Fluorinated PEG-PEI Coated Magnetic Nanoparticles for siRNA Delivery and CXCR4 Knockdown
Abstract
:1. Introduction
2. Materials and Methods
2.1. Materials
2.2. Methods
2.2.1. Synthesis of Fluorinated Polyethylene Glycol-Polyethyleneimine (F7-PEG-PEI)
- (1)
- 200 μmol of heptafluorobutyric anhydride (F7) and 100 μmol of amino-polyethylene glycol-carboxyl (NH2-PEG-COOH) were dissolved in 10 mL methanol, catalyzed by 50 μL triethylamine, magnetic stirred at 240 rpm, and reacted at room temperature for 48 h.;
- (2)
- Then, dialysis membrane (1200 MWCO) was used, and the product was dialyzed against ultrapure water for 3 days. After dialysis, a rotary evaporator was used to evaporate most of the water. Vacuum drying was performed for 48 h to obtain F7-PEG-COOH.
- (3)
- 100 mg of F7-PEG-COOH was dissolved in 50 mL pure water. Then 20 mg of 1-(3-dimethylaminopropyl)-3-ethylcarbodiimide hydrochloride (EDC) and 10 mg of N-hydroxysuccinimide (NHS) were added, and the reaction was stirred at room temperature for 2 h.
- (4)
- Then, 1200 mg of polyethyleneimine was added, and the reaction was stirred at room temperature for 48 h;
- (5)
- Dialysis membrane (8000 MWCO) was used, and the product was dialyzed against pure water for 3 days;
- (6)
- After dialysis, a rotary evaporator was used to evaporate most of the water. Vacuum drying was performed for 48 h to obtain F7-PEG-PEI.
2.2.2. Synthesis of Fe3O4 Magnetic Nanoparticles
2.2.3. Preparation of F7-PEG-PEI Coated MNPs (FPP@MNPs)
2.2.4. Cell Viability and Apoptosis
- (1)
- Cell viability was detected by CCK8 kit. HeLa cells were cultured in a 96-well plate, 104 cells per well.100 μL of culture medium (DMEM and 10% FBS) was added per well, and cells were cultured at 37 °C, 5% CO2 for 16 h. After that, the culture medium was replaced, and FPP@MNPs were added at the final concentrations of 2, 4, 6, 8, 10, and 12 μg/mL. Cells were incubated for 24 or 48 h. Then 10 μL of CCK-8 solution was added to each well, and the OD value was detected at λ = 450 nm after incubation for 1 h.The cell viability was calculated according to the following formula:Cell viability (%) = [(As − Ab)/(Ac − Ab)] × 100;As = experimental well absorbance (cells, medium, CCK-8 and FPP@MNPs);Ab = absorbance of blank wells (medium and CCK-8);Ac = control well absorbance (cells, medium and CCK-8).
- (2)
- Cell apoptosis was detected by Annexin V-FITC/PI apoptosis kit. HeLa cells were cultured in a 6-well plate, 5 × 105 cells per well. In total, 2 mL of culture medium (DMEM and 10% FBS) was added per well, and cells were cultured at 37°C, 5% CO2 for 16 h. Then FPP@MNPs were added at the final concentrations of 2.5 or 5 μg/mL. Cells were incubated for 24 or 48 h. After the cells were digested with 0.25% trypsin solution, Annexin V-FITC and PI were added and measured by flow cytometry Attune NxT (Invitrogen Inc., Carlsbad, CA, USA).
2.2.5. Observation of Cellular Uptake and Transfection by Laser Confocal Microscopy
- (3)
- Cells were cultured in glass-bottom dishes with a diameter of 35 mm and a thickness of 0.17 mm, with 5 × 105 cells per dish, and the volume of the culture medium was 2 mL.
- (4)
- Preparation of FITC-labeled(green) nanoparticles:1 mg of F7-PEG-PEI@MNPs (FPP@MNPs) or mPEG-PEI@MNPs (mPP@MNPs) and 50 μg FITC were mixed at room temperature and placed in the dark for 24 h. After that, the ultrafiltration purification (100 kDa NMWL) was repeated three times.
- (5)
- Observation of cellular uptake:FITC-labeled FPP@MNP or mPP@MNP (containing 10 μg Fe) was mixed with 2 mL DMEM medium containing LysoTracker (red) and Hoechst33342 (blue). Then the mixture was added to the cells, placed under a confocal microscope for observation.
- (6)
- Observation of cell transfection:The transfected cells were added to a 2.5% glutaraldehyde solution, fixed at 4 °C for 30 min, and then washed three times with PBS. F-actin was stained with rhodamine-phalloidin (red), and nuclei were stained with Hoechst33342. siRNA labeled with FAM (green).
- (7)
- The excitation wavelength:405 nm for blue fluorescence, 488 nm for green fluorescence, and 562 nm for red fluorescence.
2.2.6. Cell Transfection
- (1)
- The medium in each well was replaced with fresh 500 μL of DMEM medium (10% FBS);
- (2)
- For each well, 40 pmol of siRNA was dissolved in 10 μL of DEPC water, and then mixed with 0.25, 0.5, 0.75, or 1.0 μg of FPP@MNP (calculated as Fe content). Incubated at room temperature for 10–15 min to obtain FPP@MNP/siRNA complexes;
- (3)
- The above complexes were added to the medium in the well;
- (4)
- The 24-well plate was placed on the magnetic plate (400 mT) and incubated at 37 °C for 10–20 min;
- (5)
- The magnetic plate was removed, and the cells were cultured at 37 °C, 5% CO2.
2.2.7. RT-PCR
2.2.8. Transfection Efficiency and CXCR4 Expression Measured by Flow Cytometry
2.2.9. Characterization
2.3. Statistical Analysis
3. Results
3.1. Characterization of Fluorinated PEG-PEI Coated MNPs
3.2. Cell Viability and Apoptosis Assays
3.3. Validation of Cellular Uptake and Transfection Efficacy
3.4. Knockdown of CXCR4 Expression in 4 T1 Cells
4. Discussion
5. Conclusions
6. Patents
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Li, Z.; Wang, Y.; Shen, Y.; Qian, C.; Oupicky, D.; Sun, M. Targeting pulmonary tumor microenvironment with CXCR4-inhibiting nanocomplex to enhance anti–PD-L1 immunotherapy. Sci. Adv. 2020, 6, eaaz9240. [Google Scholar] [CrossRef] [PubMed]
- Arya, M.; Patel, H.R.H.; McGurk, C.; Tatoud, R.; Klocker, H.; Masters, J.; Williamson, M. The Importance of the CXCL12-CXCR4 chemokine ligand-receptor interaction in prostate cancer metastasis. J. Exp. Ther. Oncol. 2004, 4, 291–303. [Google Scholar] [PubMed]
- Liang, Z.; Yoon, Y.; Votaw, J.; Goodman, M.M.; Williams, L.; Shim, H. Silencing of CXCR4 blocks breast cancer metastasis. Cancer Res. 2005, 65, 967–971. [Google Scholar] [PubMed]
- Han, M.; Lv, S.; Zhang, Y.; Yi, R.; Huang, B.; Fu, H.; Bian, R.; Li, X. The prognosis and clinicopathology of CXCR4 in gastric cancer patients: A meta-analysis. Tumor Biol. 2014, 35, 4589–4597. [Google Scholar] [CrossRef]
- Passaro, D.; Irigoyen, M.; Catherinet, C.; Gachet, S.; Da Costa De Jesus, C.; Lasgi, C.; Tran Quang, C.; Ghysdael, J. CXCR4 is required for leukemia-initiating cell activity in T cell acute lymphoblastic leukemia. Cancer Cell 2015, 27, 769–779. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Tseng, D.; Vasquez-Medrano, D.A.; Brown, J.M. Targeting SDF-1/CXCR4 to inhibit tumour vasculature for treatment of glioblastomas. Br. J. Cancer 2011, 104, 1805–1809. [Google Scholar] [CrossRef] [Green Version]
- Müller, A.; Homey, B.; Soto, H.; Ge, N.; Catron, D.; Buchanan, M.E.; McClanahan, T.; Murphy, E.; Yuan, W.; Wagner, S.N.; et al. Involvement of chemokine receptors in breast cancer metastasis. Nature 2001, 410, 50–56. [Google Scholar] [CrossRef]
- Giallongo, C.; Dulcamare, I.; Tibullo, D.; del Fabro, V.; Vicario, N.; Parrinello, N.; Romano, A.; Scandura, G.; Lazzarino, G.; Conticello, C.; et al. CXCL12/CXCR4 axis supports mitochondrial trafficking in tumor myeloma microenvironment. Oncogenesis 2022, 11, 6. [Google Scholar] [CrossRef]
- Meng, J.; Ge, Y.; Xing, H.; Wei, H.; Xu, S.; Liu, J.; Yan, D.; Wen, T.; Wang, M.; Fang, X.; et al. Synthetic CXCR4 antagonistic peptide assembling with nanoscaled micelles combat acute myeloid leukemia. Small 2020, 16, 2001890. [Google Scholar] [CrossRef]
- Donzella, G.A.; Schols, D.; Lin, S.W.; Esté, J.A.; Nagashima, K.A.; Maddon, P.J.; Allaway, G.P.; Sakmar, T.P.; Henson, G.; De Clercq, E.; et al. AMD3100, a small molecule inhibitor of HIV-1 Entry via the CXCR4 Co-Receptor. Nat. Med. 1998, 4, 72–77. [Google Scholar] [CrossRef]
- Tamamura, H.; Hiramatsu, K.; Kusano, S.; Terakubo, S.; Yamamoto, N.; Trent, J.O.; Wang, Z.; Peiper, S.C.; Nakashima, H.; Otaka, A.; et al. Synthesis of Potent CXCR4 inhibitors possessing low cytotoxicity and improved biostability based on T140 derivatives. Organic Biomol. Chem. 2003, 1, 3656. [Google Scholar] [CrossRef] [PubMed]
- Li, X.; Guo, H.; Yang, Y.; Meng, J.; Liu, J.; Wang, C.; Xu, H. A designed peptide targeting CXCR4 displays anti-acute myelocytic leukemia activity in vitro and in vivo. Sci. Rep. 2015, 4, 6610. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Lam, J.K.W.; Chow, M.Y.T.; Zhang, Y.; Leung, S.W.S. SiRNA versus MiRNA as therapeutics for gene silencing. Mol. Ther. Nucl. Acids 2015, 4, e252. [Google Scholar] [CrossRef] [Green Version]
- Elbashir, S.M.; Harborth, J.; Lendeckel, W.; Yalcin, A.; Weber, K.; Tuschl, T. Duplexes of 21-Nucleotide RNAs Mediate RNA interference in cultured mammalian cells. Nature 2001, 411, 494–498. [Google Scholar] [CrossRef] [PubMed]
- Setten, R.L.; Rossi, J.J.; Han, S. The current state and future directions of RNAi-based therapeutics. Nat. Rev. Drug Discov. 2019, 18, 421–446. [Google Scholar] [CrossRef] [PubMed]
- Lim, L.P.; Lau, N.C.; Garrett-Engele, P.; Grimson, A.; Schelter, J.M.; Castle, J.; Bartel, D.P.; Linsley, P.S.; Johnson, J.M. Microarray analysis shows that some MicroRNAs downregulate large numbers of target MRNAs. Nature 2005, 433, 769–773. [Google Scholar] [CrossRef] [PubMed]
- Landry, B.; Gül-Uludağ, H.; Plianwong, S.; Kucharski, C.; Zak, Z.; Parmar, M.B.; Kutsch, O.; Jiang, H.; Brandwein, J.; Uludağ, H. Targeting CXCR4/SDF-1 axis by lipopolymer complexes of SiRNA in acute myeloid leukemia. J. Control. Release 2016, 224, 8–21. [Google Scholar] [CrossRef] [PubMed]
- Mykhaylyk, O.; Vlaskou, D.; Tresilwised, N.; Pithayanukul, P.; Möller, W.; Plank, C. Magnetic nanoparticle formulations for DNA and SiRNA delivery. J. Magn. Magn. Mater. 2007, 311, 275–281. [Google Scholar] [CrossRef]
- Liu, D.; Cheng, Y.; Cai, R.; Wang, B.W.; Cui, H.; Liu, M.; Zhang, B.; Mei, Q.; Zhou, S. The enhancement of SiPLK1 penetration across BBB and its anti glioblastoma activity in vivo by magnet and transferrin co-modified nanoparticle. Nanomed. Nanotechnol. Biol. Med. 2018, 14, 991–1003. [Google Scholar] [CrossRef]
- Babu, A.; Wang, Q.; Muralidharan, R.; Shanker, M.; Munshi, A.; Ramesh, R. Chitosan coated polylactic acid nanoparticle-mediated combinatorial delivery of cisplatin and SiRNA/Plasmid DNA chemosensitizes cisplatin-resistant human ovarian cancer cells. Mol. Pharm. 2014, 11, 2720–2733. [Google Scholar] [CrossRef]
- Estelrich, J.; Escribano, E.; Queralt, J.; Busquets, M. Iron oxide nanoparticles for magnetically-guided and magnetically-responsive drug delivery. Int. J. Mol. Sci. 2015, 16, 8070–8101. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Hoang Thi, T.T.; Pilkington, E.H.; Nguyen, D.H.; Lee, J.S.; Park, K.D.; Truong, N.P. The importance of poly(ethylene glycol) alternatives for overcoming PEG immunogenicity in drug delivery and bioconjugation. Polymers 2020, 12, 298. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Koren, E.; Apte, A.; Jani, A.; Torchilin, V.P. Multifunctional PEGylated 2C5-immunoliposomes containing PH-sensitive bonds and TAT peptide for enhanced tumor cell internalization and cytotoxicity. J. Control. Release 2012, 160, 264–273. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Mohamed, M.; Abu Lila, A.S.; Shimizu, T.; Alaaeldin, E.; Hussein, A.; Sarhan, H.A.; Szebeni, J.; Ishida, T. PEGylated Liposomes: Immunological responses. Sci. Technol. Adv. Mater. 2019, 20, 710–724. [Google Scholar] [CrossRef] [Green Version]
- Zhang, W.; Guo, Z.; Huang, D.; Liu, Z.; Guo, X.; Zhong, H. Synergistic effect of chemo-photothermal therapy using PEGylated graphene oxide. Biomaterials 2011, 32, 8555–8561. [Google Scholar] [CrossRef]
- Chen, M.; Tang, S.; Guo, Z.; Wang, X.; Mo, S.; Huang, X.; Liu, G.; Zheng, N. Core-Shell Pd@Au nanoplates as theranostic agents for in-vivo photoacoustic imaging, CT imaging, and photothermal therapy. Adv. Mater. 2014, 26, 8210–8216. [Google Scholar] [CrossRef]
- Wang, M.; Chang, M.; Chen, Q.; Wang, D.; Li, C.; Hou, Z.; Lin, J.; Jin, D.; Xing, B. Au2Pt-PEG-Ce6 nanoformulation with dual nanozyme activities for synergistic chemodynamic therapy/phototherapy. Biomaterials 2020, 252, 120093. [Google Scholar] [CrossRef]
- Ciocci, M.; Cacciotti, I.; Seliktar, D.; Melino, S. Injectable silk fibroin hydrogels functionalized with microspheres as adult stem cells-carrier systems. Int. J. Biol. Macromol. 2018, 108, 960–971. [Google Scholar] [CrossRef]
- Masood, N.; Ahmed, R.; Tariq, M.; Ahmed, Z.; Masoud, M.S.; Ali, I.; Asghar, R.; Andleeb, A.; Hasan, A. Silver nanoparticle impregnated chitosan-PEG hydrogel enhances wound healing in diabetes induced rabbits. Int. J. Pharm. 2019, 559, 23–36. [Google Scholar] [CrossRef]
- Grun, M.K.; Suberi, A.; Shin, K.; Lee, T.; Gomerdinger, V.; Moscato, Z.M.; Piotrowski-Daspit, A.S.; Saltzman, W.M. PEGylation of poly(amine-co-ester) polyplexes for tunable gene delivery. Biomaterials 2021, 272, 120780. [Google Scholar] [CrossRef]
- Hoskins, C.; Wang, L.; Cheng, W.P.; Cuschieri, A. Dilemmas in the reliable estimation of the in-vitro cell viability in magnetic nanoparticle engineering: Which tests and what protocols? Nanoscale Res. Lett. 2012, 7, 77. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Sun, C.-Y.; Shen, S.; Xu, C.-F.; Li, H.-J.; Liu, Y.; Cao, Z.-T.; Yang, X.-Z.; Xia, J.-X.; Wang, J. Tumor Acidity-Sensitive Polymeric Vector for Active Targeted SiRNA Delivery. J. Am. Chem. Soc. 2015, 137, 15217–15224. [Google Scholar] [CrossRef] [PubMed]
- Fang, Y.; Xue, J.; Gao, S.; Lu, A.; Yang, D.; Jiang, H.; He, Y.; Shi, K. Cleavable PEGylation: A strategy for overcoming the “PEG Dilemma” in efficient drug delivery. Drug Deliv. 2017, 24, 22–32. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Chen, Y.; Zhang, M.; Jin, H.; Tang, Y.; Wang, H.; Xu, Q.; Li, Y.; Li, F.; Huang, Y. Intein-mediated site-specific synthesis of tumor-targeting protein delivery system: Turning PEG dilemma into prodrug-like feature. Biomaterials 2017, 116, 57–68. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Kanamala, M.; Palmer, B.D.; Jamieson, S.M.; Wilson, W.R.; Wu, Z. Dual PH-sensitive liposomes with low PH-triggered sheddable PEG for enhanced tumor-targeted drug delivery. Nanomedicine 2019, 14, 1971–1989. [Google Scholar] [CrossRef] [PubMed]
- Han, X.; Li, Y.; Xu, Y.; Zhao, X.; Zhang, Y.; Yang, X.; Wang, Y.; Zhao, R.; Anderson, G.J.; Zhao, Y.; et al. Reversal of pancreatic desmoplasia by re-educating stellate cells with a tumour microenvironment-activated nanosystem. Nat. Commun. 2018, 9, 3390. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Zhu, Y.; Chen, C.; Cao, Z.; Shen, S.; Li, L.; Li, D.; Wang, J.; Yang, X. On-demand PEGylation and DePEGylation of PLA-Based nanocarriers via amphiphilic MPEG-TK-Ce6 for nanoenabled cancer chemotherapy. Theranostics 2019, 9, 8312–8320. [Google Scholar] [CrossRef]
- Fan, G.; Fan, M.; Wang, Q.; Jiang, J.; Wan, Y.; Gong, T.; Zhang, Z.; Sun, X. Bio-inspired polymer envelopes around adenoviral vectors to reduce immunogenicity and improve in vivo kinetics. Acta Biomater. 2016, 30, 94–105. [Google Scholar] [CrossRef]
- Li, G.; Song, Y.; Huang, Z.; Chen, K.; Chen, D.; Deng, Y. Novel, nano-sized, liposome-encapsulated polyamidoamine dendrimer derivatives facilitate tumour targeting by overcoming the polyethylene glycol dilemma and integrin saturation obstacle. J. Drug Target. 2017, 25, 734–746. [Google Scholar] [CrossRef]
- Hou, M.; Wu, X.; Zhao, Z.; Deng, Q.; Chen, Y.; Yin, L. Endothelial cell-targeting, ROS-Ultrasensitive Drug/SiRNA co-delivery nanocomplexes mitigate early-stage neutrophil recruitment for the anti-inflammatory treatment of myocardial ischemia reperfusion injury. Acta Biomater. 2022, 143, 344–355. [Google Scholar] [CrossRef]
- Shuai, Q.; Cai, Y.; Zhao, G.; Sun, X. Cell-penetrating peptide modified PEG-PLA micelles for efficient PTX Delivery. Int. J. Mol. Sci. 2020, 21, 1856. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Lv, J.; Chang, H.; Wang, Y.; Wang, M.; Xiao, J.; Zhang, Q.; Cheng, Y. Fluorination on polyethylenimine allows efficient 2D and 3D cell culture gene delivery. J. Mater. Chem. B 2015, 3, 642–650. [Google Scholar] [CrossRef] [PubMed]
- Wang, H.; Wang, Y.; Wang, Y.; Hu, J.; Li, T.; Liu, H.; Zhang, Q.; Cheng, Y. Self-assembled fluorodendrimers combine the features of lipid and polymeric vectors in gene delivery. Angew. Chem. Int. Ed. 2015, 54, 11647–11651. [Google Scholar] [CrossRef] [PubMed]
- Wang, M.; Liu, H.; Li, L.; Cheng, Y. A fluorinated dendrimer achieves excellent gene transfection efficacy at extremely low nitrogen to phosphorus ratios. Nat. Commun. 2014, 5, 3053. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Chen, G.; Wang, Y.; Ullah, A.; Huai, Y.; Xu, Y. The effects of fluoroalkyl chain length and density on sirna delivery of bioreducible poly(amido amine)s. Eur. J. Pharm. Sci. 2020, 152, 105433. [Google Scholar] [CrossRef] [PubMed]
- Zhang, L.; Li, Y.; Yu, J.C.; Chen, Y.Y.; Chan, K.M. Assembly of polyethylenimine-functionalized iron oxide nanoparticles as agents for DNA transfection with magnetofection technique. J. Mater. Chem. B 2014, 2, 7936–7944. [Google Scholar] [CrossRef]
- Obaidat, I.; Issa, B.; Haik, Y. Magnetic properties of magnetic nanoparticles for efficient hyperthermia. Nanomaterials 2015, 5, 63–89. [Google Scholar] [CrossRef] [Green Version]
- Sun, S.; Zeng, H.; Robinson, D.B.; Raoux, S.; Rice, P.M.; Wang, S.X.; Li, G. Monodisperse MFe2O4 (M = Fe, Co, Mn) Nanoparticles. J. Am. Chem. Soc. 2004, 126, 273–279. [Google Scholar] [CrossRef]
- Ghosh, R.; Pradhan, L.; Devi, Y.P.; Meena, S.S.; Tewari, R.; Kumar, A.; Sharma, S.; Gajbhiye, N.S.; Vatsa, R.K.; Pandey, B.N.; et al. Induction Heating Studies of Fe3O4 magnetic nanoparticles capped with oleic acid and polyethylene glycol for hyperthermia. J. Mater. Chem. 2011, 21, 13388. [Google Scholar] [CrossRef]
- Wan, Q.; Xie, L.; Gao, L.; Wang, Z.; Nan, X.; Lei, H.; Long, X.; Chen, Z.-Y.; He, C.-Y.; Liu, G.; et al. Self-assembled magnetic theranostic nanoparticles for highly sensitive MRI of minicircle DNA delivery. Nanoscale 2013, 5, 744–752. [Google Scholar] [CrossRef]
- Smith, M.C.P.; Luker, K.E.; Garbow, J.R.; Prior, J.L.; Jackson, E.; Piwnica-Worms, D.; Luker, G.D. CXCR4 regulates growth of both primary and metastatic breast cancer. Cancer Res. 2004, 64, 8604–8612. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Wang, Z.; Ma, Y.; Yu, X.; Niu, Q.; Han, Z.; Wang, H.; Li, T.; Fu, D.; Achilefu, S.; Qian, Z.; et al. Targeting CXCR4-CXCL12 Axis for visualizing, predicting, and inhibiting breast cancer metastasis with theranostic AMD3100-Ag2S Quantum Dot Probe. Adv. Funct. Mater. 2018, 28, 1800732. [Google Scholar] [CrossRef]
- Zhang, F.; Gong, S.; Wu, J.; Li, H.; Oupicky, D.; Sun, M. CXCR4-targeted and redox responsive dextrin nanogel for metastatic breast cancer therapy. Biomacromolecules 2017, 18, 1793–1802. [Google Scholar] [CrossRef] [PubMed]
- Li, H.; Zhang, X.; Wu, H.Y.; Sun, L.; Ma, Y.; Xu, J.; Lin, Q.; Zeng, D. 64 Cu-labeled ubiquitin for PET imaging of CXCR4 expression in mouse breast tumor. ACS Omega 2019, 4, 12432–12437. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Mikaeili, A.; Erfani, M.; Goudarzi, M.; Sabzevari, O. Breast tumor targeting in mice bearing 4T1 tumor with labeled CXCR4 antagonist analogue. Int. J. Peptide Res. Ther. 2021, 27, 2449–2457. [Google Scholar] [CrossRef]
Target (Mouse) | Primer | |
---|---|---|
Actin | F | CTCCTGAGCGCAAGTACTCT |
R | TACTCCTGCTTGCTGATCCAC | |
CXCR4 | F | TTCATCTTTGCCGACGTCAG |
R | CGAGACCCACCATTATATGCT |
siRNA | Sequence |
---|---|
NC | (5′-3′) UUCUCCGAACGUGUCACGUTT (3′-5′) TTAAGAGGCUUGCACAGUGCA |
R1 | (5′-3′) CGAUCAGUGUGAGUAUAUATT (3′-5′) TTGCUAGUCACACUCAUAUAU |
R2 | (5′-3′) GUCCAUUUCAAUAGGAUCUTT (3′-5′) TTCGGAGUUCUAGGAAAGGUU |
R3 | (5′-3′) GCCUCAAGAUCCUUUCCAATT (3′-5′) TTCGGAGUUCUAGGAAAGGUU |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Cao, Y.; Zhang, S.; Ma, M.; Zhang, Y. Fluorinated PEG-PEI Coated Magnetic Nanoparticles for siRNA Delivery and CXCR4 Knockdown. Nanomaterials 2022, 12, 1692. https://doi.org/10.3390/nano12101692
Cao Y, Zhang S, Ma M, Zhang Y. Fluorinated PEG-PEI Coated Magnetic Nanoparticles for siRNA Delivery and CXCR4 Knockdown. Nanomaterials. 2022; 12(10):1692. https://doi.org/10.3390/nano12101692
Chicago/Turabian StyleCao, Yixiang, Shiyin Zhang, Ming Ma, and Yu Zhang. 2022. "Fluorinated PEG-PEI Coated Magnetic Nanoparticles for siRNA Delivery and CXCR4 Knockdown" Nanomaterials 12, no. 10: 1692. https://doi.org/10.3390/nano12101692