Effects of Graphene Oxide-Gold Nanoparticles Nanocomposite on Highly Sensitive Foot-and-Mouth Disease Virus Detection
Abstract
1. Introduction
2. Materials and Methods
2.1. Materials
2.2. Preparation of GO-AuNPs Nanocomposite
2.3. Characterization of GO-AuNPs
2.4. Construction of FMDV Gene Plasmid
2.5. Real-Time PCR
3. Results
3.1. Characterization of GO-AuNPs Nanocomposite
3.2. Nano-PCR with GO-AuNPs Nanocomposite
3.3. Type-Specific Detection
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Conflicts of Interest
References
- Knowles, N.J.; Samuel, A.R. Molecular Epidemiology of Foot-and-Mouth Disease Virus. Virus Res. 2003, 91, 65–80. [Google Scholar] [CrossRef] [Scilit]
- Robson, K.J.; Harris, T.J.; Brown, F. An Assessment by Competition Hybridization of the Sequence Homology between the RNAs of the Seven Serotypes of FMDV. J. Gen. Virol. 1977, 37, 271–276. [Google Scholar] [CrossRef] [Scilit]
- Kitching, R.P. Foot-and-mouth disease: Current world situation. Vaccine 1999, 17, 1772–1774. [Google Scholar] [CrossRef] [Scilit]
- Alexandersen, S.; Zhang, Z.; Donaldson, A.I.; Garland, A.J. The Pathogenesis and Diagnosis of Foot-and-Mouth Disease. J. Comp. Pathol. 2003, 129, 1–36. [Google Scholar] [CrossRef] [Scilit]
- Verheyden, B.; Lauwers, S.; Rombaut, B. Quantitative RT-PCR ELISA to determine the amount and ratio of positive- and negative strand viral RNA synthesis and the effect of guanidine in poliovirus infected cells. J. Pharm. Biomed. Anal. 2003, 33, 303–308. [Google Scholar] [CrossRef] [Scilit]
- Reid, S.M.; Hutchings, G.H.; Ferris, N.P.; De Clercq, K. Diagnosis of foot-and-mouth disease by RT-PCR: Evaluation of primers for serotypic characterisation of viral RNA in clinical samples. J. Virol. Methods 1999, 83, 113–123. [Google Scholar] [CrossRef] [Scilit]
- Lomakina, N.F.; Fallacara, F.; Pacciarini, M.; Amadori, M.; Lomakin, A.I.; Timina, A.M.; Shcherbakova, L.O.; Drygin, V.V. Application of universal primers for identification of Foot-and-Mouth Disease virus and Swine vesicular disease virus by PCR and PCR-ELISA. Arch. Virol. 2004, 149, 1155–1170. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Nunez, J.I.; Blanco, E.; Hernandez, T.; Gomez-Tejedor, C.; Martin, M.J.; Dopazo, J.; Sobrino, F. A RT-PCR assay for the differential diagnosis of vesicular viral diseases of swine. J. Virol. Methods 1998, 72, 227–235. [Google Scholar] [CrossRef] [Scilit]
- Fosgate, G.T.; Tavornpanich, S.; Hunter, D.; Pugh, R.; Sterle, J.A.; Schumann, K.R.; Eberling, A.J.; Beckham, T.R.; Martin, B.M.; Clarke, N.P.; et al. Diagnostic specificity of a real-time RT-PCR in cattle for foot-and-mouth disease and swine for foot-and-mouth disease and classical swine fever based on non-invasive specimen collection. Vet. Microbiol. 2008, 132, 158–164. [Google Scholar] [CrossRef] [Scilit]
- Gu, C.; Zheng, C.; Shi, L.; Zhang, Q.; Li, Y.; Lu, B.; Xiong, Y.; Qu, S.; Shao, J.; Chang, H. Plus- and minus-stranded foot-and-mouth disease virus RNA quantified simultaneously using a novel real-time RT-PCR. Virus Genes 2007, 34, 289–298. [Google Scholar] [CrossRef] [Scilit]
- King, D.P.; Ferris, N.P.; Shaw, A.E.; Reid, S.M.; Hutchings, G.H.; Giuffre, A.C.; Robida, J.M.; Callahan, J.D.; Nelson, W.M.; Beckham, T.R. Detection of foot-and-mouth disease virus: Comparative diagnostic sensitivity of two independent real-time reverse transcription-polymerase chain reaction assays. J. Vet. Diagn. Investig. 2006, 18, 93–97. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Callahan, J.D.; Brown, F.; Osorio, F.A.; Sur, J.H.; Kramer, E.; Long, G.W.; Lubroth, J.; Ellis, S.J.; Shoulars, K.S.; Gaffney, K.L.; et al. Use of a portable real-time reverse transcriptase-polymerase chain reaction assay for rapid detection of foot-and-mouth disease virus. J. Am. Vet. Med. Assoc. 2002, 220, 1636–1642. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Moss, A.; Haas, B. Comparison of the plaque test and reverse transcription nested PCR for the detection of FMDV in nasal swabs and probang samples. J. Virol. Methods 1999, 80, 59–67. [Google Scholar] [CrossRef] [Scilit]
- Dukes, J.P.; King, D.P.; Alexandersen, S. Novel reverse transcription loop-mediated isothermal amplification for rapid detection of foot-and-mouth disease virus. Arch. Virol. 2006, 151, 1093–1106. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Lim, D.R.; Kim, H.R.; Park, M.J.; Chae, H.G.; Ku, B.K.; Nah, J.J.; Ryoo, S.Y.; Wee, S.H.; Park, Y.R.; Jeon, H.S.; et al. An improved reverse transcription loop-mediated isothermal amplification assay for sensitive and specific detection of serotype O foot-and-mouth disease virus. J. Virol. Methods 2018, 260, 6–13. [Google Scholar] [CrossRef] [Scilit]
- Bath, C.; Scott, M.; Sharma, P.M.; Gurung, R.B.; Phuentshok, Y.; Pefanis, S.; Colling, A.; Singanallur Balasubramanian, N.; Firestone, S.M.; Ungvanijban, S.; et al. Further development of a reverse-transcription loop-mediated isothermal amplification (RT-LAMP) assay for the detection of foot-and-mouth disease virus and validation in the field with use of an internal positive control. Transbound. Emerg. Dis. 2020, 00, 1–13. [Google Scholar]
- Sang, F.; Yang, Y.; Yuan, L.; Ren, J.; Zhang, Z. Development of a high-throughput real time PCR based on a hot-start alternative for pfu mediated by quantum dots. Nanoscale 2015, 7, 15852–15862. [Google Scholar] [CrossRef] [Scilit]
- Jia, J.; Sun, L.; Hu, N.; Huang, G.; Weng, J. Graphene Enhances the Specificity of the Polymerase Chain Reaction. Small 2012, 8, 2011–2015. [Google Scholar] [CrossRef] [Scilit]
- Vu, B.V.; Litvinov, D.; Willson, R.C. Gold Nanoparticle Effects in Polymerase Chain Reaction: Favoring of Smaller Products by Polymerase Adsorption. Anal. Chem. 2008, 80, 5462–5467. [Google Scholar] [CrossRef] [Scilit]
- Kambli, P.; Kelkar-Mane, V. Nanosized Fe3O4 an efficient PCR yield enhancer-Comparative study with Au, Ag nanoparticles. Colloids Surf. B Biointerfaces 2016, 141, 546–552. [Google Scholar] [CrossRef] [Scilit]
- Abdul Khaliq, R.; Kafafy, R.; Salleh, H.M.; Faris, W.F. Enhancing the efficiency of polymerase chain reaction using graphene nanoflakes. Nanotechnology 2012, 23, 455106. [Google Scholar] [PubMed]
- Bai, Y.; Cui, Y.; Paoli, G.C.; Shi, C.; Wang, D.; Shi, X. Nanoparticles Affect PCR Primarily via Surface Interactions with PCR Components: Using Amino-Modified Silica-Coated Magnetic Nanoparticles as a Main Model. ACS Appl. Mater. Interfaces 2015, 7, 13142–13153. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Li, H.; Huang, J.; Lv, J.; An, H.; Zhang, X.; Zhang, Z.; Fan, C.; Hu, J. Nanoparticle PCR: Nanogold-assisted PCR with enhanced specificity. Angew. Chem. Int. Ed. Engl. 2005, 44, 5100–5103. [Google Scholar] [CrossRef] [Scilit]
- Li, M.; Lin, Y.C.; Wu, C.C.; Liu, H.S. Enhancing the efficiency of a PCR using gold nanoparticles. Nucleic Acids Res. 2005, 33, e184. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Lou, X.; Zhang, Y. Mechanism Studies on NanoPCR and Applications of Gold Nanoparticles in Genetic Analysis. ACS Appl. Mater. Interfaces 2013, 5, 6276–6284. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Lin, Y.; Li, J.; Yao, J.; Liang, Y.; Zhang, J.; Zhou, Q.; Jiang, G. Mechanism of gold nanoparticle induced simultaneously increased PCR efficiency and specificity. Chin. Sci. Bull. 2013, 58, 4593–4601. [Google Scholar] [CrossRef] [Scilit]
- Wang, J.; Cheng, Y.; Zhang, M.; Zhao, H.; Lin, P.; Yi, L.; Tong, M.; Cheng, S. Development of a nanoparticle-assisted PCR (nanoPCR) assay for detection of mink enteritis virus (MEV) and genetic characterization of the NS1 gene in four Chinese MEV strains. BMC Vet Res. 2015, 11, 1. [Google Scholar] [CrossRef] [Scilit]
- Chuang, M.K.; Lin, S.W.; Chen, F.C.; Chu, C.W.; Hsu, C.S. Gold nanoparticle-decorated graphene oxides for plasmonic-enhanced polymer photovoltaic devices. Nanoscale 2014, 6, 1573–1579. [Google Scholar] [CrossRef] [Scilit]
- Khalil, I.; Julkapli, N.M.; Yehye, W.A.; Basirun, W.J.; Bhargava, S.K. Graphene-Gold Nanoparticles Hybrid-Synthesis, Functionalization, and Application in a Electrochemical and Surface-Enhanced Raman Scattering Biosensor. Materials 2016, 9, 406. [Google Scholar] [CrossRef] [Scilit]
- Cheng, J.; Su, X.O.; Wang, S.; Zhao, Y. Highly Sensitive Detection of Clenbuterol in Animal Urine Using Immunomagnetic Bead Treatment and Surface-Enhanced Raman Spectroscopy. Sci. Rep. 2016, 6, 32637. [Google Scholar] [CrossRef] [Scilit]
- Kumari, R.; Osikoya, A.O.; Anku, W.W.; Shukla, S.K.; Govender, P.P. Hierarchically Assembled Two-Dimensional Hybrid Nanointerfaces: A Platform for Bioelectronic Applications. Electroanalysis 2018, 30, 2339–2348. [Google Scholar] [CrossRef] [Scilit]
- Li, H.; Rothberg, L. Colorimetric detection of DNA sequences based on electrostatic interactions with unmodified gold nanoparticles. Proc. Natl. Acad. Sci. USA 2004, 101, 14036–14039. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Jeong, H.Y.; Baek, S.H.; Chang, S.-J.; Yang, M.; Lee, S.J.; Lee, K.G.; Park, T.J. A hybrid composite of gold and graphene oxide as a PCR enhancer. RSC Adv. 2015, 5, 93117–93121. [Google Scholar] [CrossRef] [Scilit]
- Park, J.H.; Lee, K.N.; Ko, Y.J.; Kim, S.M.; Lee, H.S.; Shin, Y.K.; Sohn, H.J.; Park, J.Y.; Yeh, J.Y.; Lee, Y.H.; et al. Control of Foot-and-Mouth Disease during 2010-2011 Epidemic, South Korea. Emerg. Infect. Dis. 2013, 19, 655–659. [Google Scholar] [CrossRef] [Scilit]
- Sang, F.-M.; Li, X.; Liu, J. Development of Nano-Polymerase Chain Reaction and Its Application. Chin. J. Anal. Chem. 2017, 45, 1745–1753. [Google Scholar] [CrossRef] [Scilit]
- Kim, H.R.; Baek, A.; Lee, I.J.; Kim, D.E. Facilitation of Polymerase Chain Reaction with Poly(ethylene glycol)-Engrafted Graphene Oxide Analogous to a Single-Stranded-DNA Binding Protein. ACS Appl. Mater. Interfaces 2016, 8, 33521–33528. [Google Scholar] [CrossRef] [Scilit]
- Balandin, A.A.; Ghosh, S.; Bao, W.; Calizo, I.; Teweldebrhan, D.; Miao, F.; Lau, C.N. Superior Thermal Conductivity of Single-Layer Graphene. Nano Lett. 2008, 8, 902–907. [Google Scholar] [CrossRef] [Scilit]






| Type of FMDV Gene | Amplicon Size (bp) | Sequence |
|---|---|---|
| O-type | 117 | Forward: GCCTTGGAACTCATAGAGAAAAG Reverse: CAAAACATCGACGATGCGC |
| A-type | 208 | Forward: GTTTGCACGGTGTGCTGG Reverse: CTTTTCTCCATGAGCTCTAGAGC |
| Pan-type | 225 | Forward: TGAGGAGGTGTTTCGCACA Reverse: GTGTAAGTGTCCAGCTCAACTC |
| Cycle Quantification Value (Cq) | ||||
|---|---|---|---|---|
| Concentration (ng) | No Additive | 0.8 nM AuNPs | 4 μg/mL GO | 10 μg/mL GO-AuNPs |
| 101 | 26.43 | 24.74 | 18.43 | 14.92 |
| 100 | 30.57 | 28.40 | 22.05 | 18.28 |
| 10−1 | 36.69 | 31.71 | 25.72 | 21.77 |
| 10−2 | 35.97 | 30.07 | 26.09 | |
| 10−3 | 39.52 | 34.13 | 30.07 | |
| 10−4 | 39.16 | 34.19 | ||
© 2020 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Kim, J.-W.; Kim, M.; Lee, K.K.; Chung, K.H.; Lee, C.-S. Effects of Graphene Oxide-Gold Nanoparticles Nanocomposite on Highly Sensitive Foot-and-Mouth Disease Virus Detection. Nanomaterials 2020, 10, 1921. https://doi.org/10.3390/nano10101921
Kim J-W, Kim M, Lee KK, Chung KH, Lee C-S. Effects of Graphene Oxide-Gold Nanoparticles Nanocomposite on Highly Sensitive Foot-and-Mouth Disease Virus Detection. Nanomaterials. 2020; 10(10):1921. https://doi.org/10.3390/nano10101921
Chicago/Turabian StyleKim, Jong-Won, Myeongkun Kim, Kyung Kwan Lee, Kwang Hyo Chung, and Chang-Soo Lee. 2020. "Effects of Graphene Oxide-Gold Nanoparticles Nanocomposite on Highly Sensitive Foot-and-Mouth Disease Virus Detection" Nanomaterials 10, no. 10: 1921. https://doi.org/10.3390/nano10101921
APA StyleKim, J.-W., Kim, M., Lee, K. K., Chung, K. H., & Lee, C.-S. (2020). Effects of Graphene Oxide-Gold Nanoparticles Nanocomposite on Highly Sensitive Foot-and-Mouth Disease Virus Detection. Nanomaterials, 10(10), 1921. https://doi.org/10.3390/nano10101921
