Next Article in Journal
Nonstationary Extreme Value Analysis of Nearshore Sea-State Parameters under the Effects of Climate Change: Application to the Greek Coastal Zone and Port Structures
Previous Article in Journal
Coastal Vulnerability of the West Coast of Aceh Besar: A Coastal Morphology Assessment
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
JMSE
Volume 9
Issue 8
10.3390/jmse9080816
jmse-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Increasing Temperature Alters the Effects of Extracellular Copper on Thalassiosira Pseudonana Physiology and Transcription

by
Xinjie Wang
1,
Wang Cao
1,
Hong Du
1,2,
Wenhua Liu
1,2 and
Ping Li
1,2,*
1
Guangdong Provincial Key Laboratory of Marine Biology, Marine Biology Institute, Shantou University, Shantou 515063, China
2
Southern Marine Science and Engineering Guangdong Laboratory (Guangzhou), Guangzhou 511458, China
*
Author to whom correspondence should be addressed.
J. Mar. Sci. Eng. 2021, 9(8), 816; https://doi.org/10.3390/jmse9080816
Submission received: 7 July 2021 / Revised: 23 July 2021 / Accepted: 24 July 2021 / Published: 28 July 2021
(This article belongs to the Section Marine Environmental Science)
Browse Figures
Versions Notes

Abstract

:
Copper (Cu) is essential for many physiological processes in phytoplankton, including electron-transfer reactions and high-affinity Fe transport systems. However, at high concentrations, Cu can have a toxic effect on phytoplankton. Phytoplankton’s tolerance to certain toxicants in marine ecosystems cannot always be solely attributed to the presence of compounds, as various environmental factors including temperature can also indirectly influence their effects on organisms. In this study, we investigated the effects of different Cu concentrations (0, 19.6, 160, 800, and 8000 nM) on the growth and physiological changes in the centric diatom Thalassiosira pseudonana (CCMP 1335) when simultaneously applied with temperature cultivation of 20 °C and 25 °C. At low (0 nM) and high (8000 nM) Cu concentrations, the growth rate of T. pseudonana was inhibited, though an increase in temperature lessened this inhibition. There were no significant changes in the POC:PON ratio during all of the treatments. However, increasing the temperature significantly decreased the POC: POP, PON: POP and BSi: POP ratios of T. pseudonana. The intracellular Cu content of T. pseudonana varied from 0.13 to 13.28 fg cell−1 in response to increases in ambient Cu concentrations. Lastly, an increase in the Cu concentration decreased the transcriptional expression of CTR (copper transporter), 3Hfcp (photosynthetic protein), and Sit1 (silica shell formation) encoding genes. In conclusion, our results indicated that T. pseudonana can adapt to physiological processes and molecular mechanisms in response to varying Cu concentrations and ambient temperatures.

1. Introduction

Trace metals are required for numerous physiological processes in phytoplankton [1,2,3]. In particular, copper (Cu) is critical for photosynthesis [4], respiration [5] and the quenching of reactive oxygen species via superoxide dismutase [6]. Its availability can limit or inhibit the growth of phytoplankton in natural environments [1,2,7,8,9]. Cu concentrations in open oceans range from 0.3–6.0 nM, and it is often a factor in limiting the growth of phytoplankton [10]. However, Cu concentration can reach up to 300 nM in coastal waters, and such high Cu concentrations have been observed to reduce growth rate of marine phytoplankton [10,11], inhibit photosynthesis [12], decrease nitrate uptake [13], hinder silicic acid uptake [14] and alter the community composition of phytoplankton [8]. Most organisms have evolved mechanisms to survive under both optimal and suboptimal conditions in order to acclimatize to dynamic environments [3]. Plasticity is particularly evident in the use of trace metals, wherein elemental substitutions can occur under limiting conditions and excess intracellular accumulation of metals can occur when external concentrations are high [15,16]. Phytoplankton can modulate their growth, elemental stoichiometry and photosynthetic activity to respond to fluctuating levels of Cu concentration [17,18]. Moreover, varying Cu concentrations can alter the community compositions of phytoplankton, because diatoms have a higher tolerance than cyanobacteria and dinoflagellates [8].
Diatoms contribute roughly 20% of the total global primary production [19,20]. Consequently, diatoms were used as optimal-biological models to investigate ecotoxicological and environmental effects arising from stressors on marine ecosystems [21,22,23]. Cu influences phytoplankton growth [24,25] and cellular-elemental stoichiometry, as well as a range of biochemical process such as pigmentation, photosynthesis and biochemical composition [26]. Furthermore, variation in physicochemical factors including temperature, salinity and pH, can impose additional stress on marine organisms, while also influencing metal contaminants, thereby affecting their availability and toxicity to organisms. In particular, seawater temperature is a key factor that influences the toxicity of chemicals on phytoplankton [17]. Chemical toxicity generally varies with temperature [27] and a rise in temperature can promote a higher Cu tolerance in periphytic bacterial communities. These early studies assumed that an acceleration in pollution induced the acquisition of community tolerance via temperature-induced physiological enhancements [28]. In contrast, Morin et al. [28] demonstrated that increased Cu concentrations induced tolerance in diatom communities, but that tolerance decreases with increasing temperatures. Further, other studies have indicated that the toxicity of cadmium (Cd) generally increases with increasing temperature in the marine diatom Thalassiosira nordenskioeldii [29]. Thus, both the specific metal element and the diatom species should be considered when designing experiments to investigate metal toxicity in diatoms.
The Cu transport system is well-understood at the molecular level in Chlamydomonas reinhardtii [3], Saccharomyces cerevisiae [30] and plants [31]. However, the mechanisms of Cu transport and homeostasis in diatoms are not well understood. Cu uptake is biphasic, wherein two types of transporters may be involved: high-affinity systems (CTR) and low-affinity systems (ZIPs and NRAMP) [32,33]. Previous studies have suggested that the two Cu-transport systems are differentially controlled by low Fe and/or Cu. Other studies have demonstrated that exposure to Cu can induce the expression of photosynthetic genes and silica-shell formation genes. Furthermore, temperature can alter the metabolism of marine organisms, altering their response to heavy metal. Thalassiosira pseudonana is one of the most widely distributed marine diatoms worldwide and a genome is available for this species. In this study, integrative analyses were used to explore the possible response mechanisms of the T. pseudonana physiology and transcription toward the combined effects of Cu exposure and temperature variation.

2. Materials & Methods

In order to address the combined effects of temperature and Cu concentrations on Thalassiosira pseudonana, cultures of T. pseudonana (CCMP 1335) were exposed to two levels of different temperatures (20 and 25 °C) and five levels of Cu concentrations. The second factor was Cu concentration (0, 19.6, 160, 800 and 8000 nM). Thus, a two by five factorial design was chosen, with triplicate values of each response variable at each treatment. Details of this overview are given in the following sections.

2.1. Cell Culture and Experimental Design

Thalassiosira pseudonana (CCMP 1335) were obtained from the Xiamen University Center for Marine Phytoplankton and semi-continuously cultured at 20 °C in constant light condition in the medium Aquil (N: 300 mM) that was filter-sterilized using 0.22-μm of polycarbonate filters (Supplemental Table S1). Cultures were acclimated to a range of Cu concentrations (0, 19.6, 160, 800 and 8000 nM) at temperatures of 20 °C and 25 °C and a light intensity of 90 μmol photons m−2 s−1 for more than 10 generations prior to experimentation. All the glassware used in the experiments were cleaned with 10% of nitric acid, rinsed with ultrapure water and autoclaved before use. A stock solution of 2 g Cu L−1 was prepared in ultrapure water using copper sulfate pentahydrate (sigma). Cultures from the high temperature (25 °C) and the low temperature (20 °C) were in turn exposed to five Cu-concentration treatments. The algal cells were cultured in a 500 mL conical flask in a light incubator for 3 days, and the algal was mixed every 2 h. Then, cultures were collected to analyze the response variables from each of the triplicates in every treatment.

2.2. Growth Rates

Cell densities were obtained using a Z2 Coulter Counter. Growth rates were calculated from observed cell numbers using the equation: μ = (LnNt2 − LnNt1)/(t2 − t1), where Nt2 and Nt1 are the cell concentrations of the culture at t2 and t1. Growth rates were calculated from triplicate measurements of cell abundances for each culture.

2.3. Pigments and Chlorophyll Fluorescence Parameters

Absorbance spectra of cell extracts were determined at day 3 by filtering 15 mL of cultures through a Whatman GF/F glass-fiber filter (25 mm diameter). The filters were placed in 10 mL centrifuge tubes and 8 mL of 90% acetone was immediately added while avoiding light. The samples were then placed at a temperature of 4 °C overnight to extract the pigments, and then centrifuged at 5000× g for 10 min. The supernatant was removed and measured using a UV-Vis spectrophotometer (SP-752, Shanghai spectrum instruments) at absorbances of 480, 510, 630, 664 and 750 nm. Pigment values were then calculated using the Ritchie method [34].
Chlorophyll fluorescence was determined using a pulse-amplitude modulated fluorometer (water-PAM, Walz, Germany). Two samples were taken from each flask. One sample was incubated in the dark, adapted for 15 min first to relax any photosynthetic activity. The maximal efficiency of PS II photochemistry was then determined as the ratio of variable to maximal chlorophyll fluorescence (Fv/Fm), where Fv = (Fm − F0), and Fm and F0 represent the maximal and minimal fluorescence yield of a dark-adapted suspension, respectively. The chlorophyll fluorescence of the other sample was determined at an actinic light of 96 μmol photons m−2 s−1. The effective efficiency of PS II photochemistry was then determined as the ratio of variable to effective chlorophyll fluorescence (Fv′/Fm′), where Fv′ = (Fm′ − F0′), and Fm′ and F0′ are the maximal and minimal fluorescence yield of an actinic light suspension, respectively, and the non-photochemical quenching-NPQ = (Fm − Fm′)/Fm′.

2.4. Intracellular Copper

Cells were filtered with 1.2 μm of polycarbonate filters, and the cells retained by the filters were washed with 15 mL of a 1 mM EDTA·2Na solution to remove surface-adsorbed metals and then rinsed with ultrapure water [35]. Samples were then digested for 6 h at 65 °C on a hot plate with 2 mL of ultrapure HNO3. Total and intercellular metal extracts were then filtered before diluting to 10 mL of ultrapure water in a 15 mL volumetric flask, and then analyzed using an Agilen ICP-MS (7700).

2.5. Intracellular POC, PON, POP and BSi

To measure particulate organic carbon (POC), nitrogen (PON), Particular organic phosphorus (POP) and biogenic silicon (BSi), each sample was taken at 25 mL to filter through pre-weighed, pre-combusted (450 °C for 6 h) GF/F filters. The filter membranes were then placed in a sealed sample box with concentrated hydrochloric acid and then dried at 65 °C. The result samples were then analyzed with an elemental analyzer (PerkinElmer 2400 Ⅱ). Biogenic silicon (BSi) and particular organic phosphorus (POP) were analyzed following procedures by Passche [36] and Solórzano et al. [37], respectively.

2.6. RNA Extraction and Quantitative Real-Time PCR

Cells from the cultures were harvested onto 25 mm polycarbonate filters with 1.2 μm porosity and then flash-frozen in liquid nitrogen and stored at −80 °C until further RNA extraction. Cell lysis and total-cellular RNA isolation were performed using an RNAiso Plus kit (Takara). In the first treatment (hereafter designated as the RNAiso Plus + liquid N2 method), the homogenization step was replaced by a simultaneous flash-freezing of the cells using liquid nitrogen in a pre-chilled mortar, followed by continuous grinding with a pestle while adding 1 mL of the RNAiso Plus reagent to the lyse cells and efficiently extracting RNA. Care was taken in order to prevent the cells from thawing before the RNAiso Plus regent was added into the Sample. As the frozen RNAiso Plus-cell mixture started to thaw, homogenization was continued until the RNAiso Plus was also pulverized, as previously described [38]. The remaining steps were as recommended in the manufacturer RNAiso Plus protocol. The purity of extracted RNA was verified by RT-qPCR to ensure the lack of genomic DNA contamination. Purified total-RNA was quantified spectrophotometrically, and 1000 ng were reverse-transcribed into first-strand cDNAs in 20 μL reaction using the 2×RealStar Power SYBR Mixture (GenStar). Gene-specific primers for RT-qPCR, with amplicon sizes in the range of 90–200 bp, were designed based on the available genomic sequence data for T. pseudonana or otherwise based on previous reports [17,39,40]. cDNA was then amplified with RT-qPCR using those gene-specific primers (Table 1) and SYBR Green Supermix. Each 20 μL PCR reaction contained 0.2 μmol L−1 each of the forward and reverse primers, and 2 ng transcribed RNA. RT-qPCR was performed on the iQ5 real-time system with thermal cycling conditions as follows: 95 °C for 10 min followed by 40 cycles of 95 °C for 15 s and 60 °C for 30 s. Melt curve analysis began at 95 °C for 1 s, followed by 65 °C for 15 s. Transcript abundance was then determined using the 2(−ΔCt) method [41] from technical duplicates of each biological triplicate. The ΔCt values were calculated after normalization to the template numbers of the endogenous reference gene TpActin_25772.

2.7. Data analysis

All data are expressed as mean ± 1 standard deviation (SD). Each treatment was performed in triplicate. t-test and One-way ANOVA (LSD test) were used to compare the different parameters (e.g., growth rate, Chla, Chlc, Carotenoid, Fv/Fm, Yield, NPQ, Cu content, POC: Chla) among the 10 different treatments. We checked the normality, equal variances and independence were met before we conducted the one-way ANOVA. Multiple-way analysis of variance (MANOVA) was used to determine whether there were significant differences among the two factors (temperature and Cu content). All statistical analyses were performed using SPSS 16.0 (SPSS, Inc., Chicago, IL, USA). The significant level was set at p < 0.05.

3. Results

3.1. Growth Rates

Copper addition significantly increased the growth rates of Thalassiosira pseudonana at 20 °C and 25 °C when Cu concentrations were less than 160 nM (Figure 1). However, increasing copper concentration significantly reduced the growth rates of T. pseudonana at 20 °C when Cu concentrations were more than 160 nM (Figure 1). In contrast, increased Cu did not significantly alter the growth rates at 25 °C (Figure 1). In addition, the 5 °C temperature increase also influenced the growth rates of T. pseudonana (Figure 1). The growth rates of T. pseudonana at 25 °C significantly increased relative to T. pseudonana at 20 °C by 41.8%, 32.1%, 26.1%, 39.7% and 49.3% at the five different Cu concentrations (p < 0.05) (Figure 1, Supplemental Table S2).

3.2. Pigments and Chlorophyll Fluorescence Parameters

At the higher temperature (25 °C), the concentrations of pigments including Chla, Chlc and carotenoid increased in T. pseudonana (Figure 2A). In addition, Cu concentration and temperature had no effect on Chla content, and Chlc had significantly increased under high temperature at 160 nM and nM Cu concentrations (Figure 2A). After 25 °C, carotenoid content of five copper-concentration groups increased, and there were significant differences, except for 800 nM (Figure 2A). For T. pseudonana grown at 20 °C and 25 °C, a significant difference was observed between Fv/Fm and Fv′/Fm′ with increased Cu concentration. The results indicate that elevated temperature can improve the Fv/Fm and Fv′/Fm′ of T. pseudonana (Figure 2B). Additionally, the NPQ also increased significantly in the treatment of 8000 nM Cu concentration at 20 °C and 25 °C.

3.3. Intracellular Elemental Contents

The intracellular Cu content in T. pseudonana ranged from 0.13 to 13.28 fg cell−1 and increased with increasing Cu-concentration treatments (Figure 3). Increased growth temperature significantly reduced the intracellular Cu content of T. pseudonana, with the exception of the highest Cu concentration. There were no significant changes in the POC:PON ratio throughout all of the treatments (Figure 4A). The POC:POP, PON:POP and BSi:POP ratios of T. pseudonana grown at 25 °C decreased relative to that grown at 20 °C in all of the treatments (Figure 4). There were no significant changes in POC:POP and PON:POP ratios when Cu was increased at 20 °C. However, increasing Cu significantly decreased the POC:POP and PON:POP ratios at 25 °C (Figure 4B,C). Increasing Cu decreased the BSi:POP ratio of T. pseudonana in all of the treatments, except that grown at 0 nM Cu (Figure 4D). The POC:Chla ratio of T. pseudonana grown at 25 °C decreased, relative to that grown at 20 °C, by 8.7%, 12.7%, 5.1%, 15.4% and 1.9% when grown with the five different Cu concentration treatments, respectively (Figure 5). The POC:Chla ratio decreased when Cu concentrations increased from 0 to 19.6 nM, but the ratio increased when Cu concentrations increased from 19.6 to 8000 nM (Figure 5).

3.4. Gene Expression

Temperature alters the transcription and expression of many genes, including Cu transport, ZIP, photosynthetic, and silica shell formation-related genes. Under low Cu concentrations, CTR_24275 and CTR_9391 expression increased at both 20 °C and 25 °C (Figure 6A). However, the expression of these two genes differed with respect to temperature, wherein the higher-growth temperature induced the expression of CTR_9391 (Figure 6A). Increased Cu concentrations inhibited the expression of CTP_263051 and CTP_264357 (Figure 6A). In particular, the expression of CTP_264357 was significantly inhibited at 25 °C (Figure 6A). At high-Cu concentrations, the expression of COX_37139 and COX17_264096 were reduced at both 20 °C and 25 °C (Figure 6A). Likewise, the expression of SCO1_30986 was reduced at both 20 °C and 25 °C under high-Cu concentration treatments (Figure 6A). Increased temperature will promote the expression of these two genes. Higher-growth temperature induced the expression of FET3_5574, FRE1_11375, and FTR1_268009 during most of the Cu concentration treatments (Figure 6B). In addition, increased-growth temperature and Cu concentrations induced the expression of NRAMP_9840 (Figure 6B). The expression of five ZIP genes differed based on temperature and Cu concentrations. For example, the expression levels of ZIP_11826 and ZIP_268980 were inhibited at 25 °C (Figure 6B). Under high-Cu concentrations, the expression of ZIP_26890 was inhibited when cultures were grown at 20 °C, but induced with growth at 25 °C (Figure 6B). 3HfcpA and 3HfcpB also exhibited lower expression levels at 25 °C, but the transcription expression of 3HfcpA_1778744 and 3HfcpB_1778746 decreased with increasing Cu concentrations (Figure 6C). Lastly, higher Cu concentrations inhibited the expression of Sil1_52355302 and Sit1_224002055 (Figure 6C).

4. Discussion

4.1. Growth Rates

Here, we investigate the role of Cu and ambient temperatures on the growth and physiological responses of the diatom T. pseudonana. Cu is essential for many physiological processes in phytoplankton, including electron-transfer reactions and high-affinity Fe transport systems, therefore low-Cu concentrations can also limit phytoplankton growth, as observed in the coccolithophore and T. oceanic [7]. Therefore, slight increases in ambient Cu concentrations have been shown to trigger the growth of P. tricornutum [25]. We found that increased Cu concentrations appeared to stimulate the growth of T. pseudonana at lower concentrations, which is consistent with previous studies [43,44]. Taken together, the results of this study and others suggest that Cu is an essential element for phytoplankton. However, Cu can also be potentially toxic at high concentrations. Increased copper concentration significantly reduced the growth rates of T. pseudonana at 20 °C (Figure 1). Jordi, Basterretxea et al. have shown that Cu aerosols can inhibit phytoplankton growth in the Mediterranean sea [45]. Further, high-Cu concentrations can inhibit Phaeocystis cordata growth, both in batch and semi-continuous cultures [46]. T. pseudonana exhibited a reduced growth at 20 °C under high-Cu concentrations, but little inhibition at 25 °C (Figure 1). Overall, the high-Cu concentration treatments decreased the growth of T. pseudonana.
Earth-system models predict that global warming will result in significant a decline in net-primary production by marine phytoplankton throughout the 21st century; this will be driven by rising temperatures which exceed the limits of thermal tolerances of phytoplankton, in addition to increasing grazing, nutrient limitations and more stratified ocean waters [47]. However, some species grow faster under increased cultivation temperatures [48,49]. Accordingly, our results also show that increased cultivation temperature significantly increased the growth rate of T. pseudonana (Figure 1). In addition to the direct effects of temperature on physiology, it can indirectly alter the effects of Cu concentrations on phytoplankton growth. Our results indicated that declines in growth rates were a result of higher Cu concentrations that were affected by increased temperatures. Consistent with this result, spring lacustrine phototrophic periphyton growing at 18 °C were more sensitive to a herbicide mixture than those growing at higher temperatures [50]. Further, a recent study indicated a decrease in Cu tolerance of winter phototrophic periphyton coincided with temperature changes, where higher temperatures decreased the diversity of diatom species and also exacerbated the community sensitivity towards Cu [28].

4.2. Chlorophyll Fluorescence Parameters

Quantum yield analysis indicated that T. pseudonana were characterized by relatively high Fv/Fm, suggesting that T. pseudonana possessed relatively high activity PS II complexes. A slight decrease in Fv/Fm values was observed in T. pseudonana grown with increased Cu concentration and at 20 °C (Figure 2B). In contrast, no significant differences in Fv/Fm values were observed when grown under different Cu concentrations and at 25 °C, although the Fv/Fm values were generally higher than those for T. pseudonana grown at 20 °C (Figure 2B). Taken together, these results suggest that the T. pseudonana PS II complex was relatively sensitive to Cu stress, but increased temperatures mitigated these deleterious effects. Thus, increased growth temperatures may help improve PS II recovery of T. pseudonana treat with high-Cu concentration stress.

4.3. Intracellular Elemental Contents

Diatom (e.g., T. pseudonana, P. tricornutum and T. weissflogii) exhibit a higher tolerance to increased Cu levels compared to chrysophyceae (e.g., Gephyrocapsa oceanica) dinoflagellates (e.g., Peridinium sp.) and Cyanobacteria (e.g., Synechococcus spp.) [8]. It is possible that copper binds more strongly to the mucopolysaccharide cell wall of the cyanobacteria than it does to the fundamentally different types of cell walls of eukaryotic algae (predominantly cellulose) [8]. The Cu content in P. tricornutum has been shown to range from 1.3 to 12.8 fg cell−1 [25], which coincides with the range reported here for T. psuedonana. T. pseudonana appeared to particularly adapt to higher Cu concentrations and grew well in the presence of 8000 nM Cu (Figure 1). Concomitantly, their intracellular Cu was far lower than that observed in other species that exhibit Cu toxicity symptoms [51,52].
Only a few studies have explored the phenotypic flexibility in C:N:P of microalgae during exponential growth; therefore, more studies are needed to better understand the effect of micro/macro-nutrient and temperature [53]. The POC:PON ratio is a key parameter in algal growth and is dependent on the variability in the availability of nutrients as well as growth temperature. Reay et al. [54] found that phytoplankton-specific affinity for nitrate is temperature-dependent below optimal temperatures, and diatom nitrate reductase activity declines rapidly as temperatures exceed optimal growth levels [55]. The higher POC:PON ratios of T. australis at low temperature, compared to high temperature (optimal temperature), suggest that suboptimal temperatures could have limited nitrate uptake relative to carbon fixation [56]. No significant differences in the POC:PON ratio were observed among the cultures in this study, although the POC:PON ratio was decreased with an increasing growth temperature (Figure 4). However, previous studies have suggested that warming can reduce intracellular POC:PON, POC:POP, PON:POP and BSi: POP ratios [57,58,59] due to higher temperatures promoting cell metabolism and increased carbon consumption [47,60]. Hillebrand et al. [61] observed a trend of decreasing N:P ratio and variability with increasing growth rate in phytoplankton, suggesting that fast-growing phytoplankton in general require more P and also have a relatively low PON:POP ratio compared with slow-growing phytoplankton. Another key parameter that characterizes algal growth is the POC: Chla ratio. The POC: Chla ratios increased at low and high Cu levels or low temperature, which suggested that the cell needed more energy to maintain Cu homeostasis when they are in extreme environments. Geider [62] demonstrated that the relationship between the POC: Chla ratio and growth can be described by a linear model. He also parameterized the dependence of the POC: Chla ratio on temperature and demonstrated that the POC: Chla ratio decreases with increasing growth temperature, similar to the results observed in this study (Figure 5). POC: Chla could be a useful indicator for ecological and physiological conditions of phytoplankton communities and, additionally, it is a photoacclimation index, which can help us to understand primary productivity, and is highly variable over space and time and among different species, ranging from about 20 to over 200 g g−1 in the ocean. Variation in POC: Chla ratios have been established as a sensitive indicator that quantifies the adjustment of phytoplankton cellular pigment levels to the new demands for photosynthesis, caused by changes in ambient temperature, nutrients, and light conditions [63].

4.4. Gene Expression

Gene transcription represents a rapid physiological response to environmental change. Previous research has demonstrated that Cu addition provokes a decreased relative expression of two CTR-like genes (CTR_24275 and CTR_9391), two putative Cu-transporting P1B-type ATPases (CTP_263051 and CTP_264357) and two Cu-chaperones (COX11_37139 and COX17_264096) over short time scales [40]. In the aforementioned study, CTR_24275 and COX_264096 mRNA had rebounded to almost to the initial expression levels after 12 h of incubation with Cu addition. These results suggest that the expression of the two genes CTR_24275 and COX_264096 can acclimate to environmental changes. In this study, the relative expression of COX_264096 was only inhibited by increasing copper additions (Figure 6A). This difference may be explained by coastal diatoms exhibiting a lower sensitivity to environmental conditions than oceanic diatoms. In addition, the genes ToCTR1 and ToCTR2 were down-regulated in T. oceanica in response to increasing Cu concentrations [10]. ZIPs and NARMP are the low affinity Cu transport system that also exhibited altered expression with varying Cu concentrations and temperature. In addition, the expression of respiration-related genes can be altered when acclimating to varying Cu concentrations and temperatures. COX11 is described as an inner mitochondrial membrane integral protein that is essential for cytochrome c oxidase assembly [64,65]. Likewise, COX17 is involved in the assembly of the cytochrome c oxidase protein and is involved in copper donation to both SCO1 and COX11 [66], in the intermembrane space [16,67,68]. Our results indicated that T. pseudonana reduced the absorption of Cu by reducing the expression of COX17_264096, COX11_37139 and SCO1_30986 in order to protect against Cu toxicity to the respiration system. Numerous studies have indicated that warming accelerates the respiratory activity of organisms [47,60]. Consistent with these observations, our results indicated that the expression of COX17_264096, COX11_37139 and SCO1_30986 increased with increased growth temperatures (Figure 6A). The increased expression of photosynthetic proteins 3HfcpA_1778744 and 3HfcpB_1778746 in T. pseudonana likely occurred to maintain photosynthetic performance in response to environmental stress, which is consistent with other studies [17,67]. Our results indicate that T. pseudonana can grow fast by inducing the expression of 3HfcpA_1778744 and 3HfcpB_1778746 under low Cu concentration conditions (Figure 6C).

5. Conclusions

Cu is a micronutrient that is involved in many of the metabolic processes in diatoms including photosynthesis, respiration, antioxidant activities, cell well metabolism, and hormone perception. Consequently, the growth of diatoms is inhibited when they experience Cu-limitation in open oceans. However, excessive Cu concentrations can also physiologically damage diatoms growing in coastal waters. In this study, increased growth temperature altered the effect of excess Cu concentrations on T. pseudonana growth. There is no interactive effects of temperature and Cu concentrations on T. pseudonana pigment content, POC, PON, POP, BSi (or POC: PON, POC: POP, PON: POP and BSi: POP ratios), although each was responsive to individual factors. Nevertheless, the combination of increased temperature and Cu concentrations altered the transcription of genes, including photosynthetic and silicon synthesis genes under different Cu concentration and temperature conditions. Heavy metal accumulation is an intensive contemporary problem for marine environments [69]. Consequently, understanding metal homeostasis is critical to ascertain the effects of heavy metals on marine ecosystem taxa and processes. Cu is a particularly integral trace metal for phytoplankton, and thus, exploring Cu homeostasis, including g intracellular location [70] and Cu-sensing and regulation-processing [71], is necessary to evaluate the combined effect of Cu and environmental stressors on marine taxa and ecosystems. The results reported here provide a framework for better understanding the adaptability of important marine diatoms to increase metal stress and ambient temperatures.

Supplementary Materials

The following are available online at https://www.mdpi.com/article/10.3390/jmse9080816/s1.

Author Contributions

Conceptualization: W.L. and P.L.; Methodology, X.W., W.C.; Software, H.D.; writing—original draft preparation, X.W., P.L.; writing—review and editing, H.D., W.L.; Funding acquisition, W.L., P.L. All authors have read and agreed to the published version of the manuscript.

Funding

This study was supported by the Southern Marine Science and Engineering Guangdong Laboratory (Guangzhou) (GML2019ZD0606), Science and Technology Planning Project of Guangdong Province (2020A1414010195).

Institutional Review Board Statement

Not applicable.

Informed Consent Statement

Not applicable.

Data Availability Statement

Not applicable.

Acknowledgments

This study was supported by Key Special Project for Introduced Talents Team of Southern Marine Science and Engineering Guangdong Laboratory (Guangzhou) (GML2019ZD0606) and Science and Technology Planning Project of Guangdong Province (2020A1414010195).

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. Raven, J.A.; Evans, M.C.W.; Korb, R.E. The role of trace metals in photosynthetic electron transport in O 2 -evolving organisms. Photosynth. Res. 1999, 60, 111–150. [Google Scholar] [CrossRef]
  2. Peers, G.; Quesnel, S.A.; Price, N.M. Copper requirements for iron acquisition and growth of coastal and oceanic diatoms. Limnol. Oceanogr. 2005, 50, 1149–1158. [Google Scholar] [CrossRef]
  3. Blabyhaas, C.E.; Merchant, S.S. Regulating cellular trace metal economy in algae. Curr. Opin. Plant Biol. 2017, 39, 88–96. [Google Scholar] [CrossRef] [Green Version]
  4. Graham, P.; Price, N.M. Copper-containing plastocyanin used for electron transport by an oceanic diatom. Nature 2006, 441, 341. [Google Scholar]
  5. Kropat, J.; Gallaher, S.D.; Urzica, E.I.; Nakamoto, S.S.; Strenkert, D.; Tottey, S.; Mason, A.Z.; Merchant, S.S. Copper economy in Chlamydomonas: Prioritized allocation and reallocation of copper to respiration vs. photosynthesis. Proc. Natl. Acad. Sci. USA 2015, 112, 2644–2651. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  6. Annett, A.L.; Lapi, S.; Ruth, T.J.; Maldonado, M.T. The effects of Cu and Fe availability on the growth and Cu : C ratios of marine diatoms. Limnol. Oceanogr. 2008, 53, 2451–2461. [Google Scholar] [CrossRef] [Green Version]
  7. Guo, J.; Lapi, S.; Ruth, T.J.; Maldonado, M.T. The effects of iron and copper availability on the copper stoichiometry of marine phytoplankton1. J. Phycol. 2012, 48, 312–325. [Google Scholar] [CrossRef]
  8. Brand, L.E.; Sunda, W.G.; Guillard, R.R.L. Reduction of marine phytoplankton reproduction rates by copper and cadmium. J. Exp. Mar. Biol. Ecol. 1986, 96, 225–250. [Google Scholar] [CrossRef]
  9. Sunda, W.G. The Relationship Between Cupric Ion Activity and the Toxicity of Copper to Phytoplankton. J. Mar. Res. 1975. [Google Scholar] [CrossRef]
  10. Kong, L.; Price, N.M. Functional CTR-type Cu(I) transporters in an oceanic diatom. Environ. Microbiol. 2019, 21, 98–110. [Google Scholar] [CrossRef] [Green Version]
  11. Manimaran, K.; Karthikeyan, P.; Ashokkumar, S.; Prabu, V.A.; Sampathkumar, P. Effect of Copper on Growth and Enzyme Activities of Marine Diatom, Odontella mobiliensis. Bull. Environ. Contam. Toxicol. 2012, 88, 30–37. [Google Scholar] [CrossRef]
  12. Nguyen-Deroche, T.L.N.; Le, T.T.; Bui, T.V.; Rince, Y.; Tremblin, G.; Morant-Manceau, A. Effects of copper on growth and photosynthesis in marine diatoms: A comparison between species from two different geographical areas. Cryptogam. Algol. 2009, 30, 97–109. [Google Scholar]
  13. Harrison, W.G.; Eppley, R.W.; Renger, E.H. Phytoplankton Nitrogen Metabolism, Nitrogen Budgets, and Observations on Copper Toxicity: Controlled Ecosystem Pollution Experiment. Bull. Mar. Sci. Miami 1977, 27, 44–57. [Google Scholar]
  14. Jgjr, R.; Chisholm, S.W.; Fmm, M. Effects of copper toxicity on silicic acid uptake and growth in Thalassiorsira Pseudonana. J. Phycol. 2010, 17, 270–278. [Google Scholar]
  15. Moore, C.M.; Mills, M.M.; Arrigo, K.R.; Bermanfrank, I.; Bopp, L.; Boyd, P.W.; Galbraith, E.D.; Geider, R.J.; Guieu, C.; Jaccard, S.L. Processes and patterns of oceanic nutrient limitation. Nat. Geosci. 2013, 6, 701–710. [Google Scholar] [CrossRef] [Green Version]
  16. Smith, A.D.; Logeman, B.L.; Thiele, D.J. Copper Acquisition and Utilization in Fungi. Annu. Rev. Microbiol. 2017, 71, 597. [Google Scholar] [CrossRef] [PubMed]
  17. Leung, P.T.; Yi, A.X.; Ip, J.C.; Mak, S.S.; Leung, K.M. Photosynthetic and transcriptional responses of the marine diatom Thalassiosira pseudonana to the combined effect of temperature stress and copper exposure. Mar. Pollut. Bull. 2017, 124, 938–945. [Google Scholar] [CrossRef]
  18. Twining, B.S.; Baines, S.B. The Trace Metal Composition of Marine Phytoplankton. In Annual Review of Marine Science; Carlson, C.A., Giovannoni, S.J., Eds.; Annual Review of Marine Science; Annual Reviews: Palo Alto, CA, USA, 2013; Volume 5, pp. 191–215. [Google Scholar]
  19. Falkowski, P.G.; Barber, R.T.; Smetacek, V.V. Biogeochemical Controls and Feedbacks on Ocean Primary Production. Science 1998, 281, 200–207. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  20. Field, C.B.; Behrenfeld, M.J.; Randerson, J.T.; Falkowski, P. Primary production of the biosphere: Integrating terrestrial and oceanic components. Science 1998, 281, 237–240. [Google Scholar] [CrossRef] [Green Version]
  21. Davis, A.K.; Hildebrand, M.; Palenik, B. Gene Expression Induced by Copper Stress in the Diatom Thalassiosira pseudonana. Eukaryot. Cell 2006, 5, 1157. [Google Scholar] [CrossRef] [Green Version]
  22. Bao, V.W.; Leung, K.M.; Qiu, J.W.; Lam, M.H. Acute toxicities of five commonly used antifouling booster biocides to selected subtropical and cosmopolitan marine species. Mar. Pollut. Bull. 2011, 62, 1147–1151. [Google Scholar] [CrossRef]
  23. Guo, R.; Lee, M.A.; Ki, J.S. Different transcriptional responses of heat shock protein 70/90 in the marine diatom Ditylum brightwellii exposed to metal compounds and endocrine-disrupting chemicals. Chemosphere 2013, 92, 535–543. [Google Scholar] [CrossRef]
  24. Lürling, M.; Eshetu, F.; Faassen, E.J.; Kosten, S.; Huszar, V.L.M. Comparison of cyanobacterial and green algal growth rates at different temperatures. Freshw. Biol. 2013, 58, 552–559. [Google Scholar] [CrossRef]
  25. Wang, D.; Xia, W.; Kumar, K.S.; Gao, K. Increasing copper alters cellular elemental composition (Moand P) of marine diatom. Ecol. Evol. 2017, 7, 3362–3371. [Google Scholar] [CrossRef]
  26. Garcia, N.S.; Sexton, J.; Riggins, T.; Brown, J.; Lomas, M.W.; Martiny, A.C. High Variability in Cellular Stoichiometry of Carbon, Nitrogen, and Phosphorus Within Classes of Marine Eukaryotic Phytoplankton Under Sufficient Nutrient Conditions. Front. Microbiol. 2018, 9, 543. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  27. Zhou, G.J.; Wang, Z.; Lau, E.T.C.; Xu, X.R.; Leung, K.M.Y. Can we predict temperature-dependent chemical toxicity to marine organisms and set appropriate water quality guidelines for protecting marine ecosystems under different thermal scenarios? Mar. Pollut. Bull. 2014, 87, 11–21. [Google Scholar] [CrossRef] [PubMed]
  28. Morin, S.; Lambert, A.S.; Rodriguez, E.P.; Dabrin, A.; Coquery, M.; Pesce, S. Changes in copper toxicity towards diatom communities with experimental warming. J. Hazard. Mater. 2017, 334, 223. [Google Scholar] [CrossRef] [Green Version]
  29. Wang, M.J.; Wang, W.X. Temperature-dependent sensitivity of a marine diatom to cadmium stress explained by subcelluar distribution and thiol synthesis. Environ. Sci. Technol. 2008, 42, 8603. [Google Scholar] [CrossRef]
  30. Van, H.A.; Ward, D.M.; Kaplan, J. Transition metal transport in yeast. Annu. Rev. Microbiol. 2002, 56, 237–261. [Google Scholar] [CrossRef]
  31. Pilon, M.; Abdel-Ghany, S.E.; Cohu, C.M.; Gogolin, K.A.; Ye, H. Copper cofactor delivery in plant cells. Curr. Opin. Plant Biol. 2006, 9, 256–263. [Google Scholar] [CrossRef]
  32. Knauer, K.; Behra, R.; Sigg, L. Adsorption and uptake of copper by the green alga scenedesmus subspicatus (chlorophyta). J. Phycol. 1997, 33, 596–601. [Google Scholar] [CrossRef]
  33. Guo, J.; Annett, A.L.; Taylor, R.L.; Lapi, S.; Ruth, T.J.; Maldonado, M.T. Copper-uptake kinetics of coastal and oceanic diatoms¹. J. Phycol. 2010, 46, 1218–1228. [Google Scholar] [CrossRef]
  34. Ritchie, R.J. Consistent sets of spectrophotometric chlorophyll equations for acetone, methanol and ethanol solvents. Photosynth. Res. 2006, 89, 27–41. [Google Scholar] [CrossRef]
  35. BRÄUTIGAM, A.; Schaumlöffel, D.; Preud’Homme, H.; Thondorf, I.; Wesenberg, D. Physiological characterization of cadmium-exposed Chlamydomonas reinhardtii. Plant Cell Environ. 2011, 34, 2071–2082. [Google Scholar] [CrossRef]
  36. Paasche, E. Silicon and the ecology of marine plankton diatoms. I. Thalassiosira pseudonana ( Cyclotella nana ) grown in a chemostat with silicate as limiting nutrient. Mar. Biol. 1973, 19, 117–126. [Google Scholar] [CrossRef]
  37. Solorzano, L.; Sharp, J.H. Determination of Total Dissolved Phosphorus and Particulate Phosphorus in Natural Waters. Limnol. Oceanogr. 1980, 25, 754–758. [Google Scholar] [CrossRef]
  38. Poong, S.W.; Lim, P.E.; Lai, J.W.S.; Phang, S.M. Optimization of high quality total RNA isolation from the microalga, Chlorella sp (Trebouxiophyceae, Chlorophyta) for next-generation sequencing. Phycol. Res. 2017, 65, 146–150. [Google Scholar] [CrossRef]
  39. Kustka, A.B.; Allen, A.E.; Morel, F.M.M. Sequence analysis and transcriptional regulation of iron acquisition genes in two marine diatoms. J. Phycol. 2007, 43, 715–729. [Google Scholar] [CrossRef]
  40. Guo, J.; Green, B.R.; Maldonado, M.T. Sequence Analysis and Gene Expression of Potential Components of Copper Transport and Homeostasis in Thalassiosira pseudonana. Protist 2015, 166, 58–77. [Google Scholar] [CrossRef]
  41. Pfaffl, M.W. A new mathematical model for relative quantification in real-time RT-PCR. Nucleic Acids Res. 2001, 29, e45. [Google Scholar] [CrossRef]
  42. Bopp, S.K.; Lettieri, T. Gene regulation in the marine diatom Thalassiosira pseudonana upon exposure to polycyclic aromatic hydrocarbons (PAHs). Gene 2007, 396, 293–302. [Google Scholar] [CrossRef] [PubMed]
  43. Bao, V.W.W.; Leung, K.M.Y.; Kwok, K.W.H.; Zhang, A.Q.; Lui, G.C.S. Synergistic toxic effects of zinc pyrithione and copper to three marine species: Implications on setting appropriate water quality criteria. Mar. Pollut. Bull. 2008, 57, 616–623. [Google Scholar] [CrossRef]
  44. Biswas, H.; Bandyopadhyay, D.; Waite, A. Copper addition helps alleviate iron stress in a coastal diatom: Response of Chaetoceros gracilis from the Bay of Bengal to experimental Cu and Fe addition. Mar. Chem. 2013, 157, 224–232. [Google Scholar] [CrossRef]
  45. Jordi, A.; Basterretxea, G.; Tovarsánchez, A.; Alastuey, A.; Querol, X. Copper aerosols inhibit phytoplankton growth in the Mediterranean Sea. Proc. Natl. Acad. Sci. USA 2012, 109, 21246–21249. [Google Scholar] [CrossRef] [Green Version]
  46. Lombardi, A.T.; Maldonado, M.T. The effects of copper on the photosynthetic response of Phaeocystis cordata. Photosynth. Res. 2011, 108, 77–87. [Google Scholar] [CrossRef]
  47. Schaum, C.E.; Buckling, A.; Smirnoff, N.; Studholme, D.; Yvondurocher, G. Environmental fluctuations accelerate molecular evolution of thermal tolerance in a marine diatom. Nat. Commun. 2018, 9, 1719. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  48. Boyd, P.W.; Dillingham, P.W.; McGraw, C.M.; Armstrong, E.A.; Cornwall, C.E.; Feng, Y.Y.; Hurd, C.L.; Gault-Ringold, M.; Roleda, M.Y.; Timmins-Schiffman, E.; et al. Physiological responses of a Southern Ocean diatom to complex future ocean conditions. Nat. Clim. Chang. 2016, 6, 207–213. [Google Scholar] [CrossRef]
  49. Schaum, C.E.; Barton, S.; Bestion, E.; Buckling, A.; Garcia-Carreras, B.; Lopez, P.; Lowe, C.; Pawar, S.; Smirnoff, N.; Trimmer, M. Adaptation of phytoplankton to a decade of experimental warming linked to increased photosynthesis. Nat. Ecol. Evol. 2017, 1, 94. [Google Scholar] [CrossRef]
  50. Larras, F.; Lambert, A.S.; Pesce, S.; Rimet, F.; Bouchez, A.; Montuelle, B. The effect of temperature and a herbicide mixture on freshwater periphytic algae. Ecotoxicol. Environ. Saf. 2013, 98, 162–170. [Google Scholar] [CrossRef]
  51. Levy, J.L.; Angel, B.M.; Stauber, J.L.; Poon, W.L.; Simpson, S.L.; Cheng, S.H.; Jolley, D.F. Uptake and internalisation of copper by three marine microalgae: Comparison of copper-sensitive and copper-tolerant species. Aquat. Toxicol. 2008, 89, 82–93. [Google Scholar] [CrossRef] [Green Version]
  52. Debelius, B.; Forja, J.M.; Delvalls, A.; Lubián, L.M. Toxicity and bioaccumulation of copper and lead in five marine microalgae. Ecotoxicol. Environ. Saf. 2009, 72, 1503–1513. [Google Scholar] [CrossRef]
  53. Laroche, J. Redfield revisited: Variability of C[ratio]N[ratio]P in marine microalgae and its biochemical basis. Eur. J. Phycol. 2002, 37, 1–17. [Google Scholar]
  54. Reay, D.S.; Nedwell, D.B.; Priddle, J.; Ellis-Evans, J.C. Temperature dependence of inorganic nitrogen uptake: Reduced affinity for nitrate at suboptimal temperatures in both algae and bacteria. Appl. Environ. Microbiol 1999, 65, 2577–2584. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  55. Lomas, M.W.; Glibert, P.M. Temperature Regulation of Nitrate Uptake: A Novel Hypothesis about Nitrate Uptake and Reduction in Cool-Water Diatoms. Limnol. Oceanogr. 1999, 44, 556–572. [Google Scholar] [CrossRef]
  56. Zhu, Z.; Qu, P.; Fu, F.; Tennenbaum, N.; Tatters, A.O.; Hutchins, D.A. Understanding the blob bloom: Warming increases toxicity and abundance of the harmful bloom diatom Pseudo-nitzschia in California coastal waters. Harmful Algae 2017, 67, 36. [Google Scholar] [CrossRef] [PubMed]
  57. Spilling, K.; Ylostalo, P.; Simis, S.; Seppala, J. Interaction Effects of Light, Temperature and Nutrient Limitations (N, P and Si) on Growth, Stoichiometry and Photosynthetic Parameters of the Cold-Water Diatom Chaetoceros wighamii. PLoS ONE 2015, 10, e0126308. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  58. Yu, J.; Wang, P.; Wang, Y.; Chang, J.; Deng, S.; Wei, W. Thermal constraints on growth, stoichiometry and lipid content of different groups of microalgae with bioenergy potential. J. Appl. Phycol. 2018, 30, 1503–1512. [Google Scholar] [CrossRef]
  59. Bi, R.; Ismar, S.; Sommer, U.; Zhao, M. Environmental dependence of the correlations between stoichiometric and fatty acid-based indicators of phytoplankton nutritional quality. Limnol. Oceanogr. 2017, 62, 334–347. [Google Scholar] [CrossRef]
  60. Padfield, D.; Yvon-Durocher, G.; Buckling, A.; Jennings, S.; Yvon-Durocher, G.; Hillebrand, H. Rapid evolution of metabolic traits explains thermal adaptation in phytoplankton. Ecol. Lett. 2016, 19, 133–142. [Google Scholar] [CrossRef] [Green Version]
  61. Hillebrand, H.; Steinert, G.; Boersma, M.; Malzahn, A.M.; Meunier, C.L.; Plum, C.; Patcnik, R. Goldman revisited: Faster-growing phytoplankton has lower N : P and lower stoichiometric flexibility. Limnol. Oceanogr. 2013, 58, 2076–2088. [Google Scholar] [CrossRef]
  62. Geider, R.J. Light and temperature dependence of the carbon to chlorophyll a ratio in microalgae and cyanobacteria: Implications for physiology and growth of phytoplankton. New Phytol. 1987, 106, 1–34. [Google Scholar] [CrossRef]
  63. Xiu, P.; Chai, F. Spatial and temporal variability in phytoplankton carbon, chlorophyll, and nitrogen in the North Pacific. J. Geophys. Res. Ocean. 2012, 117, C11023. [Google Scholar] [CrossRef]
  64. Banting, G.S.; Glerum, D.M. Mutational analysis of the Saccharomyces cerevisiae cytochrome c oxidase assembly protein Cox11p. Eukaryot. Cell 2006, 5, 568–578. [Google Scholar] [CrossRef] [Green Version]
  65. Khalimonchuk, O.; Ostermann, K.; Rodel, G. Evidence for the association of yeast mitochondrial ribosomes with Cox11p, a protein required for the Cu-B site formation of cytochrome c oxidase. Curr. Genet. 2005, 47, 223–233. [Google Scholar] [CrossRef] [PubMed]
  66. Chojnacka, M.; Gornicka, A.; Oeljeklaus, S.; Warscheid, B.; Chacinska, A. Cox17 Protein Is an Auxiliary Factor Involved in the Control of the Mitochondrial Contact Site and Cristae Organizing System. J. Biol. Chem. 2015, 290, 15304–15312. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  67. Horng, Y.C.; Cobine, P.A.; Maxfield, A.B.; Carr, H.S.; Winge, D.R. Specific copper transfer from the Cox17 metallochaperone to both Sco1 and Cox11 in the assembly of yeast cytochrome c oxidase. J. Biol. Chem. 2004, 279, 35334–35340. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  68. Silva-Bailao, M.G.; da Silva, K.L.P.; dos Anjos, L.R.B.; Lima, P.D.; Teixeira, M.D.; Soares, C.M.D.; Bailao, A.M. Mechanisms of copper and zinc homeostasis in pathogenic black fungi. Fungal Biol. 2018, 122, 526–537. [Google Scholar] [CrossRef]
  69. Guerra-García, J.M.; García-Gómez, J.C. Assessing pollution levels in sediments of a harbour with two opposing entrances: Environmental implications. J. Environ. Manag. 2005, 77, 1–11. [Google Scholar] [CrossRef] [PubMed]
  70. Hong-Hermesdorf, A.; Miethke, M.; Gallaher, S.D.; Kropat, J.; Dodani, S.C.; Chan, J.; Barupala, D.; Domaille, D.W.; Shirasaki, D.I.; Loo, J.A.; et al. Subcellular metal imaging identifies dynamic sites of Cu accumulation in Chlamydomonas. Nat. Chem. Biol. 2014, 10, 1034–1042. [Google Scholar] [CrossRef] [Green Version]
  71. Castruita, M.; Casero, D.; Karpowicz, S.J.; Kropat, J.; Vieler, A.; Hsieh, S.I.; Yan, W.; Cokus, S.; Loo, J.A.; Benning, C. Systems biology approach in Chlamydomonas reveals connections between copper nutrition and multiple metabolic steps. Plant Cell 2011, 23, 1273. [Google Scholar] [CrossRef] [Green Version]
Jmse 09 00816 g001 550
Figure 1. Growth rate of diatom T. pseudonana under different temperature and copper concentration at light:dark cycles of 12:12 under 90 μmol photons m−2 s−1 growth light. Data are mean ± standard deviation (n = 3). Different letters at the top of each bar indicate significant differences between different Cu concentration treatments and * indicate significant differences between different temperatures (p < 0.05).
Figure 1. Growth rate of diatom T. pseudonana under different temperature and copper concentration at light:dark cycles of 12:12 under 90 μmol photons m−2 s−1 growth light. Data are mean ± standard deviation (n = 3). Different letters at the top of each bar indicate significant differences between different Cu concentration treatments and * indicate significant differences between different temperatures (p < 0.05).
Jmse 09 00816 g001
Jmse 09 00816 g002 550
Figure 2. Pigment content (chlorophyll a, Chlc and Caro) (A) and chlorophyll fluorescence parameters (Fv/FM, yield and NPQ) (B) of T. pseudonana after culture for three days in five different copper concentrations, at temperatures of 20 °C and 25 °C. Data are mean ± standard deviation (n = 3) Different letters at the top of each bar indicate significant differences between different Cu concentration treatments and * indicates significant differences between different temperatures (p < 0.05).
Figure 2. Pigment content (chlorophyll a, Chlc and Caro) (A) and chlorophyll fluorescence parameters (Fv/FM, yield and NPQ) (B) of T. pseudonana after culture for three days in five different copper concentrations, at temperatures of 20 °C and 25 °C. Data are mean ± standard deviation (n = 3) Different letters at the top of each bar indicate significant differences between different Cu concentration treatments and * indicates significant differences between different temperatures (p < 0.05).
Jmse 09 00816 g002
Jmse 09 00816 g003 550
Figure 3. Intracellular Cu content of T. pseudonana cell after being cultured for three days in five different copper concentrations at temperatures of 20 °C and 25 °C, Data are mean ± standard deviation (n = 3). Different letters at the top of each bar indicate significant differences between different Cu concentration treatments and * indicates significant differences between different temperatures (p < 0.05).
Figure 3. Intracellular Cu content of T. pseudonana cell after being cultured for three days in five different copper concentrations at temperatures of 20 °C and 25 °C, Data are mean ± standard deviation (n = 3). Different letters at the top of each bar indicate significant differences between different Cu concentration treatments and * indicates significant differences between different temperatures (p < 0.05).
Jmse 09 00816 g003
Jmse 09 00816 g004 550
Figure 4. The POC:PON, POC:POP, PON:POP and BSi:POP ratios (A–D) in T. pseudonana after being cultured for four days in five different copper concentrations at 20 °C and 25 °C. Data are mean ± standard deviation (n = 3). Different letters at the top of each bar indicate significant differences between different Cu concentration treatments and * indicates significant differences between different temperatures (p < 0.05).
Figure 4. The POC:PON, POC:POP, PON:POP and BSi:POP ratios (A–D) in T. pseudonana after being cultured for four days in five different copper concentrations at 20 °C and 25 °C. Data are mean ± standard deviation (n = 3). Different letters at the top of each bar indicate significant differences between different Cu concentration treatments and * indicates significant differences between different temperatures (p < 0.05).
Jmse 09 00816 g004
Jmse 09 00816 g005 550
Figure 5. The response of POC:Chla ratio to five different copper concentrations at 20 °C and 25 °C, Data are mean ± standard deviation (n = 3). Different letters at the top of each bar indicate significant differences between different Cu concentration treatments and * indicates significant differences between different temperatures (p < 0.05).
Figure 5. The response of POC:Chla ratio to five different copper concentrations at 20 °C and 25 °C, Data are mean ± standard deviation (n = 3). Different letters at the top of each bar indicate significant differences between different Cu concentration treatments and * indicates significant differences between different temperatures (p < 0.05).
Jmse 09 00816 g005
Jmse 09 00816 g006 550
Figure 6. Relative mRNA expression of genes upon combined effect of copper exposure and temperature treatment with the control (mean + SD, n = 3, Note: n = 1 for sample at 160 nM Cu under 25 °C). (A) Cu transporters (CTR_24257, CTR_9391), Cu-transporting P-type ATPase (CTP_263051, CTP_264357), Cu chaperone (COX11_37139, COX17_264096, SCO1_30986, COPⅠ_23273); (B) ZIP transporters (ZIP_11826, ZIP_22351, ZIP_263800, ZIP_268980, ZIP_32375), NRAMP protein (NRAMP_9840), Multi-copper oxidase (FET3_5574), Fe reductase (FRE1_11375), Fe permease (FTR1_268009), Heavy metal transporter (HAM_261657); (C) photosynthetic proteins (3HscpA_1778744, 3HscpB_1778746), silicon synthesis proteins (Sil1_52355302, Sit1_224002055). Data are mean ± standard deviation (n = 3). Different letters at the top of each bar indicate significant differences between different Cu concentration treatments and * indicates significant differences between different temperatures (p < 0.05).
Figure 6. Relative mRNA expression of genes upon combined effect of copper exposure and temperature treatment with the control (mean + SD, n = 3, Note: n = 1 for sample at 160 nM Cu under 25 °C). (A) Cu transporters (CTR_24257, CTR_9391), Cu-transporting P-type ATPase (CTP_263051, CTP_264357), Cu chaperone (COX11_37139, COX17_264096, SCO1_30986, COPⅠ_23273); (B) ZIP transporters (ZIP_11826, ZIP_22351, ZIP_263800, ZIP_268980, ZIP_32375), NRAMP protein (NRAMP_9840), Multi-copper oxidase (FET3_5574), Fe reductase (FRE1_11375), Fe permease (FTR1_268009), Heavy metal transporter (HAM_261657); (C) photosynthetic proteins (3HscpA_1778744, 3HscpB_1778746), silicon synthesis proteins (Sil1_52355302, Sit1_224002055). Data are mean ± standard deviation (n = 3). Different letters at the top of each bar indicate significant differences between different Cu concentration treatments and * indicates significant differences between different temperatures (p < 0.05).
Jmse 09 00816 g006
Table
Table 1. Genes and primers used in this study.
Table 1. Genes and primers used in this study.
Genes (Name_ID)Primer Sequence (5′to3′)Tm (°C)AnnotationReferences
CTR_24275ForwardGCATGCGTCGGCTTATTCTA58.50Cu transporter[40]
ReverseCACATGACCTGCCATCATTC56.85
CTR_9391ForwardGTCAAATGCTCTGTCCAGCA58.47Cu transporter
ReverseCGTTTGATCCATTTGGAGGT56.02
CTP_263051ForwardGTGCTGAGCAGAACAGTGAGC61.79Cu transporting p-type ATPase
ReverseGCAGATAGACAACGGCGATT58.43
CTP_264357ForwardTTGACAAGACGGGAACCATT57.35Cu transporting p-type ATPase
ReverseTTCACTGCCGAGGGTAAATC57.60
COX17_264096ForwardAAAGTGGGCATCAAATCAGG56.27Cu chaperone
ReverseCTCTTACAATCCGCGTCCTC58.16
COX11_37139ForwardAGTCGCCACCTACAATGTCC59.75Cu chaperone
ReverseACTGGCATATCCACCGTTTC57.96
ZIP_32375ForwardAACGTAGGAACAGCCCTCCT60.54ZIP transporter
ReverseATGACACCTGCCGACAAAC58.37
ZIP_268980ForwardTGGTGTGTGGTCACTTCGTT59.75ZIP transporter
ReverseGCCTCCAACAACAACTCCAT58.38
ZIP_22351ForwardCAACGCAGACGAAGAAAACA57.27ZIP transporter
ReverseGGGAACGCATACTTCGACAT58.06
ZIP_11826ForwardCATTGGTTGCAGCACTATCG57.54ZIP transporter
ReverseCGACAATCGTTTACCAAGCA56.76
ZIP_263800ForwardGCCATTGCTCAAACCGTATT57.06ZIP transporter
ReverseCTTAGCCGCAAGACCAAATC57.17
SCO1_30986ForwardTTGGTTTCGCTCGGTGTC57.96Cu chaperoneIn this study
ReverseGTTCGCAATGCAACTTTCCT57.58
COPⅠ_23273ForwardATTCGGAGTGTTGTTGCC55.58Cu chaperone
ReverseCATTGTCAGGGAGTTGTTCT55.27
FET3_5574ForwardGTCGTCGAGCAAGTTTCGTT59.15Multi-copper oxidase[39]
ReverseGGGAGCAACGTGGATAACAT57.96
FTR1_268009ForwardGCTGGCTTGTGTTTGGAATTGT60.48Fe permease
ReverseCACCTTCCTCTGCCTCGTTGA62.04
NRAMP_9840ForwardATCGCCCAAGACGACAGAGTTGA64.04NRAMP protein
ReverseCACCGCTCCTAGAATCCCAGTAATG62.75
TpActin_25772ForwardACTGGATTGGAGATGGATGG56.66Actin
ReverseCAAAGCCGTAATCTCCTTCG56.62
3HfcpA_1778744ForwardCTCCCTCCAGGTTCCTGTTG56.66Photosynthetic proteins[42]
ReverseAGCGAGCTCAAGGAATCCAA59.38
3HfcpB_1778746ForwardAGTTCGATGAGGAGACCAAGCT61.16Photosynthetic proteins
ReverseGGCACGTCCGTTGTTCAAC60.01
Sil1_52355302ForwardCCGTCACCCTCTCCTGAAAC60.04Silica shell formation
ReverseATGGGAGCAGCGGTAATGG59.85
Sit1_224002055ForwardTTGCCGAGGATGCCTAAACTT60.00Silica shell formation
ReverseTGACGAGCTACTGCAGGTTCA61.43
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Share and Cite

MDPI and ACS Style

Wang, X.; Cao, W.; Du, H.; Liu, W.; Li, P. Increasing Temperature Alters the Effects of Extracellular Copper on Thalassiosira Pseudonana Physiology and Transcription. J. Mar. Sci. Eng. 2021, 9, 816. https://doi.org/10.3390/jmse9080816

AMA Style

Wang X, Cao W, Du H, Liu W, Li P. Increasing Temperature Alters the Effects of Extracellular Copper on Thalassiosira Pseudonana Physiology and Transcription. Journal of Marine Science and Engineering. 2021; 9(8):816. https://doi.org/10.3390/jmse9080816

Chicago/Turabian Style

Wang, Xinjie, Wang Cao, Hong Du, Wenhua Liu, and Ping Li. 2021. "Increasing Temperature Alters the Effects of Extracellular Copper on Thalassiosira Pseudonana Physiology and Transcription" Journal of Marine Science and Engineering 9, no. 8: 816. https://doi.org/10.3390/jmse9080816

APA Style

Wang, X., Cao, W., Du, H., Liu, W., & Li, P. (2021). Increasing Temperature Alters the Effects of Extracellular Copper on Thalassiosira Pseudonana Physiology and Transcription. Journal of Marine Science and Engineering, 9(8), 816. https://doi.org/10.3390/jmse9080816

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop