Biocompatibility Analysis of the Silver-Coated Microporous Titanium Implants Manufactured with 3D-Printing Technology
Abstract
1. Introduction
2. Materials and Methods
2.1. Silver-Coated 3D-Printed Titanium Samples
2.2. 3D Printing vs. Sintering
2.3. Specifics of 3D Printing Fabrication
- Type of additive printing process, DMLM.
- Parameters used for 3D printing-Mesh+
- Slice thickness for generating build file-30 microns
2.4. Specifics of Silver Coating of the Samples
2.5. Cells
2.6. MTT Assay
2.7. Scanning Electron Microscopy
2.8. Real-Time PCR Analysis
2.9. Statistical Analysis
3. Results
3.1. Analysis of Cell Viability and Adhesion on the Silver-Coated 3D-Printed Titanium Implants
3.2. Evaluation of Cell Adhesion Markers Expression for MC3T3-E1 Osteoblasts and Dermal Fibroblasts Grown on Silver-Coated 3D-Printed Titanium Implants
3.3. Evaluation of the Genes Expression Related to Osteogenic Processes for MC3T3-E1 Osteoblast Cells Cultured on Silver-Coated 3D-Printed Titanium Implants
4. Discussion
5. Conclusions
Author Contributions
Funding
Data Availability Statement
Conflicts of Interest
Abbreviations
| ALP | alkaline phosphatase |
| ATP | adenosine triphosphate |
| BMD | bone mineral density |
| BMP | bone morphogenic protein |
| CaP | calcium phosphate |
| CFU | colony-forming units |
| COL-1 | type I collagen |
| CT | computed tomography |
| DNA | deoxyribonucleic acid |
| DSA | direct skeletal attachment |
| EBM | electron beam melting |
| ECM | extracellular matrix |
| ERK | extracellular signal-regulated kinase |
| FAK | focal adhesion kinase |
| Fosl1 | fos-related antigen 1 |
| GAPDH | glyceraldehyde 3-phosphate dehydrogenase |
| HA | hydroxyapatite |
| MAPK | mitogen-activated protein kinase |
| ML-ALD | molecular layering of atomic layer deposition |
| MTT assay | 3-[4,5-dimethylthiazol]-2, 5-diphenylterazolium bromide assay |
| OCN | octeocalcin |
| OPG | osteoprotegerin |
| PCR | polymerase chain reaction |
| PVD | physical vapor deposition |
| RANKL | receptor activator of nuclear factor kappa-Β ligand |
| RNA | ribonucleic acid |
| RhoA | ras homolog family member A |
| ROS | reactive oxygen species |
| RT-PCR | real-time polymerase chain reaction |
| Runx2 | runt-related transcription factor 2 |
| SBIP | skin and bone integrated pylon |
| SLM | selective laser melting |
| SMAD4 | SMAD family member 4, Mothers against decapentaplegic homolog 4 |
| TGF-β1 | transforming growth factor beta |
References
- Kaspiris, A.; Vasiliadis, E.; Pantazaka, E.; Lianou, I.; Melissaridou, D.; Savvidis, M.; Panagopoulos, F.; Tsalimas, G.; Vavourakis, M.; Kolovos, I.; et al. Current Progress and Future Perspectives in Contact and Releasing-Type Antimicrobial Coatings of Orthopaedic Implants: A Systematic Review Analysis Emanated from In Vitro and In Vivo Models. Infect. Dis. Rep. 2024, 16, 298–316. [Google Scholar] [CrossRef] [PubMed]
- Funao, H.; Nagai, S.; Sasaki, A.; Hoshikawa, T.; Tsuji, T.; Okada, Y.; Koyasu, S.; Toyama, Y.; Nakamura, M.; Aizawa, M.; et al. A novel hydroxyapatite film coated with ionic silver via inositol hexaphosphate chelation prevents implant-associated infection. Sci. Rep. 2016, 6, 23238. [Google Scholar] [CrossRef] [PubMed]
- Sedighi, O.; Bednarke, B.; Sherriff, H.; Doiron, A.L. Nanoparticle-Based Strategies for Managing Biofilm Infections in Wounds: A Comprehensive Review. ACS Omega 2024, 9, 27853–27871. [Google Scholar] [CrossRef] [PubMed]
- Shevtsov, M.A.; Yudintceva, N.M.; Blinova, M.I.; Voronkina, I.V.; Suslov, D.N.; Galibin, O.V.; Gavrilov, D.V.; Akkaoui, M.; Raykhtsaum, G.; Albul, A.V.; et al. Evaluation of the temporary effect of physical vapor deposition silver coating on resistance to infection in transdermal skin and bone integrated pylon with deep porosity. J. Biomed. Mater. Res. B Appl. Biomater. 2019, 107, 169–177. [Google Scholar] [CrossRef] [PubMed Central]
- Godoy-Gallardo, M.; Eckhard, U.; Delgado, L.M.; de Roo Puente, Y.J.D.; Hoyos-Nogués, M.; Gil, F.J.; Perez, R.A. Antibacterial approaches in tissue engineering using metal ions and nanoparticles: From mechanisms to applications. Bioact. Mater. 2021, 6, 4470–4490. [Google Scholar] [CrossRef]
- Frei, A.; Verderosa, A.D.; Elliott, A.G.; Zuegg, J.; Blaskovich, M.A.T. Metals to combat antimicrobial resistance. Nat. Rev. Chem. 2023, 7, 202–224. [Google Scholar] [CrossRef]
- Algadi, H.; Alhoot, M.A.; Al-Maleki, A.R.; Purwitasari, N. Effects of Metal and Metal Oxide Nanoparticles against Biofilm-Forming Bacteria: A systematic Review. J. Microbiol. Biotechnol. 2024, 34, 1748–1756. [Google Scholar] [CrossRef]
- Tran, N.; Tran, P.A.; Jarrell, J.D.; Engiles, J.B.; Thomas, N.P.; Young, M.D.; Hayda, R.A.; Born, C.T. In vivo caprine model for osteomyelitis and evaluation of biofilm-resistant intramedullary nails. BioMed Res. Int. 2013, 2013, 674378. [Google Scholar] [CrossRef]
- Rosário, F.; Hoet, P.; Santos, C.; Oliveira, H. Death and cell cycle progression are differently conditioned by the AgNP size in osteoblast-like cells. Toxicology 2016, 368-369, 103–115. [Google Scholar] [CrossRef]
- Rosário, F.; Hoet, P.; Nogueira, A.J.A.; Santos, C.; Oliveira, H. Differential pulmonary in vitro toxicity of two small-sized polyvinylpyrrolidone-coated silver nanoparticles. J. Toxicol. Environ. Health A 2018, 81, 675–690. [Google Scholar] [CrossRef]
- Xie, K.; Zhou, Z.; Guo, Y.; Wang, L.; Li, G.; Zhao, S.; Liu, X.; Li, J.; Jiang, W.; Wu, S.; et al. Long-Term Prevention of Bacterial Infection and Enhanced Osteoinductivity of a Hybrid Coating with Selective Silver Toxicity. Adv. Healthc. Mater. 2019, 8, e1801465. [Google Scholar] [CrossRef] [PubMed]
- Kuo, Y.J.; Chen, C.H.; Dash, P.; Lin, Y.C.; Hsu, C.W.; Shih, S.J.; Chung, R.J. Angiogenesis, Osseointegration, and Antibacterial Applications of Polyelectrolyte Multilayer Coatings Incorporated With Silver/Strontium Containing Mesoporous Bioactive Glass on 316L Stainless Steel. Front. Bioeng. Biotechnol. 2022, 10, 818137. [Google Scholar] [CrossRef] [PubMed]
- Svensson, S.; Suska, F.; Emanuelsson, L.; Palmquist, A.; Norlindh, B.; Trobos, M.; Bäckros, H.; Persson, L.; Rydja, G.; Ohrlander, M.; et al. Osseointegration of titanium with an antimicrobial nanostructured noble metal coating. Nanomedicine 2013, 9, 1048–1056. [Google Scholar] [CrossRef] [PubMed]
- Veronesi, F.; Giavaresi, G.; Fini, M.; Longo, G.; Ioannidu, C.A.; Scotto d’Abusco, A.; Superti, F.; Panzini, G.; Misiano, C.; Palattella, A.; et al. Osseointegration is improved by coating titanium implants with a nanostructured thin film with titanium carbide and titanium oxides clustered around graphitic carbon. Mater. Sci. Eng. C Mater. Biol. Appl. 2017, 70 Pt 1, 264–271. [Google Scholar] [CrossRef]
- Mahmood, M.; Li, Z.; Casciano, D.; Khodakovskaya, M.V.; Chen, T.; Karmakar, A.; Dervishi, E.; Xu, Y.; Mustafa, T.; Watanabe, F.; et al. Nanostructural materials increase mineralization in bone cells and affect gene expression through miRNA regulation. J. Cell. Mol. Med. 2011, 15, 2297–2306. [Google Scholar] [CrossRef]
- Qin, H.; Zhu, C.; An, Z.; Jiang, Y.; Zhao, Y.; Wang, J.; Liu, X.; Hui, B.; Zhang, X.; Wang, Y. Silver nanoparticles promote osteogenic differentiation of human urine-derived stem cells at noncytotoxic concentrations. Int. J. Nanomed. 2014, 9, 2469–2478. [Google Scholar] [CrossRef]
- Jia, Z.; Xiu, P.; Li, M.; Xu, X.; Shi, Y.; Cheng, Y.; Wei, S.; Zheng, Y.; Xi, T.; Cai, H.; et al. Bioinspired anchoring AgNPs onto micro-nanoporous TiO2 orthopedic coatings: Trap-killing of bacteria, surface-regulated osteoblast functions and host responses. Biomaterials 2016, 75, 203–222. [Google Scholar] [CrossRef]
- Qing, T.; Mahmood, M.; Zheng, Y.; Biris, A.S.; Shi, L.; Casciano, D.A. A genomic characterization of the influence of silver nanoparticles on bone differentiation in MC3T3-E1 cells. J. Appl. Toxicol. 2018, 38, 172–179. [Google Scholar] [CrossRef]
- Cao, H.; Zhang, W.; Meng, F.; Guo, J.; Wang, D.; Qian, S.; Jiang, X.; Liu, X.; Chu, P.K. Osteogenesis Catalyzed by Titanium-Supported Silver Nanoparticles. ACS Appl. Mater. Interfaces 2017, 9, 5149–5157. [Google Scholar] [CrossRef]
- Xie, H.; Wang, P.; Wu, J. Effect of exposure of osteoblast-like cells to low-dose silver nanoparticles: Uptake, retention and osteogenic activity. Artif. Cells Nanomed. Biotechnol. 2019, 47, 260–267. [Google Scholar] [CrossRef]
- Shevtsov, M.; Pitkin, E.; Combs, S.E.; Meulen, G.V.D.; Preucil, C.; Pitkin, M. Comparison In Vitro Study on the Interface between Skin and Bone Cell Cultures and Microporous Titanium Samples Manufactured with 3D Printing Technology Versus Sintered Samples. Nanomaterials 2024, 14, 1484. [Google Scholar] [CrossRef] [PubMed]
- Marconi, G.D.; Fonticoli, L.; Della Rocca, Y.; Oliva, S.; Rajan, T.S.; Trubiani, O.; Murmura, G.; Diomede, F.; Pizzicannella, J. Enhanced Extracellular Matrix Deposition on Titanium Implant Surfaces: Cellular and Molecular Evidences. Biomedicines 2021, 9, 1710. [Google Scholar] [CrossRef] [PubMed]
- Chen, G.; Deng, C.; Li, Y.P. TGF-β and BMP signaling in osteoblast differentiation and bone formation. Int. J. Biol. Sci. 2012, 8, 272–288. [Google Scholar] [CrossRef]
- Guo, X.; Wang, X.F. Signaling cross-talk between TGF-beta/BMP and other pathways. Cell Res. 2009, 19, 71–88. [Google Scholar] [CrossRef] [PubMed]
- Wagner, D.O.; Sieber, C.; Bhushan, R.; Börgermann, J.H.; Graf, D.; Knaus, P. BMPs: From bone to body morphogenetic proteins. Sci. Signal. 2010, 3, mr1. [Google Scholar] [CrossRef] [PubMed]
- Shelton, T.J.; Peter Beck, J.; Bloebaum, R.D.; Bachus, K.N. Percutaneous osseointegrated prostheses for amputees: Limb compensation in a 12-month ovine model. J. Biomech. 2011, 44, 2601–2606. [Google Scholar] [CrossRef]
- Pitkin, M.; Raykhtsaum, G. Skin Integrated Device. U.S. Patent 8257435, 4 September 2012. Available online: https://www.google.com/patents/US8257435 (accessed on 12 October 2024).
- Farrell, B.; Prilutsky, B.; Kistenberg, R.; Dalton, J.; Strong, A.; Pitkin, M. An animal model to study skin-implant-bone integration and prosthetic gait with limb prostheses directly attached to the residual limb. Clin. Biomech. 2014, 29, 336–349. [Google Scholar] [CrossRef] [PubMed Central]
- Farrell, B.; Prilutsky, B.; Ritter, J.; Kelley, S.; Popat, K.; Pitkin, M. Effects of pore size, implantation time and nano-surface properties on rat skin ingrowth into percutaneous porous titanium implants. J. Biomed. Mater. Res. Part A 2014, 102, 1305–1315. [Google Scholar] [CrossRef] [PubMed Central]
- Pitkin, M.; Raykhtsaum, G.; Pilling, J.; Shukeylo, Y.; Moxson, V.; Duz, V.; Lewandowski, J.; Connolly, R.; Kistenberg, R.; Dalton, J.; et al. Mathematical modeling and mechanical and histopathological testing of porous prosthetic pylon for direct skeletal attachment. J. Rehabil. Res. Dev. 2009, 46, 315–330. [Google Scholar] [CrossRef] [PubMed Central]
- Pitkin, M.; Pilling, J.; Raykhtsaum, G. Mechanical properties of totally permeable titanium composite pylon for direct skeletal attachment. J. Biomed. Mater. Res. Part B Appl. Biomater. 2012, 100, 993–999. [Google Scholar] [CrossRef] [PubMed Central]
- Fang, Z.Z.; Paramore, J.D.; Sun, P.; Chandran, K.R.; Zhang, Y.; Xia, Y.; Cao, F.; Koopman, M.; Free, M. Powder metallurgy of titanium–past, present, and future. Int. Mater. Rev. 2018, 63, 407–459. [Google Scholar] [CrossRef]
- Ng, W.L.; An, J.; Chua, C.K. Process, material, and regulatory considerations for 3D printed medical devices and tissue constructs. Engineering 2024, 36, 146–166. [Google Scholar] [CrossRef]
- Sandler, N.; Salmela, I.; Fallarero, A.; Rosling, A.; Khajeheian, M.; Kolakovic, R.; Genina, N.; Nyman, J.; Vuorela, P. Towards fabrication of 3D printed medical devices to prevent biofilm formation. Int. J. Pharm. 2014, 459, 62–64. [Google Scholar] [CrossRef] [PubMed]
- Pitkin, M. In-bone implantable shaft for prosthetic joints or for direct skeletal attachment of external limb prostheses and method of its installation. U.S. Patent 8992615, 31 March 2015. Available online: https://patents.google.com/patent/US8992615B2/en (accessed on 12 October 2024).
- Shevtsov, M.; Gavrilov, D.; Yudintceva, N.; Zemtsova, E.; Arbenin, A.; Smirnov, V.; Voronkina, I.; Adamova, P.; Blinova, M.; Mikhailova, N.; et al. Protecting the skin-implant interface with transcutaneous silver-coated skin-and-bone-intergrated-pylon (SBIP) in pig and rabbit dorsum models. J. Biomed. Mater. Res. B Appl. Biomater. 2021, 34725, 584–595. [Google Scholar] [CrossRef]
- Pitkin, M.; Cassidy, C.; Shevtsov, M.A.; Jarrell, J.R.; Park, H.; Farrell, B.J.; Dalton, J.F.; Childers, W.L.; Kistenberg, R.S.; Oh, K.; et al. Recent Progress in Animal Studies of the Skin- and Bone-integrated Pylon With Deep Porosity for Bone-Anchored Limb Prosthetics With and Without Neural Interface. Mil. Med. 2021, 186 (Suppl. S1), 688–695. [Google Scholar] [CrossRef] [PubMed]
- Atkinson, H.V.; Davies, S. Fundamental aspects of hot isostatic pressing: An overview. Metall. Mater. Trans. A 2000, 31, 2981–3000. [Google Scholar] [CrossRef]
- Karlin, W.; Cassidy, C.; Villany, M.; Virgous, C.; Jean, S.S.; Meulen, G.; Preucil, M.; Schevtsov, M.; Combs, E.; Pitkin, M. Pilot porcine study with osseointegrated 3D-printed titanium Skin and Bone Integrated Pylons (SBIP-3D) structured selectively for bone and skin interfaces. Nanomaterials, 2024; 15, In preparation for publication. [Google Scholar]
- SreeHarsha, K.S. Principles of Physical Vapor Deposition of Thin Films, 1st ed.; Elsevier: Amsterdam, The Netherlands; Boston, MA, USA, 2006; 1160p. [Google Scholar]
- Alexander, J.W. History of the medical use of silver. Surg. Infect. 2009, 10, 289–292. [Google Scholar] [CrossRef]
- Park, E.J.; Bae, E.; Yi, J.; Kim, Y.; Choi, K.; Lee, S.H.; Yoon, J.; Lee, B.C.; Park, K. Repeated-dose toxicity and inflammatory responses in mice by oral administration of silver nanoparticles. Environ. Toxicol. Pharmacol. 2010, 30, 162–168. [Google Scholar] [CrossRef]
- Bertrand, C.; Zalouk-Vergnoux, A.; Giamberini, L.; Poirier, L.; Devin, S.; Labille, J.; Perrein-Ettajani, H.; Pagnout, C.; Chatel, A.; Levard, C.; et al. The influence of salinity on the fate and behavior of silver standardized nanomaterial and toxicity effects in the estuarine bivalve Scrobicularia plana. Environ. Toxicol. Chem. 2016, 35, 2550–2561. [Google Scholar] [CrossRef]
- Boudreau, M.D.; Imam, M.S.; Paredes, A.M.; Bryant, M.S.; Cunningham, C.K.; Felton, R.P.; Jones, M.Y.; Davis, K.J.; Olson, G.R. Differential Effects of Silver Nanoparticles and Silver Ions on Tissue Accumulation, Distribution, and Toxicity in the Sprague Dawley Rat Following Daily Oral Gavage Administration for 13 Weeks. Toxicol. Sci. 2016, 150, 131–160. [Google Scholar] [CrossRef] [PubMed]
- Cox, A.; Venkatachalam, P.; Sahi, S.; Sharma, N. Silver and titanium dioxide nanoparticle toxicity in plants: A review of current research. Plant Physiol. Biochem. 2016, 107, 147–163. [Google Scholar] [CrossRef] [PubMed]
- Gao, J.; Mahapatra, C.T.; Mapes, C.D.; Khlebnikova, M.; Wei, A.; Sepulveda, M.S. Vascular toxicity of silver nanoparticles to developing zebrafish (Danio rerio). Nanotoxicology 2016, 10, 1363–1372. [Google Scholar] [CrossRef]
- Liao, C.; Li, Y.; Tjong, S.C. Bactericidal and cytotoxic properties of silver nanoparticles. Int. J. Mol. Sci. 2019, 20, 449. [Google Scholar] [CrossRef]
- Cui, C.; Zhao, Y.; Bai, Z.; Yan, J.; Qin, D.; Peng, H.; Liu, Y.; Tong, J.; Sun, L.; Wu, X.; et al. The Effect of Antibacterial-Osteogenic Surface Modification on the Osseointegration of Titanium Implants: A Static and Dynamic Strategy. ACS Biomater. Sci. Eng. 2024, 10, 4093–4113. [Google Scholar] [CrossRef]
- Li, B.; Thebault, P.; Labat, B.; Ladam, G.; Alt, V.; Rupp, M.; Brochausen, C.; Jantsch, J.; Ip, M.; Zhang, N.; et al. Implants coating strategies for antibacterial treatment in fracture and defect models: A systematic review of animal studies. J. Orthop. Transl. 2024, 45, 24–35. [Google Scholar] [CrossRef]
- Li, H.; Wang, D.; Zhang, W.; Xu, G.; Xu, C.; Liu, W.; Li, J. Potential side effects of antibacterial coatings in orthopaedic implants: A systematic review of clinical studies. Front. Bioeng. Biotechnol. 2023, 11, 1111386. [Google Scholar] [CrossRef]
- van Hengel, I.A.J.; Putra, N.E.; Tierolf, M.; Minneboo, M.; Fluit, A.C.; Fratila-Apachitei, L.E.; Apachitei, I.; Zadpoor, A.A. Biofunctionalization of selective laser melted porous titanium using silver and zinc nanoparticles to prevent infections by antibiotic-resistant bacteria. Acta Biomater. 2020, 107, 325–337. [Google Scholar] [CrossRef]
- van Hengel, I.A.J.; Tierolf, M.; Valerio, V.P.M.; Minneboo, M.; Fluit, A.C.; Fratila-Apachitei, L.E.; Apachitei, I.; Zadpoor, A.A. Self-defending additively manufactured bone implants bearing silver and copper nanoparticles. J. Mater. Chem. B 2020, 8, 1589–1602. [Google Scholar] [CrossRef]
- Riool, M.; Dirks, A.J.; Jaspers, V.; de Boer, L.; Loontjens, T.J.; van der Loos, C.M.; Florquin, S.; Apachitei, I.; Rijk, L.N.; Keul, H.A.; et al. A chlorhexidine-releasing epoxy-based coating on titanium implants prevents Staphylococcus aureus experimental biomaterial-associated infection. Eur. Cells Mater. 2017, 33, 143–157. [Google Scholar] [CrossRef]
- Chimutengwende-Gordon, M.; Pendegrass, C.; Blunn, G. The in vivo effect of a porous titanium alloy flange with hydroxyapatite, silver and fibronectin coatings on soft-tissue integration of intraosseous transcutaneous amputation prostheses. Bone Joint J. 2017, 99, 393–400. [Google Scholar] [CrossRef] [PubMed]
- Savvidou, O.D.; Kaspiris, A.; Goumenos, S.; Trikoupis, I.; Melissaridou, D.; Kalogeropoulos, A.; Serenidis, D.; Georgoulis, J.D.; Lianou, I.; Koulouvaris, P.; et al. Knee Arthrodesis with a Modular Silver-Coated Endoprosthesis for Infected Total Knee Arthroplasty with Extensive Bone Loss: A Retrospective Case-Series Study. J. Clin. Med. 2023, 12, 3600. [Google Scholar] [CrossRef] [PubMed]
- Ghimire, A.; Song, J. Anti-Periprosthetic Infection Strategies: From Implant Surface Topographical Engineering to Smart Drug-Releasing Coatings. ACS Appl. Mater. Interfaces 2021, 13, 20921–20937. [Google Scholar] [CrossRef] [PubMed]
- Ghimire, A.; Skelly, J.D.; Song, J. Micrococcal-Nuclease-Triggered On-Demand Release of Vancomycin from Intramedullary Implant Coating Eradicates Staphylococcus aureus Infection in Mouse Femoral Canals. ACS Cent. Sci. 2019, 5, 1929–1936. [Google Scholar] [CrossRef]
- Skelly, J.D.; Chen, F.; Chang, S.Y.; Ujjwal, R.R.; Ghimire, A.; Ayers, D.C.; Song, J. Modulating On-Demand Release of Vancomycin from Implant Coatings via Chemical Modification of a Micrococcal Nuclease-Sensitive Oligonucleotide Linker. ACS Appl. Mater. Interfaces 2023, 15, 37174–37183. [Google Scholar] [CrossRef]
- Chen, F.; Skelly, J.D.; Chang, S.Y.; Song, J. Triggered Release of Ampicillin from Metallic Implant Coatings for Combating Periprosthetic Infections. ACS Appl. Mater. Interfaces 2024, 16, 24421–24430. [Google Scholar] [CrossRef]
- Wang, H.; Xiong, C.; Yu, Z.; Zhang, J.; Huang, Y.; Zhou, X. Research Progress on Antibacterial Coatings for Preventing Implant-Related Infection in Fractures: A Literature Review. Coatings 2022, 12, 1921. [Google Scholar] [CrossRef]
- Gerits, E.; Kucharíková, S.; Van Dijck, P.; Erdtmann, M.; Krona, A.; Lövenklev, M.; Fröhlich, M.; Dovgan, B.; Impellizzeri, F.; Braem, A.; et al. Antibacterial activity of a new broad-spectrum antibiotic covalently bound to titanium surfaces. J. Orthop. Res. 2016, 34, 2191–2198. [Google Scholar] [CrossRef]
- Huang, B.; Tan, L.; Liu, X.; Li, J.; Wu, S. A facile fabrication of novel stuff with antibacterial property and osteogenic promotion utilizing red phosphorus and near-infrared light. Bioact. Mater. 2019, 4, 17–21. [Google Scholar] [CrossRef]
- Peeters, E.; Hooyberghs, G.; Robijns, S.; De Weerdt, A.; Kucharíková, S.; Tournu, H.; Braem, A.; Čeh, K.; Majdič, G.; Španič, T.; et al. An antibiofilm coating of 5-aryl-2-aminoimidazole covalently attached to a titanium surface. J. Biomed. Mater Res. B Appl. Biomater. 2019, 107, 1908–1919. [Google Scholar] [CrossRef]






| Sample Identifier (SI) | % Porous | % Solid | Average Pore Diameter (µm) | Strut Diameter (µm) |
|---|---|---|---|---|
| S1 | 71.4 | 28.6 | 1000 | 270 |
| S2 | 67.3 | 32.7 | 890 | 270 |
| S3 | 62.7 | 37.3 | 770 | 270 |
| S4 | 56.8 | 43.2 | 690 | 260 |
| S5 | 50.0 | 50.0 | 590 | 270 |
| S6 | 41.3 | 58.7 | 500 | 270 |
| S7 | 21.2 | 78.8 | 420 | 250 |
| S8 | 31.1 | 68.9 | 310 | 250 |
| S9 | 19.5 | 80.5 | 210 | 230 |
| Gene | Primers (5′–3′) | Product Length (bp) |
|---|---|---|
| α2 integrin |
Fwd AAGTGCCCTGTGGACCTACCCA Rev TGGTGAGGGTCAATCCCAGGCT | 119 |
| α5 integrin |
Fwd ACCACCTGCAGAAACGAGAGGC Rev TGGCCCAAACTCACAGCGCA | 111 |
| αV integrin |
Fwd TCCCACCGCAGGCTGACTTCAT Rev TCGGGTTTCCAAGGTCGCACAC | 121 |
| β1 integrin | Fwd TTCAGACTTCCGCATTGGCT Rev AATGGGCTGGTGCAGTTTTG | 122 |
| Fibronectin | Fwd TGCAGTGGCTGAAGTCGCAAGG Rev GGGCTCCCCGTTTGAATTGCCA | 119 |
| Vitronectin | Fwd TGTTGATGCAGCGTTCGCCCT Rev TCCTGGCTGGGTTGCTGCTGAA | 114 |
| Type I collagen | Fwd CTCCTGACGCATGGCCAAGAA Rev TCAAGCATACCTCGGGTTTCCA | 100 |
| Vinculin | Fwd TCAAGCTGTTGGCAGTAGCCGC Rev TCTCTGCTGTGGCTCCAAGCCT | 120 |
| FAK | Fwd AGCACCTGGCCACCTAAGCAAC Rev CATTGGACCGGTCAAGGTTGGCA | 125 |
| Paxillin | Fwd AGGGCCTGGAACAGAGAGTGGA Rev AGCTGCTCCCAGTTTTCCCCTG | 129 |
| TGF-β1 | Fwd ACCCGCGTGCTAATGGTGGA Rev GGGCACTGCTTCCCGAATGTCT | 111 |
| SMAD4 | Fwd AGCCAGGACAGCAGCAGAATGGA Rev ATGGCCGTTTTGGTGGTGAGGC | 128 |
| Osteocalcin | Fwd AGCAGGAGGGCAATAAGGTAGT Rev TCGTCACAAGCAGGGTTAAGC | 118 |
| Osteonectin |
Fwd ATGTCCTGGTCACCTTGTACGA Rev TCCAGGCGCTTCTCATTCTCAT | 103 |
| Osteopontin |
Fwd TGATTCTGGCAGCTCAGAGGA Rev CATTCTGTGGCGCAAGGAGATT | 110 |
| MC3T3-E1 Osteoblasts | ||||||||||||
| Blank Control | Sintered Ti Sample | 3D-Printed Ti Sample | S1 | S2 | S3 | S4 | S5 | S6 | S7 | S8 | S9 | |
| 1 d | 98.13 (1) | 95.97 (1.7) | 98.13 (0.85) | 94 (2.07) | 94.43 (1.57) | 91.4 (2.17) | 92.7 (1.61) | 93.9 (3.93) | 91.37 (1.31) | 91.97 (1.99) | 92.5 (1.97) | 92.63 (2.48) |
| 3 d | 97.37 (2.17) | 94.7 (0.98) | 94.27 (2.1) | 88.77 (2.14) | 90.57 (0.81) | 91.4 (2.43) | 89.43 (1.03) | 90.07 (1.31) | 91.07 (2.06) | 88.83 (1.21) | 89.93 (1.65) | 88.07 (1.78) |
| 7 d | 95.47 (0.74) | 91.57 (2.28) | 90.7 (0.72) | 76.43 (2.4) | 74.73 (2.85) | 74.63 (3.29) | 73.1 (2.99) | 73.6 (2.29) | 72.93 (2.38) | 74.2 (3.39) | 75 (2.91) | 73.57 (3.7) |
| 14 d | 90.8 (0.56) | 88.03 (1.8) | 82.83 (2.4) | 64.77 (1.67) | 65.37 (1.68) | 64.97 (1.8) | 67.4 (4.09) | 66.03 (3.61) | 64.2 (2.09) | 64.47 (2.35) | 63.13 (2.75) | 63.93 (1.72) |
| Dermal Fibroblasts | ||||||||||||
| Blanc Control | Sintered Ti Sample | 3D-Printed Ti Sample | S1 | S2 | S3 | S4 | S5 | S6 | S7 | S8 | S9 | |
| 1 d | 97.83 (1.31) | 96.3 (3.83) | 94.57 (2.57) | 93.93 (2.5) | 93.57 (3.07) | 93.93 (1.85) | 93.8 (2.23) | 94.4 (4.23) | 92.43 (1.68) | 94.4 (4.2) | 91.4 (2.02) | 94.07 (3.52) |
| 3 d | 98.5 (1.35) | 94.53 (4.28) | 92.63 (1.66) | 86.37 (1.5) | 86.3 (1.25) | 85.5 (2.43) | 87.73 (3.8) | 86.5 (2.33) | 86.23 (2.55) | 87.73 (3.12) | 88.07 (3.18) | 89.57 (2.1) |
| 7 d | 94.3 (3.86) | 91.87 (1.65) | 92.4 (2.59) | 76.77 (2.68) | 76.83 (1.23) | 73.87 (0.91) | 72.67 (2.04) | 72.2 (3.16) | 73.77 (2.68) | 75.1 (2.7) | 74.77 (3.15) | 71.67 (1.27) |
| 14 d | 89.63 (2.1) | 84 (2.4) | 83.83 (2.7) | 68.77 (2.59) | 68.9 (1.82) | 69.5 (2.96) | 68.2 (1.85) | 66.6 (2.76) | 68.4 (2.31) | 67.3 (2.69) | 64.67 (3.67) | 66.83 (5.73) |
| α2 Integrin (Collagen-Specific) | |||||||||
| S1 | S2 | S3 | S4 | S5 | S6 | S7 | S8 | S9 | |
| 4 h | 1.27 (0.09) | 1.15 (0.09) | 1.2 (0.08) | 1.3 (0.07) | 1.22 (0.03) | 1.3 (0.1) | 1.3 (0.03) | 1.23 (0.1) | 1.26 (0.13) |
| 24 h | 1.35 (0.2) | 1.36 (0.07) | 1.38 (0.06) | 2 (0.07) | 2.07 (0.08) | 2.13 (0.05) | 1.77 (0.08) | 1.48 (0.06) | 1.17 (0.07) |
| 48 h | 1.65 (0.14) | 1.74 (0.06) | 1.64 (0.03) | 2.37 (0.05) | 3.63 (0.3) | 4.1 (0.1) | 4.14 (0.08) | 3.71 (0.3) | 3.13 (0.13) |
| 72 h | 2.21 (0.12) | 2.8 (0.1) | 2.76 (0.25) | 2.96 (0.08) | 3.87 (0.22) | 5.05 (0.06) | 4.82 (0.1) | 4.21 (0.16) | 3.8 (0.36) |
| α5 Integrin (Fibronectin-Specific) | |||||||||
| S1 | S2 | S3 | S4 | S5 | S6 | S7 | S8 | S9 | |
| 4 h | 1.08 (0.06) | 1.31 (0.08) | 1.3 (0.07) | 1.33 (0.08) | 1.12 (0.11) | 1.22 (0.15) | 1.46 (0.04) | 1.42 (0.02) | 1.28 (0.04) |
| 24 h | 2.12 (0.25) | 1.33 (0.06) | 1.29 (0.17) | 1.99 (0.06) | 1.91 (0.02) | 2.28 (0.16) | 2.22 (0.12) | 1.66 (0.12) | 1.48 (0.04) |
| 48 h | 2.28 (0.09) | 2.12 (0.08) | 1.91 (0.02) | 2.25 (0.07) | 3.08 (0.06) | 3.53 (0.32) | 3.65 (0.14) | 3.15 (0.05) | 2.78 (0.18) |
| 72 h | 2.99 (0.1) | 2.8 (0.27) | 2.84 (0.13) | 3.27 (0.24) | 4 (0.34) | 5.34 (0.37) | 5.03 (0.06) | 4.38 (0.25) | 4 (0.11) |
| αV Integrin (Vitronectin-Specific) | |||||||||
| S1 | S2 | S3 | S4 | S5 | S6 | S7 | S8 | S9 | |
| 4 h | 1.2 (0.18) | 1.08 (0.08) | 1.22 (0.06) | 1.21 (0.12) | 1.32 (0.12) | 1.4 (0.1) | 1.17 (0.19) | 1.05 (0.07) | 1.22 (0.06) |
| 24 h | 1.45 (0.15) | 1.18 (0.05) | 1.3 (0.11) | 1.7 (0.13) | 2.01 (0.03) | 2.36 (0.38) | 2.71 (0.08) | 1.91 (0.09) | 1.69 (0.11) |
| 48 h | 2.31 (0.17) | 1.78 (0.1) | 1.69 (0.08) | 1.9 (0.1) | 3.55 (0.09) | 4.03 (0.15) | 4.11 (0.1) | 3.71 (0.51) | 3.27 (0.22) |
| 72 h | 2.41 (0.17) | 2.7 (0.27) | 2.86 (0.14) | 3.1 (0.54) | 4.16 (0.13) | 5.2 (0.08) | 4.97 (0.06) | 4.07 (0.29) | 3.42 (0.23) |
| β1 Integrin | |||||||||
| S1 | S2 | S3 | S4 | S5 | S6 | S7 | S8 | S9 | |
| 4 h | 0.84 (0.13) | 0.77 (0.08) | 0.9 (0.08) | 1.08 (0.1) | 1.14 (0.09) | 1.08 (0.05) | 1.29 (0.02) | 1.11 (0.15) | 1.05 (0.07) |
| 24h | 1.04 (0.09) | 1.12 (0.11) | 1.26 (0.15) | 1.14 (0.09) | 1.34 (0.05) | 1.56 (0.23) | 1.59 (0.02) | 1.4 (0.02) | 1.2 (0.12) |
| 48 h | 1.22 (0.17) | 1.2 (0.01) | 1.08 (0.1) | 1.11 (0.08) | 1.49 (0.11) | 2.02 (0.03) | 2.16 (0.03) | 1.79 (0.06) | 1.57 (0.06) |
| 72 h | 1.41 (0.09) | 1.25 (0.15) | 1.26 (0.1) | 1.3 (0.02) | 1.6 (0.26) | 2.27 (0.1) | 1.91 (0.09) | 1.58 (0.19) | 1.54 (0.23) |
| Vitronectin | |||||||||
| S1 | S2 | S3 | S4 | S5 | S6 | S7 | S8 | S9 | |
| 1 d | 1.39 (0.12) | 1.9 (0.13) | 1.68 (0.05) | 1.79 (0.21) | 1.77 (0.05) | 2.23 (0.05) | 2.07 (0.1) | 1.85 (0.13) | 1.86 (0.17) |
| 7 d | 3.22 (0.06) | 3.24 (0.13) | 3.39 (0.03) | 3.5 (0.09) | 4.09 (0.08) | 5 (0.11) | 5.05 (0.06) | 4.21 (0.17) | 4.05 (0.13) |
| Fibronectin | |||||||||
| S1 | S2 | S3 | S4 | S5 | S6 | S7 | S8 | S9 | |
| 1 d | 1.38 (0.04) | 1.54 (0.07) | 1.68 (0.05) | 1.87 (0.05) | 1.53 (0.05) | 1.99 (0.06) | 1.67 (0.17) | 1.64 (0.18) | 1.42 (0.04) |
| 7 d | 2.87 (0.12) | 2.81 (0.06) | 2.94 (0.07) | 3.13 (0.05) | 4.06 (0.06) | 5.18 (0.21) | 5.12 (0.32) | 4.55 (0.07) | 3.91 (0.12) |
| Type I Collagen | |||||||||
| S1 | S2 | S3 | S4 | S5 | S6 | S7 | S8 | S9 | |
| 1 d | 1.24 (0.14) | 1.39 (0.03) | 1.83 (0.07) | 2.26 (0.06) | 2.5 (0.07) | 2.6 (0.19) | 2.33 (0.21) | 2.08 (0.11) | 1.79 (0.21) |
| 7 d | 3.39 (0.04) | 3.51 (0.09) | 3.56 (0.22) | 3.89 (0.11) | 4.44 (0.27) | 4.96 (0.03) | 5.03 (0.09) | 4.33 (0.05) | 3.84 (0.51) |
| Paxillin | |||||||||
| S1 | S2 | S3 | S4 | S5 | S6 | S7 | S8 | S9 | |
| 1 d | 1.19 (0.02) | 1.33 (0.05) | 1.11 (0.09) | 1.43 (0.17) | 1.55 (0.06) | 1.4 (0.12) | 1.27 (0.15) | 1.06 (0.05) | 1.11 (0.07) |
| 3 d | 2.24 (0.12) | 2.56 (0.16) | 3.11 (0.08) | 4.16 (0.1) | 4.05 (0.2) | 3.3 (0.12) | 3.07 (0.1) | 2.55 (0.4) | 2.68 (0.29) |
| 7 d | 3.76 (0.1) | 3.94 (0.07) | 4.76 (0.05) | 4.97 (0.11) | 5.53 (0.28) | 4.33 (0.34) | 3.14 (0.14) | 2.86 (0.08) | 2.59 (0.06) |
| 14 d | 4.82 (0.13) | 5.05 (0.06) | 5.88 (0.1) | 5.98 (0.08) | 6.23 (0.11) | 5.45 (0.3) | 4.33 (0.34) | 4.15 (0.23) | 4.25 (0.23) |
| FAK | |||||||||
| S1 | S2 | S3 | S4 | S5 | S6 | S7 | S8 | S9 | |
| 1 d | 1.07 (0.05) | 1.15 (0.05) | 0.99 (0.06) | 1.08 (0.14) | 0.8 (0.13) | 0.91 (0.07) | 0.82 (0.08) | 0.7 (0.23) | 0.9 (0.05) |
| 3 d | 2.12 (0.04) | 2.3 (0.07) | 2.48 (0.05) | 2.34 (0.16) | 2.2 (0.1) | 1.89 (0.09) | 2 (0.24) | 1.71 (0.28) | 1.79 (0.2) |
| 7 d | 3.11 (0.09) | 3.26 (0.07) | 3.54 (0.07) | 3.54 (0.04) | 3.41 (0.23) | 2.43 (0.24) | 2.21 (0.64) | 2.14 (0.23) | 2.04 (0.12) |
| 14 d | 4.18 (0.1) | 4.36 (0.15) | 4.65 (0.06) | 5 (0.1) | 4.78 (0.13) | 4.21 (0.16) | 3.73 (0.39) | 3.15 (0.06) | 3.21 (0.2) |
| Vinculin | |||||||||
| S1 | S2 | S3 | S4 | S5 | S6 | S7 | S8 | S9 | |
| 1 d | 0.43 (0.06) | 0.56 (0.14) | 0.71 (0.08) | 1.07 (0.07) | 0.85 (0.11) | 1.04 (0.06) | 0.65 (0.08) | 0.75 (0.08) | 0.85 (0.11) |
| 3 d | 0.89 (0.04) | 1.09 (0.08) | 1.19 (0.09) | 2.17 (0.1) | 2.05 (0.06) | 1.72 (0.29) | 1.17 (0.19) | 1.1 (0.03) | 1.25 (0.08) |
| 7 d | 1.5 (0.08) | 1.68 (0.06) | 1.97 (0.13) | 3.05 (0.06) | 3.14 (0.14) | 2.83 (0.12) | 2.07 (0.07) | 1.5 (0.15) | 1.56 (0.09) |
| 14 d | 2.62 (0.03) | 2.8 (0.03) | 3.97 (0.13) | 4.15 (0.15) | 4.94 (0.13) | 4.57 (0.42) | 3.2 (0.08) | 2.99 (0.04) | 2.98 (0.43) |
| Osteocalcin | |||||||||
| S1 | S2 | S3 | S4 | S5 | S6 | S7 | S8 | S9 | |
| 1 d | 1.13 (0.22) | 0.99 (0.05) | 0.85 (0.07) | 1.19 (0.13) | 1.57 (0.18) | 1.33 (0.55) | 1.02 (0.11) | 0.92 (0.03) | 0.89 (0.12) |
| 3 d | 2.04 (0.08) | 2.36 (0.14) | 3.23 (0.08) | 3.41 (0.2) | 4.08 (0.12) | 2.76 (0.07) | 2.05 (0.11) | 1.95 (0.06) | 1.79 (0.22) |
| 7 d | 3.75 (0.06) | 4.1 (0.11) | 4.42 (0.07) | 5.18 (0.1) | 5.54 (0.29) | 3.31 (0.12) | 2.83 (0.1) | 2.75 (0.19) | 2.76 (0.18) |
| 14 d | 4.72 (0.1) | 5.04 (0.17) | 6.2 (0.19) | 6.47 (0.26) | 7.22 (0.15) | 5.17 (0.16) | 4.52 (0.3) | 4.28 (0.1) | 4.32 (0.13) |
| Osteopontin | |||||||||
| S1 | S2 | S3 | S4 | S5 | S6 | S7 | S8 | S9 | |
| 1 d | 1.03 (0.1) | 1.25 (0.1) | 1.41 (0.11) | 1.99 (0.06) | 2.11 (0.1) | 1.99 (0.22) | 1.11 (0.07) | 0.94 (0.01) | 0.91 (0.2) |
| 3 d | 2.63 (0.12) | 2.92 (0.12) | 4.89 (0.17) | 6.16 (0.22) | 6.5 (0.38) | 5.16 (0.15) | 3.59 (0.48) | 4.07 (0.05) | 3.18 (0.11) |
| 7 d | 5.81 (0.08) | 6.18 (0.13) | 8.42 (0.26) | 9.14 (0.13) | 10.8 (0.31) | 8.37 (0.59) | 5.9 (0.35) | 6.07 (0.12) | 5.16 (0.16) |
| 14 d | 9.05 (0.07) | 9.6 (0.17) | 11.8 (0.38) | 12.75 (0.27) | 13.35 (0.59) | 12.29 (0.7) | 10.33 (0.55) | 9.25 (0.28) | 7.65 (0.55) |
| Osteonectin | |||||||||
| S1 | S2 | S3 | S4 | S5 | S6 | S7 | S8 | S9 | |
| 1 d | 1.28 (0.09) | 1.28 (0.1) | 1.31 (0.11) | 1.28 (0.17) | 1.66 (0.25) | 1.45 (0.07) | 1.14 (0.06) | 1.08 (0.05) | 1.07 (0.09) |
| 3 d | 2.63 (0.23) | 2.9 (0.05) | 3.04 (0.08) | 4.14 (0.12) | 4.12 (0.11) | 3.8 (0.62) | 2.64 (0.3) | 2.6 (0.21) | 2.42 (0.06) |
| 7 d | 3.96 (0.09) | 4.2 (0.08) | 4.95 (0.08) | 5.6 (0.22) | 5.5 (0.29) | 4.84 (0.17) | 3.58 (0.44) | 3.44 (0.43) | 3.42 (0.22) |
| 14 d | 5.71 (0.54) | 6.21 (0.08) | 7.29 (0.1) | 7.53 (0.43) | 7.7 (0.37) | 5.89 (0.44) | 4.75 (0.4) | 4.8 (0.45) | 5.36 (0.1) |
| TGF-β1 | |||||||||
| S1 | S2 | S3 | S4 | S5 | S6 | S7 | S8 | S9 | |
| 1 d | 2.45 (0.08) | 2.38 (0.2) | 3.22 (0.08) | 3.53 (0.32) | 3.32 (0.16) | 2.79 (0.19) | 2.76 (0.08) | 2.69 (0.05) | 2.56 (0.1) |
| 7 d | 2.68 (0.1) | 2.71 (0.15) | 2.84 (0.06) | 4.08 (0.08) | 4.27 (0.1) | 2.95 (0.15) | 2.91 (0.03) | 2.91 (0.05) | 2.85 (0.1) |
| SMAD-4 | |||||||||
| S1 | S2 | S3 | S4 | S5 | S6 | S7 | S8 | S9 | |
| 1 d | 0.8 (0.04) | 0.74 (0.13) | 0.87 (0.06) | 1.01 (0.07) | 1.13 (0.08) | 1.01 (0.02) | 0.92 (0.08) | 0.87 (0.07) | 0.92 (0.1) |
| 3 d | 1.6 (0.08) | 1.71 (0.05) | 2 (0.1) | 2.74 (0.23) | 3.25 (0.25) | 2.75 (0.27) | 1.96 (0.1) | 1.86 (0.1) | 1.83 (0.1) |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Shevtsov, M.; Pitkin, E.; Combs, S.E.; Yudintceva, N.; Nazarov, D.; Meulen, G.V.D.; Preucil, C.; Akkaoui, M.; Pitkin, M. Biocompatibility Analysis of the Silver-Coated Microporous Titanium Implants Manufactured with 3D-Printing Technology. Nanomaterials 2024, 14, 1876. https://doi.org/10.3390/nano14231876
Shevtsov M, Pitkin E, Combs SE, Yudintceva N, Nazarov D, Meulen GVD, Preucil C, Akkaoui M, Pitkin M. Biocompatibility Analysis of the Silver-Coated Microporous Titanium Implants Manufactured with 3D-Printing Technology. Nanomaterials. 2024; 14(23):1876. https://doi.org/10.3390/nano14231876
Chicago/Turabian StyleShevtsov, Maxim, Emil Pitkin, Stephanie E. Combs, Natalia Yudintceva, Denis Nazarov, Greg Van Der Meulen, Chris Preucil, Michael Akkaoui, and Mark Pitkin. 2024. "Biocompatibility Analysis of the Silver-Coated Microporous Titanium Implants Manufactured with 3D-Printing Technology" Nanomaterials 14, no. 23: 1876. https://doi.org/10.3390/nano14231876
APA StyleShevtsov, M., Pitkin, E., Combs, S. E., Yudintceva, N., Nazarov, D., Meulen, G. V. D., Preucil, C., Akkaoui, M., & Pitkin, M. (2024). Biocompatibility Analysis of the Silver-Coated Microporous Titanium Implants Manufactured with 3D-Printing Technology. Nanomaterials, 14(23), 1876. https://doi.org/10.3390/nano14231876

