussion
3.1. Validating the Capture and Detector of the miRNA Using Optimized DNA Hairpin Sequences
3.2. Characterization of Nanoprobes
3.3. Validation of hsa-miR-17-5p Levels in Spiked Serum Samples Using RT-qPCR
3.4. Measured SERS Intensity of hsa-miR-17-5p Levels in Water Aliquot of hsa-miR-17-5p and Spiked Serum Samples
4. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Espinoza, J.; Vidaeff, A.; Pettker, C.M.; Simhan, H. ACOG Practice Bulletin No. 202: Gestational Hypertension and Preeclampsia. Obstet. Gynecol. 2019, 133, 1. [Google Scholar] [CrossRef]
- Roberts, J.M.; August, P.A.; Bakris, G.; Barton, J.R.; Bernstein, I.M.; Druzin, M.; Gaiser, R.R.; Granger, J.P.; Jeyabalan, A.; Johnson, D.D.; et al. Hypertension in pregnancy. Report of the American College of Obstetricians and Gynecologists’ Task Force on Hypertension in Pregnancy. Obstet. Gynecol. 2013, 122, 1122–1131. [Google Scholar] [CrossRef]
- Poon, L.C.; Shennan, A.; Hyett, J.A.; Kapur, A.; Hadar, E.; Divakar, H.; McAuliffe, F.; da Silva Costa, F.; von Dadelszen, P.; McIntyre, H.D.; et al. The International Federation of Gynecology and Obstetrics (FIGO) initiative on pre-eclampsia: A pragmatic guide for first-trimester screening and prevention. Int. J. Gynaecol. Obstet. 2019, 145 (Suppl. S1), 1–33. [Google Scholar] [CrossRef] [PubMed]
- Magee, L.A.; Brown, M.A.; Hall, D.R.; Gupte, S.; Hennessy, A.; Karumanchi, S.A.; Kenny, L.C.; McCarthy, F.; Myers, J.; Poon, L.C.; et al. The 2021 International Society for the Study of Hypertension in Pregnancy classification, diagnosis & management recommendations for international practice. Pregnancy Hypertens. 2022, 27, 148–169. [Google Scholar] [CrossRef] [PubMed]
- US Preventive Services Task Force. Screening for Preeclampsia: US Preventive Services Task Force Recommendation Statement. JAMA 2017, 317, 1661–1667. [Google Scholar] [CrossRef]
- Stevens, W.; Shih, T.; Incerti, D.; Ton, T.G.; Lee, H.C.; Peneva, D.; Macones, G.A.; Sibai, B.M.; Jena, A.B. Short-term costs of preeclampsia to the United States health care system. Am. J. Obstet. Gynecol. 2017, 217, 237–248.e16. [Google Scholar] [CrossRef]
- Wu, P.; Green, M.; Myers, J.E. Hypertensive disorders of pregnancy. BMJ 2023, 381, e071653. [Google Scholar] [CrossRef]
- He, J.; Chen, C.; Xu, L.; Xiao, B.; Chen, Z.; Wen, T.; Wang, Y.X.J.; Liu, P. Diffusion-Derived Vessel Density Computed From a Simplified Intravoxel Incoherent Motion Imaging Protocol in Pregnancies Complicated by Early Preeclampsia: A Novel Biomarker of Placental Dysfunction. Hypertension 2023, 80, 1658–1667. [Google Scholar] [CrossRef]
- Turkevich, J.; Stevenson, P.C.; Hillier, J. A study of the nucleation and growth processes in the synthesis of colloidal gold. Discuss. Faraday Soc. 1951, 11, 55–75. [Google Scholar] [CrossRef]
- Zeisler, H.; Llurba, E.; Chantraine, F.; Vatish, M.; Staff, A.C.; Sennström, M.; Olovsson, M.; Brennecke, S.P.; Stepan, H.; Allegranza, D.; et al. Predictive Value of the sFlt-1:PlGF Ratio in Women with Suspected Preeclampsia. N. Engl. J. Med. 2016, 374, 13–22. [Google Scholar] [CrossRef]
- Malone, S.L.; Yahya, R.H.; Kane, S.C. Reviewing Accuracy of First Trimester Screening for Preeclampsia Using Maternal Factors and Biomarkers. Int. J. Womens Health 2022, 14, 1371–1384. [Google Scholar] [CrossRef] [PubMed]
- Wang, W.; Feng, L.; Zhang, H.; Hachy, S.; Satohisa, S.; Laurent, L.C.; Parast, M.; Zheng, J.; Chen, D.-B. Preeclampsia up-regulates angiogenesis-associated microRNA (i.e., miR-17, -20a, and -20b) that target ephrin-B2 and EPHB4 in human placenta. J. Clin. Endocrinol. Metab. 2012, 97, E1051–E1059. [Google Scholar] [CrossRef] [PubMed]
- Bounds, K.R.; Chiasson, V.L.; Pan, L.J.; Gupta, S.; Chatterjee, P. MicroRNAs: New Players in the Pathobiology of Preeclampsia. Front. Cardiovasc. Med. 2017, 4, 60. [Google Scholar] [CrossRef] [PubMed]
- Enquobahrie, D.A.; Abetew, D.F.; Sorensen, T.K.; Willoughby, D.; Chidambaram, K.; Williams, M.A. Placental microRNA expression in pregnancies complicated by preeclampsia. Am. J. Obstet. Gynecol. 2011, 204, 178.e112–178.e121. [Google Scholar] [CrossRef]
- Choudhury, M. Methods of Predicting Preeclampsia Using Biomarkers. U.S. Patent 11,344,121, 31 May 2022. [Google Scholar]
- Chevillet, J.R.; Kang, Q.; Ruf, I.K.; Briggs, H.A.; Vojtech, L.N.; Hughes, S.M.; Cheng, H.H.; Arroyo, J.D.; Meredith, E.K.; Gallichotte, E.N.; et al. Quantitative and stoichiometric analysis of the microRNA content of exosomes. Proc. Natl. Acad. Sci. USA 2014, 111, 14888–14893. [Google Scholar] [CrossRef]
- Wang, N.; Zhang, J.; Xiao, B.; Sun, X.; Xie, R.; Chen, A. Recent advances in the rapid detection of microRNA with lateral flow assays. Biosens. Bioelectron. 2022, 211, 114345. [Google Scholar] [CrossRef]
- Schatz, G.C.; Young, M.A.; Van Duyne, R.P. Electromagnetic mechanism of SERS. In Surface-Enhanced Raman Scattering: Physics and Applications; Springer: Berlin/Heidelberg, Germany, 2006; pp. 19–45. [Google Scholar]
- Lee, S.; Dang, H.; Moon, J.I.; Kim, K.; Joung, Y.; Park, S.; Yu, Q.; Chen, J.; Lu, M.; Chen, L.; et al. SERS-based microdevices for use as in vitro diagnostic biosensors. Chem. Soc. Rev. 2024, 53, 5394–5427. [Google Scholar] [CrossRef] [PubMed]
- Kim, K.; Kashefi-Kheyrabadi, L.; Joung, Y.; Kim, K.; Dang, H.; Chavan, S.G.; Lee, M.H.; Choo, J. Recent advances in sensitive surface-enhanced Raman scattering-based lateral flow assay platforms for point-of-care diagnostics of infectious diseases. Sens. Actuators B Chem. 2021, 329, 129214. [Google Scholar] [CrossRef]
- Perumal, J.; Wang, Y.; Attia, A.B.E.; Dinish, U.S.; Olivo, M. Towards a point-of-care SERS sensor for biomedical and agri-food analysis applications: A review of recent advancements. Nanoscale 2021, 13, 553–580. [Google Scholar] [CrossRef]
- Yuan, H.; Fales, A.M.; Khoury, C.G.; Liu, J.; Vo-Dinh, T. Spectral Characterization and Intracellular Detection of Surface-Enhanced Raman Scattering (SERS)-Encoded Plasmonic Gold Nanostars. J. Raman Spectrosc. 2013, 44, 234–239. [Google Scholar] [CrossRef]
- Schiestel, T.; Brunner, H.; Tovar, G.E. Controlled surface functionalization of silica nanospheres by covalent conjugation reactions and preparation of high density streptavidin nanoparticles. J. Nanosci. Nanotechnol. 2004, 4, 504–511. [Google Scholar] [CrossRef] [PubMed]
- Boelens, H.F.; Eilers, P.H.; Hankemeier, T. Sign constraints improve the detection of differences between complex spectral data sets: LC-IR as an example. Anal. Chem. 2005, 77, 7998–8007. [Google Scholar] [CrossRef] [PubMed]
- Lubin, A.A.; Plaxco, K.W. Folding-based electrochemical biosensors: The case for responsive nucleic acid architectures. Acc. Chem. Res. 2010, 43, 496–505. [Google Scholar] [CrossRef]
- Ma, D.L.; He, H.Z.; Leung, K.H.; Zhong, H.J.; Chan, D.S.; Leung, C.H. Label-free luminescent oligonucleotide-based probes. Chem. Soc. Rev. 2013, 42, 3427–3440. [Google Scholar] [CrossRef]
- Huang, Y.; Wen, W.; Du, D.; Zhang, X.; Wang, S.; Lin, Y. A universal lateral flow biosensor for proteins and DNAs based on the conformational change of hairpin oligonucleotide and its use for logic gate operations. Biosens. Bioelectron. 2014, 61, 598–604. [Google Scholar] [CrossRef]
- Zadeh, J.N.; Steenberg, C.D.; Bois, J.S.; Wolfe, B.R.; Pierce, M.B.; Khan, A.R.; Dirks, R.M.; Pierce, N.A. NUPACK: Analysis and design of nucleic acid systems. J. Comput. Chem. 2011, 32, 170–173. [Google Scholar] [CrossRef] [PubMed]
- Michota, A.; Bukowska, J. Surface-enhanced Raman scattering (SERS) of 4-mercaptobenzoic acid on silver and gold substrates. J. Raman Spectrosc. 2003, 34, 21–25. [Google Scholar] [CrossRef]
- Williams, Z.; Ben-Dov, I.Z.; Elias, R.; Mihailovic, A.; Brown, M.; Rosenwaks, Z.; Tuschl, T. Comprehensive profiling of circulating microRNA via small RNA sequencing of cDNA libraries reveals biomarker potential and limitations. Proc. Natl. Acad. Sci. USA 2013, 110, 4255–4260. [Google Scholar] [CrossRef]
- Geekiyanage, H.; Rayatpisheh, S.; Wohlschlegel, J.A.; Brown, R., Jr.; Ambros, V. Extracellular microRNAs in human circulation are associated with miRISC complexes that are accessible to anti-AGO2 antibody and can bind target mimic oligonucleotides. Proc. Natl. Acad. Sci. USA 2020, 117, 24213–24223. [Google Scholar] [CrossRef]
- Arroyo, J.D.; Chevillet, J.R.; Kroh, E.M.; Ruf, I.K.; Pritchard, C.C.; Gibson, D.F.; Mitchell, P.S.; Bennett, C.F.; Pogosova-Agadjanyan, E.L.; Stirewalt, D.L.; et al. Argonaute2 complexes carry a population of circulating microRNAs independent of vesicles in human plasma. Proc. Natl. Acad. Sci. USA 2011, 108, 5003–5008. [Google Scholar] [CrossRef]
- Luo, S.-S.; Ishibashi, O.; Ishikawa, G.; Ishikawa, T.; Katayama, A.; Mishima, T.; Takizawa, T.; Shigihara, T.; Goto, T.; Izumi, A.; et al. Human villous trophoblasts express and secrete placenta-specific microRNAs into maternal circulation via exosomes. Biol. Reprod. 2009, 81, 717–729. [Google Scholar] [CrossRef] [PubMed]
- Salomon, C.; Yee, S.W.; Mitchell, M.D.; Rice, G.E. The possible role of extravillous trophoblast-derived exosomes on the uterine spiral arterial remodeling under both normal and pathological conditions. Biomed Res. Int. 2014, 2014, 693157. [Google Scholar] [CrossRef] [PubMed]
- Armbruster, D.A.; Pry, T. Limit of blank, limit of detection and limit of quantitation. Clin. Biochem. Rev. 2008, 29 (Suppl. S1), S49–S52. [Google Scholar] [PubMed] [PubMed Central]







| Name | Sequence (5′ to 3′) |
|---|---|
| Detector Hairpin | /5BioTEG/AAAAAAAAAAAGGTCTACCTGCA |
| Capture Hairpin | CTGTAGCACTTTGCTAAAAAAA/3BioTEG/ |
| Control Line Capture Hairpin | TGCAGGTAGCCTTTTTTTTTTT/3BioTEG/ |
| hsa-miR-17-5p (Target) | CAAAGUGCUACAGUGCAGGUAGU |
| hsa-miR-20a-5p | UAAAGUGCUUCAGUGCAGGUAGU |
| hsa-miR-122-5p | UGGAGUGUGACAAUGGUGUUUG |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Ng, K.W.; Jaitpal, S.; Vu, N.N.; San Juan, A.M.T.; Tripathy, S.; Kodam, R.S.; Bastiray, A.; Cho, J.-H.; Choudhury, M.; Coté, G.L.; et al. Lateral Flow Assay for Preeclampsia Screening Using DNA Hairpins and Surface-Enhanced Raman-Active Nanoprobes Targeting hsa-miR-17-5p. Biosensors 2024, 14, 535. https://doi.org/10.3390/bios14110535
Ng KW, Jaitpal S, Vu NN, San Juan AMT, Tripathy S, Kodam RS, Bastiray A, Cho J-H, Choudhury M, Coté GL, et al. Lateral Flow Assay for Preeclampsia Screening Using DNA Hairpins and Surface-Enhanced Raman-Active Nanoprobes Targeting hsa-miR-17-5p. Biosensors. 2024; 14(11):535. https://doi.org/10.3390/bios14110535
Chicago/Turabian StyleNg, Ka Wai, Siddhant Jaitpal, Ngoc Nhu Vu, Angela Michelle T. San Juan, Sayantan Tripathy, Rohit Sai Kodam, Abhishek Bastiray, Jae-Hyun Cho, Mahua Choudhury, Gerard L. Coté, and et al. 2024. "Lateral Flow Assay for Preeclampsia Screening Using DNA Hairpins and Surface-Enhanced Raman-Active Nanoprobes Targeting hsa-miR-17-5p" Biosensors 14, no. 11: 535. https://doi.org/10.3390/bios14110535
APA StyleNg, K. W., Jaitpal, S., Vu, N. N., San Juan, A. M. T., Tripathy, S., Kodam, R. S., Bastiray, A., Cho, J.-H., Choudhury, M., Coté, G. L., & Mabbott, S. (2024). Lateral Flow Assay for Preeclampsia Screening Using DNA Hairpins and Surface-Enhanced Raman-Active Nanoprobes Targeting hsa-miR-17-5p. Biosensors, 14(11), 535. https://doi.org/10.3390/bios14110535

