A Multianalyte Electrochemical Genosensor for the Detection of High-Risk HPV Genotypes in Oral and Cervical Cancers
Abstract
1. Introduction
2. Materials and Methods
2.1. Chemicals, Kits, and Instrumentation
2.2. Design of Primers and Probes
2.3. Preparation of the Silica Seed Nanoparticles
2.4. Loading of SiNPs with Redox-Active Dye
2.5. Preparation of the Reporter Probe
2.6. Preparation of Capture Probe
2.7. Target Hybridization and Signal Detection
2.8. Sensitivity and Specificity of the Assay
2.9. Extraction of Genomic DNA from Clinical Samples
2.10. Nested PCR and Detection of HPV-16 and HPV-18 from Clinical Samples
2.11. Ethical Consideration
2.12. Statistical Analysis
3. Results and Discussion
3.1. Characterization of the Silica Nanoparticles (SiNPs) and Silica Redox-Active Dye (Si-Dye)
3.2. Optimization of the Assay Conditions
3.3. Analytical Performance of the Assay
3.4. Detection of HPV-16 and HPV-18 in Two Different Types of Clinical Samples
4. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Bray, F.; Ferlay, J.; Soerjomataram, I.; Siegel, R.L.; Torre, L.A.; Jemal, A.J.C. Global cancer statistics 2018: GLOBOCAN estimates of incidence and mortality worldwide for 36 cancers in 185 countries. CA Cancer J. Clin. 2018, 68, 394–424. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Akbulut, N.; Oztas, B.; Kursun, S.; Evirgen, S. Delayed diagnosis of oral squamous cell carcinoma: A case series. J. Med. Case Rep. 2011, 5, 1–4. [Google Scholar] [CrossRef] [Scilit]
- Oh, L.J.; Asher, R.; Veness, M.; Smee, R.; Goldstein, D.; Iyer, N.G.; Balasubramanian, D.; Low, T.-H.H.; Palme, C.E.; Gupta, R.J.O.O. Effect of age and gender in non-smokers with oral squamous cell carcinoma: Multi-institutional study. Oral Oncol. 2021, 116, 105210. [Google Scholar] [CrossRef] [Scilit]
- Vokes, E.E.; Agrawal, N.; Seiwert, T.Y. HPV-associated head and neck cancer. JNCI J. Natl. Cancer Inst. 2015, 107, djv344. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- de Martel, C.; Plummer, M.; Vignat, J.; Franceschi, S. Worldwide burden of cancer attributable to HPV by site, country and HPV type. Int. J. Cancer 2017, 141, 664–670. [Google Scholar] [CrossRef] [Scilit]
- Baig, S.; Zaman, U.; Lucky, M.H. Human papilloma virus 16/18: Fabricator of trouble in oral squamous cell carcinoma. Int. J. Infect. Dis. 2018, 69, 115–119. [Google Scholar]
- Ndiaye, C.; Mena, M.; Alemany, L.; Arbyn, M.; Castellsagué, X.; Laporte, L.; Bosch, F.X.; de Sanjosé, S.; Trottier, H. HPV DNA, E6/E7 mRNA, and p16INK4a detection in head and neck cancers: A systematic review and meta-analysis. Lancet Oncol. 2014, 15, 1319–1331. [Google Scholar] [CrossRef] [Scilit]
- Bouda, M.; Gorgoulis, V.G.; Kastrinakis, N.G.; Giannoudis, A.; Tsoli, E.; Danassi-Afentaki, D.; Foukas, P.; Kyroudi, A.; Laskaris, G.; Herrington, C.S. “High risk” HPV types are frequently detected in potentially malignant and malignant oral lesions, but not in normal oral mucosa. Mod. Pathol. 2000, 13, 644–653. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Liao, G.; Jiang, X.; She, B.; Tang, H.; Wang, Z.; Zhou, H.; Ma, Y.; Xu, W.; Xu, H.; Chen, W. Multi-Infection Patterns and Co-infection Preference of 27 Human Papillomavirus Types Among 137,943 Gynecological Outpatients Across China. Front. Oncol. 2020, 10, 449. [Google Scholar] [CrossRef] [Scilit]
- Martin-Gomez, L.; Giuliano, A.R.; Fulp, W.J.; Caudell, J.; Echevarria, M.; Sirak, B.; Abrahamsen, M.; Isaacs-Soriano, K.A.; Hernandez-Prera, J.C.; Wenig, B.M.; et al. Human papillomavirus genotype detection in oral gargle samples among men with newly diagnosed oropharyngeal squamous cell carcinoma. JAMA Otolaryngol. Neck Surg. 2019, 145, 460–466. [Google Scholar] [CrossRef] [Scilit]
- Elrefaey, S.; Massaro, M.; Chiocca, S.; Chiesa, F.; Ansarin, M. HPV in oropharyngeal cancer: The basics to know in clinical practice. Acta Otorhinolaryngol. Ital. 2014, 34, 299. [Google Scholar] [PubMed]
- Burd, E.M. Human papillomavirus laboratory testing: The changing paradigm. Clin. Microbiol. Rev. 2016, 29, 291–319. [Google Scholar] [CrossRef] [Scilit]
- Peyton, C.; Schiffman, M.; Lorincz, A.; Hunt, W.; Mielzynska, I.; Bratti, C.; Eaton, S.; Hildesheim, A.; Morera, L.; Rodriguez, A.C. Comparison of PCR-and hybrid capture-based human papillomavirus detection systems using multiple cervical specimen collection strategies. J. Clin. Microbiol. 1998, 36, 3248–3254. [Google Scholar] [CrossRef] [Scilit]
- Espinosa, J.R.; Galván, M.; Quiñones, A.S.; Ayala, J.L.; Durón, S.M.J.S. DNA biosensor based on double-layer discharge for the detection of HPV type 16. Sensors 2019, 19, 3956. [Google Scholar] [CrossRef] [Scilit]
- Ramesh, T.; Foo, K.L.; Haarindraprasad, R.; Sam, A.J.; Solayappan, M. Gold-Hybridized Zinc oxide nanorods as Real-time Low-cost nanoBiosensors for Detection of virulent DNA signature of HPV-16 in cervical carcinoma. Sci. Rep. 2019, 9, 1–17. [Google Scholar] [CrossRef] [Scilit]
- Pareek, S.; Jain, U.; Bharadwaj, M.; Chauhan, N.J.S.; Research, B.-S. A label free nanosensing platform for the detection of cervical cancer through analysis of ultratrace DNA hybridization. Sens. Bio-Sensing Res. 2021, 33, 100444. [Google Scholar] [CrossRef] [Scilit]
- Mahmoodi, P.; Rezayi, M.; Rasouli, E.; Avan, A.; Gholami, M.; Mobarhan, M.G.; Karimi, E.; Alias, Y. Early-stage cervical cancer diagnosis based on an ultra-sensitive electrochemical DNA nanobiosensor for HPV-18 detection in real samples. J. Nanobiotechnol. 2020, 18, 1–12. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Gichki, A.S.; Buajeeb, W.; Doungudomdacha, S.; Khovidhunkit, S.-O.P. Detection of human papillomavirus in normal oral cavity in a group of Pakistani subjects using real-time PCR. Asian Pac. J. Cancer Prev. 2012, 13, 2299–2304. [Google Scholar] [CrossRef] [Scilit]
- Sotlar, K.; Diemer, D.; Dethleffs, A.; Hack, Y.; Stubner, A.; Vollmer, N.; Menton, S.; Menton, M.; Dietz, K.; Wallwiener, D. Detection and typing of human papillomavirus by e6 nested multiplex PCR. J. Clin. Microbiol. 2004, 42, 3176–3184. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Rossi, L.M.; Shi, L.; Quina, F.H.; Rosenzweig, Z.J.L. Stöber synthesis of monodispersed luminescent silica nanoparticles for bioanalytical assays. Langmuir 2005, 21, 4277–4280. [Google Scholar] [CrossRef] [Scilit]
- Cheeveewattanagul, N.; Rijiravanich, P.; Surareungchai, W.; Somasundrum, M. Loading of silicon nanoparticle labels with redox mediators for detection of multiple DNA targets within a single voltammetric sweep. J. Electroanal. Chem. 2016, 779, 61–66. [Google Scholar] [CrossRef] [Scilit]
- Prasongdee, P.; Tippayawat, P.; Limpaiboon, T.; Leelayuwat, C.; Wongwattanakul, M.; Jearanaikoon, P. The development of simultaneous measurement of viral load and physical status for human papillomavirus 16 and 18 co-infection using multiplex quantitative polymerase chain reaction. Oncol. Lett. 2018, 16, 6977–6987. [Google Scholar] [CrossRef] [Scilit]
- Vladimir, G.; Giorgia, G.; Filip, K.; Monopoli, M.P.; Moore, C.J. Dye-doped silica nanoparticles: Synthesis, surface chemistry and bioapplications. Cancer Nanotechnol. 2020, 11, 1. [Google Scholar]
- Chaibun, T.; Puenpa, J.; Ngamdee, T.; Boonapatcharoen, N.; Athamanolap, P.; O’Mullane, A.P.; Vongpunsawad, S.; Poovorawan, Y.; Lee, S.Y.; Lertanantawong, B. Rapid electrochemical detection of coronavirus SARS-CoV-2. Nat. Commun. 2021, 12, 1–10. [Google Scholar] [CrossRef] [Scilit]
- Yeap, C.S.; Chaibun, T.; Lee, S.Y.; Zhao, B.; Jan, Y.; Surareungchai, W.; Song, S.; Lertanantawong, B.J.C.C. Ultrasensitive pathogen detection with a rolling circle amplification-empowered multiplex electrochemical DNA sensor. Chem. Commun. 2021, 57, 12155–12158. [Google Scholar] [CrossRef] [Scilit]
- Campos-Ferreira, D.S.; Nascimento, G.A.; Souza, E.V.; Souto-Maior, M.A.; Arruda, M.S.; Zanforlin, D.M.; Ekert, M.H.; Bruneska, D.; Lima-Filho, J.L. Electrochemical DNA biosensor for human papillomavirus 16 detection in real samples. Anal. Chim. Acta 2013, 804, 258–263. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Jampasa, S.; Wonsawat, W.; Rodthongkum, N.; Siangproh, W.; Yanatatsaneejit, P.; Vilaivan, T.; Chailapakul, O. Electrochemical detection of human papillomavirus DNA type 16 using a pyrrolidinyl peptide nucleic acid probe immobilized on screen-printed carbon electrodes. Biosens. Bioelectron. 2014, 54, 428–434. [Google Scholar] [CrossRef] [Scilit]
- Bartosik, M.; Jirakova, L.; Anton, M.; Vojtesek, B.; Hrstka, R. Genomagnetic LAMP-based electrochemical test for determination of high-risk HPV16 and HPV18 in clinical samples. Anal. Chim. Acta 2018, 1042, 37–43. [Google Scholar] [CrossRef] [Scilit]
- Parmin, N.A.; Hashim, U.; Gopinath, S.C.; Nadzirah, S.; Rejali, Z.; Afzan, A.; Uda, M.; Hong, V.; Rajapaksha, R.J.M.A. Voltammetric determination of human papillomavirus 16 DNA by using interdigitated electrodes modified with titanium dioxide nanoparticles. Mikrochim. Acta 2019, 186, 1–9. [Google Scholar] [CrossRef] [Scilit]
- Lin, J.; Gopinath, S.C.; Lakshmipriya, T.; Chen, Y.; Yuan, W.R.; Yang, M.J.I.j.o.b.m. Target DNA detection of human papilloma virus-16 E7 gene by capture-target-reporter sandwich on interdigitated electrode sensor. Int. J. Biol. Macromol. 2019, 141, 564–569. [Google Scholar] [CrossRef] [Scilit]
- Civit, L.; Fragoso, A.; Hölters, S.; Dürst, M.; O’Sullivan, C.K.J.A.c.a. Electrochemical genosensor array for the simultaneous detection of multiple high-risk human papillomavirus sequences in clinical samples. Anal. Chim. Acta 2012, 715, 93–98. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Lucena, R.P.; Frías, I.A.; Lucena-Silva, N.; Andrade, C.A.; Oliveira, M.D.L. Biotechnology. Impedimetric genosensor based on graphene nanoribbons for detection and identification of oncogenic types of human papillomavirus. J. Chem. Technol. Biotechnol. 2021, 96, 1496–1503. [Google Scholar] [CrossRef] [Scilit]





| Type | Primer Name | Sequence (5′→3′) | Length (Bases) | Reference |
|---|---|---|---|---|
| HPV-16 Outer primer | GP-E6-3F | GGGWGKKACTGAAATCGGT | 19 | [19] |
| GP-E6-5B | CTGAGCTGTCARNTAATTGCTCA | 23 | [19] | |
| GP-E6-6B | TCCTCTGAGTYGYCTAATTGCTC | 23 | [19] | |
| HPV-16 Inner primer | Forward | CACAGTTATGCACAGAGCTGC | 21 | [19] |
| Reverse | CATATATTCATGCAATGTAGGTGT | 24 | [19] | |
| HPV-16 Probes and linear targets | HPV-16-CP | Biotin-GTGTGTACTGCAAGCAAC | 18 | This study |
| HPV-16-RP | TGCGACGTGAGGTATATG-Biotin | 18 | This study | |
| HPV-16-LT | ATCCCGAAAAGCAAAGTCATATACCTCACGTCGCAGTAACTGTTGCTT GCAGTACACACATTCTAATATTATATATGTA TAGTTGTTTGCAGCTCT GTGCATAACTGTG | 110 | This study | |
| HPV-16-1m LT | AGTCATATACCTCACGTCGCAGTAACTGTTGCTTGCGGTACACACATT | 48 | This study | |
| HPV-16-3m LT | AGTCATATACCTCACGTCGCAGTAACTGTTGCTTGCGACACACACATT | 48 | This study | |
| HPV-18 Outer primer | Forward | TGAAATTCCGGTTGACCTTC | 20 | [18] |
| Reverse | GGTCGTCTGCTGAGCTTTCT | 20 | [18] | |
| HPV-18 Inner primer | Forward | ATGTCACGAGCAATTAAGC | 19 | [18] |
| Reverse | TTCTGGCTTCACACTTACAACA | 22 | [18] | |
| HPV-18 Probes and linear targets | HPV-18-CP | Biotin-CCACAACGTCACACAATG | 18 | This study |
| HPV-18-RP | GTGTTGTAA GTGTGAAGC-Biotin | 18 | This study | |
| HPV-18-LT | TTCTGGCTTCACACTTACAACACATACACAACATTGTGTGACGTTGTGGTTCGGCTCGTCGGGCTGGTAAATGTTGATGATTAACTCCATCTATTT CATCGTTTTCTTCCTCTGAGTCGCTTAATTGCTCGTGACAT | 137 | This study | |
| HPV-18-1m LT | CTGGCTTCACACTTACAACACATACACAACATTGTGTGGCGTTGTGGTTCGGCT | 54 | This study | |
| HPV-18-3m LT | CTGGCTTCACACTTACAACACATACACAACATTGTGCAGCGTTGTGGTTCGGCT | 54 | This study | |
| HPV-16/18 Blocking probe | dT10_BP | TTTTTTTTTT-Biotin | 10 | This study |
| Non-complementary linear target | HAV-LT | CGTTGAATGGTTTTTGTCTTAACAACTCACCAATATCCGCCGCTGTTACC | 50 | This Study |
| HBV-LT | AAGATGTTGTACAGACTTGGCCCCCAATACCACATCATCCATATAACTGA AAGCCAA | 57 | This Study | |
| HCV-LT | CTGCGTGAAGACAGTAGTTCCTCACAGGGGAGTGATTCATGGTGGAGTGTCGCCC | 55 | This Study | |
| HEV-LT | GGATTGCGAAGGGCTGAGAATCAACCCGGTCACCCCAGAAACCACCGCC GG | 51 | This Study |
| Sensor Platform | Technique | Target | LOD | Reference |
|---|---|---|---|---|
| Reduction signals of methylene blue on L-cysteine film modified gold electrode surface | Differential pulse voltammetry | HPV-16 | 18.13 nM | [26] |
| Immobilized anthraquinone-labeled pyrrolidinyl peptide nucleic acid probe on chitosan-modified disposable SPCE | Square-wave voltammetry | HPV-16 | 4 nM | [27] |
| Potential relaxation of the double layer of a DNA-modified gold electrode | Electrochemical impedance spectroscopy | HPV-16 | 0.38 nM | [14] |
| Detection of loop-mediated amplification (LAMP) products on carbon-based electrode chips with chronoamperometric monitoring of benzoquinone reduction | Chronoamperometry | HPV-16 | 0.1 ng | [28] |
| Modified indium tin oxide electrode coated with chitosan capped gold nanoparticles | Square wave voltammetry | HPV-16 | 1 pM | [16] |
| DNA hybridization on interdigitated electrode chips surface modified with gold doped zinc oxide nanorods | Electrochemical impedance spectroscopy | HPV-16 | 1 fM | [15] |
| Interdigitated electrodes modified with titanium dioxide nanoparticles | Unspecified voltammetric technique | HPV-16 | 0.1 fM | [29] |
| Carbodiimidazole-modified interdigitated electrode with reporter conjugated gold nanorod | Unspecified voltammetric technique | HPV-16 | 1 aM | [30] |
| Reduced graphene oxide and multiwalled carbon nanotubes with L-cysteine functionalized gold nanoparticles on SPCE | Differential pulse voltammetry | HPV-18 | 0.05 fM | [17] |
| Gold electrodes co-immobilized with thiolated probe and bipodal alkanethiol with horseradish peroxidase-labelled reporter probe | Chronoamperometry | HPV-16 HPV-18 | 220 pM 170 pM | [31] |
| Electrochemical signal of silica-methylene blue (HPV-16) and silica-acridine orange (HPV-18) reporter probes on SPCE | Differential pulse voltammetry | HPV-16 HPV-18 | 20 fM 22 fM | This study |
| Clinical Samples | No. of Sample | HPV-16 | HPV-18 | ||||||
|---|---|---|---|---|---|---|---|---|---|
| Nested PCR/Gel Electrophoresis | Biosensor | Nested PCR/Gel Electrophoresis | Biosensor | ||||||
| + | − | + | − | + | − | + | − | ||
| WBC DNA (negative control) | 1 | 0 | 1 | 0 | 1 | 0 | 1 | 0 | 1 |
| SiHa cell (HPV-16 positive control) | 1 | 1 | 0 | 1 | 0 | 0 | 0 | 0 | 0 |
| HeLa cell (HPV-18 positive control) | 1 | 0 | 0 | 0 | 0 | 1 | 0 | 1 | 0 |
| Normal mucosa | 14 | 0 | 14 | 0 | 14 | 0 | 14 | 0 | 14 |
| Oral lichen planus | 25 | 0 | 25 | 0 | 25 | 0 | 25 | 0 | 25 |
| Oral leukoplakia | 3 | 0 | 3 | 0 | 3 | 0 | 3 | 0 | 3 |
| OSCC | 13 | 1 | 12 | 1 | 12 | 1 | 12 | 1 | 12 |
| Cervical lesions | 25 | 16 | 9 | 16 | 9 | 11 | 14 | 11 | 14 |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Chaibun, T.; Thanasapburachot, P.; Chatchawal, P.; Su Yin, L.; Jiaranuchart, S.; Jearanaikoon, P.; Promptmas, C.; Buajeeb, W.; Lertanantawong, B. A Multianalyte Electrochemical Genosensor for the Detection of High-Risk HPV Genotypes in Oral and Cervical Cancers. Biosensors 2022, 12, 290. https://doi.org/10.3390/bios12050290
Chaibun T, Thanasapburachot P, Chatchawal P, Su Yin L, Jiaranuchart S, Jearanaikoon P, Promptmas C, Buajeeb W, Lertanantawong B. A Multianalyte Electrochemical Genosensor for the Detection of High-Risk HPV Genotypes in Oral and Cervical Cancers. Biosensors. 2022; 12(5):290. https://doi.org/10.3390/bios12050290
Chicago/Turabian StyleChaibun, Thanyarat, Patcharanin Thanasapburachot, Patutong Chatchawal, Lee Su Yin, Sirimanas Jiaranuchart, Patcharee Jearanaikoon, Chamras Promptmas, Waranun Buajeeb, and Benchaporn Lertanantawong. 2022. "A Multianalyte Electrochemical Genosensor for the Detection of High-Risk HPV Genotypes in Oral and Cervical Cancers" Biosensors 12, no. 5: 290. https://doi.org/10.3390/bios12050290
APA StyleChaibun, T., Thanasapburachot, P., Chatchawal, P., Su Yin, L., Jiaranuchart, S., Jearanaikoon, P., Promptmas, C., Buajeeb, W., & Lertanantawong, B. (2022). A Multianalyte Electrochemical Genosensor for the Detection of High-Risk HPV Genotypes in Oral and Cervical Cancers. Biosensors, 12(5), 290. https://doi.org/10.3390/bios12050290

