Artificial Intelligence-Assisted Environmental DNA Metabarcoding and High-Resolution Underwater Optical Imaging for Noninvasive and Innovative Marine Environmental Monitoring
Abstract
:1. Introduction
2. High-Resolution Underwater Optical Imaging-Based Monitoring Technology as a Powerful Monitoring Tool for Marine Ecosystem
2.1. High-Resolution Underwater Optical Imaging-Based Monitoring Platform for Marine Environmental Monitoring
2.2. Artificial Intelligence (AI)-Based Data Processing Strategies to Overcome Limitations of Captured Image or Video Data
2.2.1. Single-Modal Methods
2.2.2. Multi-Modal Methods
2.3. The Promising Use of AI in Underwater Optical Imaging-Based Monitoring Application
3. eDNA Metabarcoding as the Next-Generation Biomonitoring and Biodiversity Conservation Tools: Its Noninvasive Nature and Advantages
4. Progress in Key eDNA Metabarcoding Methodologies
4.1. The Nondestructive Sampling in eDNA Metabarcoding-Based Monitoring
4.1.1. Active and Automatic Sampling
4.1.2. Passive Sampling
4.2. The Reference Database for Marine Species and the Practical Standards for eDNA Metabarcoding-Based Marine Monitoring
4.2.1. Globally Accessible Reference Databases
4.2.2. Localized References Databases
Database | Main Content | Source | Website * |
---|---|---|---|
GenBank | Nucleotide sequences for over 478,000 officially classified species | National Center for Biotechnology Information (NCBI) | https://www.ncbi.nlm.nih.gov/genbank/ |
European Molecular Biology Laboratory database (EMBL) | Data resources and analysis tools to support life science research | 29 member states | https://www.embl.org/ |
Barcode of Life Database (BOLD) | An assembly of DNA barcode data with primers, electropherograms, images and sequences.; sub-database for fish (FISH-BOL), mammals, bird species, plant species, and more. | International Barcode of Life (iBOL) Project; Canada | https://www.boldsystems.org/ |
Greengenes 2—16S rRNA database | A reference tree that unifies the genome and 16S rRNA databases in a consistent, integrated resource by inserting sequences into a genome-wide phylogenetic tree | Lawrence Berkeley National Laboratory, Berkeley, CA, USA | https://greengenes2.ucsd.edu/ |
SILVA rRNA database | Aligned small (16S/18S, SSU) and large subunit (23S/28S, LSU) ribosomal RNA (rRNA) sequences for all three domains of life (Bacteria, Archaea and Eukarya). | Free online resource from Leibniz Institute DSMZ-German Collection of Microorganisms and Cell Cultures GmbH, Braunschweig, Germany. | https://www.arb-silva.de/ |
Ribosomal Database Project (RDP) | Quality-controlled, aligned and annotated Bacterial and Archaeal 16S rRNA sequences, and Fungal 28S rRNA sequences; A series of analysis tools | United States | http://rdp.cme.msu.edu/ |
PR2-metaPR2 | Eukaryotic 18S rRNA metabarcodes that have been reprocessed and assigned using PR2 | Vaulot et al., 2022 [106] | https://app.metapr2.org/metapr2/ |
UNITE | Eukaryotic nuclear ribosomal ITS region | Northern European initiative | https://unite.ut.ee/ |
MIDORI Reference 2 | DNA and amino acid sequences used for taxonomic assignments of Eukaryota mitochondrial DNA sequences | Biodiversity Research Center, Academia Sinica, Taiwan | https://www.reference-midori.info/index.html |
MitoFish | Standardized fish mitochondrial genome | Atmosphere and Ocean Research Institute, the University of Tokyo, Japan. | https://mitofish.aori.u-tokyo.ac.jp/ |
AeDNA | Aquatic DNA barcodes and genomes; Habitat types cover rivers, lakes, seas, glaciers and hot springs. | Institute of Aquatic Biology, Chinese Academy of Sciences, Wuhan, China | http://159.226.163.221/ |
4.3. eDNA Metabarcoding-Based Monitoring from the Use of Single to Multiple Primers
5. eDNA Metabarcoding-Based Monitoring for Marine Conservation and Management
5.1. eDNA Metabarcoding for Marine Biodiversity Monitoring
5.1.1. eDNA Metabarcoding-Based Monitoring for Rare, Protected, or Threatened Marine Species
5.1.2. eDNA Metabarcoding-Based Monitoring for the Vulnerable Marine Ecosystem: Coral Reef Ecosystem
5.1.3. eDNA Metabarcoding-Based Monitoring for Deep-Sea Environment
5.2. Integrating Citizen Science with eDNA Metabarcoding: Regional/National to Global Biodiversity Monitoring
6. Machine Learning (ML)-Assisted eDNA Metabarcoding for Large-Scale Marine Biodiversity Monitoring
7. Centralized Environmental Database for Enhanced Marine Environmental Baseline and Impact Monitoring
8. The Integration of Underwater Optical Imaging-Based Monitoring and eDNA Metabarcoding-Based Monitoring for Marine Environmental Conservation
9. Future Perspectives
Author Contributions
Funding
Conflicts of Interest
References
- Visbeck, M. Ocean Science Research Is Key for a Sustainable Future. Nat. Commun. 2018, 9, 690. [Google Scholar] [CrossRef] [PubMed]
- Inniss, L.; Simcock, A.; Ajawin, A.Y.; Alcala, A.C.; Bernal, P.; Calumpong, H.P.; Araghi, P.E.; Green, S.O.; Harris, P.; Kamara, O.K. The First Global Integrated Marine Assessment; Cambridge University Press, Cambridge, UK, 2017.
- Sala, E.; Knowlton, N. Global Marine Biodiversity Trends. Annu. Rev. Environ. Resour. 2006, 31, 93–122. [Google Scholar] [CrossRef]
- Environment, U.N. Annual Report 2023|UNEP—UN Environment Programme. Available online: https://www.unep.org/resources/annual-report-2023 (accessed on 27 August 2024).
- UNESCO-IOC The United Nations Decade of Ocean Science for Sustainable Development (2021–2030): Implementation Plan—UNESCO Digital Library. Available online: https://unesdoc.unesco.org/ark:/48223/pf0000377082 (accessed on 27 August 2024).
- Unit, B. COP Decision. Available online: https://www.cbd.int/decision/cop?id=12268 (accessed on 27 August 2024).
- Yuan, S.; Li, Y.; Bao, F.; Xu, H.; Yang, Y.; Yan, Q.; Zhong, S.; Yin, H.; Xu, J.; Huang, Z.; et al. Marine Environmental Monitoring with Unmanned Vehicle Platforms: Present Applications and Future Prospects. Sci. Total Environ. 2023, 858, 159741. [Google Scholar] [CrossRef] [PubMed]
- Danovaro, R.; Carugati, L.; Berzano, M.; Cahill, A.E.; Carvalho, S.; Chenuil, A.; Corinaldesi, C.; Cristina, S.; David, R.; Dell’Anno, A. Implementing and Innovating Marine Monitoring Approaches for Assessing Marine Environmental Status. Front. Mar. Sci. 2016, 3, 213. [Google Scholar] [CrossRef]
- Andrade, H.; Massabuau, J.-C.; Cochrane, S.; Ciret, P.; Tran, D.; Sow, M.; Camus, L. High Frequency Non-Invasive (HFNI) Bio-Sensors As a Potential Tool for Marine Monitoring and Assessments. Front. Mar. Sci. 2016, 3, 187. [Google Scholar] [CrossRef]
- Beuchel, F.; Gulliksen, B.; Carroll, M.L. Long-Term Patterns of Rocky Bottom Macrobenthic Community Structure in an Arctic Fjord (Kongsfjorden, Svalbard) in Relation to Climate Variability (1980–2003). J. Mar. Syst. 2006, 63, 35–48. [Google Scholar] [CrossRef]
- Shen, Y.; Zhao, C.; Liu, Y.; Wang, S.; Huang, F. Underwater Optical Imaging: Key Technologies and Applications Review. IEEE Access 2021, 9, 85500–85514. [Google Scholar] [CrossRef]
- Stat, M.; Huggett, M.J.; Bernasconi, R.; DiBattista, J.D.; Berry, T.E.; Newman, S.J.; Harvey, E.S.; Bunce, M. Ecosystem Biomonitoring with eDNA: Metabarcoding across the Tree of Life in a Tropical Marine Environment. Sci. Rep. 2017, 7, 12240. [Google Scholar] [CrossRef] [PubMed]
- Zhang, Y.; Pavlovska, M.; Stoica, E.; Prekrasna, I.; Yang, J.; Slobodnik, J.; Zhang, X.; Dykyi, E. Holistic Pelagic Biodiversity Monitoring of the Black Sea via eDNA Metabarcoding Approach: From Bacteria to Marine Mammals. Environ. Int. 2020, 135, 105307. [Google Scholar] [CrossRef]
- Lecun, Y.; Bengio, Y.; Hinton, G. Deep Learning. Nature 2015, 521, 436–444. [Google Scholar] [CrossRef]
- Khanzode, K.C.A.; Sarode, R.D. Advantages and Disadvantages of Artificial Intelligence and Machine Learning: A Literature Review. Int. J. Libr. Inf. Sci. (IJLIS) 2020, 9, 3. [Google Scholar]
- Cordier, T.; Esling, P.; Lejzerowicz, F.; Visco, J.; Ouadahi, A.; Martins, C.; Cedhagen, T.; Pawlowski, J. Predicting the Ecological Quality Status of Marine Environments from eDNA Metabarcoding Data Using Supervised Machine Learning. Environ. Sci. Technol. 2017, 51, 9118–9126. [Google Scholar] [CrossRef]
- Cordier, T.; Forster, D.; Dufresne, Y.; Martins, C.I.M.; Stoeck, T.; Pawlowski, J. Supervised Machine Learning Outperforms Taxonomy-based Environmental DNA Metabarcoding Applied to Biomonitoring. Mol. Ecol. Resour. 2018, 18, 1381–1391. [Google Scholar] [CrossRef] [PubMed]
- Ma, A.; Lu, X.; Gray, C.; Raybould, A.; Tamaddoni-Nezhad, A.; Woodward, G.; Bohan, D.A. Ecological Networks Reveal Resilience of Agro-Ecosystems to Changes in Farming Management. Nat. Ecol. Evol. 2019, 3, 260–264. [Google Scholar] [CrossRef] [PubMed]
- Stefanni, S.; Mirimin, L.; Stanković, D.; Chatzievangelou, D.; Bongiorni, L.; Marini, S.; Modica, M.V.; Manea, E.; Bonofiglio, F.; del Rio Fernandez, J.; et al. Framing Cutting-Edge Integrative Deep-Sea Biodiversity Monitoring via Environmental DNA and Optoacoustic Augmented Infrastructures. Front. Mar. Sci. 2022, 8, 797140. [Google Scholar] [CrossRef]
- Duan, Z.; Yuan, Y.; Lu, J.C.; Wang, J.L.; Li, Y.; Svanberg, S.; Zhao, G.Y. Underwater Spatially, Spectrally, and Temporally Resolved Optical Monitoring of Aquatic Fauna. Opt. Express 2020, 28, 2600–2610. [Google Scholar] [CrossRef]
- Zhang, L.; Li, C.; Sun, H. Object Detection/Tracking toward Underwater Photographs by Remotely Operated Vehicles (ROVs). Future Gener. Comput. Syst. 2022, 126, 163–168. [Google Scholar] [CrossRef]
- Tang, J.; Chen, Z.; Fu, B.; Lu, W.; Li, S.; Li, X.; Ji, X. ROV6D: 6D Pose Estimation Benchmark Dataset for Underwater Remotely Operated Vehicles. IEEE Robot. Autom. Lett. 2024, 9, 65–72. [Google Scholar] [CrossRef]
- Ma, Y.; Wu, Y.; Li, Q.; Zhou, Y.; Yu, D. ROV-Based Binocular Vision System for Underwater Structure Crack Detection and Width Measurement. Multimed. Tools Appl. 2023, 82, 20899–20923. [Google Scholar] [CrossRef]
- Borković, G.; Fabijanić, M.; Magdalenić, M.; Malobabić, A.; Vuković, J.; Zieliński, I.; Kapetanović, N.; Kvasić, I.; Babić, A.; Mišković, N. Underwater ROV Software for Fish Cage Inspection. In Proceedings of the 2021 44th International Convention on Information, Communication and Electronic Technology (MIPRO), Opatija, Croatia, 27 September–1 October 2021; pp. 1747–1752. [Google Scholar]
- Lakshmi, K.; Muralikrishna, P.; Soman, K.P. Compressive Estimation of UWA Channels for OFDM Transmission Using Iterative Sparse Reconstruction Algorithms. In Proceedings of the 2013 International Mutli-Conference on Automation, Computing, Communication, Control and Compressed Sensing (iMac4s), Kottayam, India,, 22–23 March 2013; pp. 847–851. [Google Scholar]
- Han, J.; Zhang, L.; Leus, G. Partial FFT Demodulation for MIMO-OFDM over Time-Varying Underwater Acoustic Channels. IEEE Signal Process. Lett. 2015, 23, 282–286. [Google Scholar] [CrossRef]
- Lu, H.; Li, Y.; Zhang, Y.; Chen, M.; Serikawa, S.; Kim, H. Underwater Optical Image Processing: A Comprehensive Review. Mob. Netw. Appl. 2017, 22, 1204–1211. [Google Scholar] [CrossRef]
- Kindsvater, H.K.; Dulvy, N.K.; Horswill, C.; Juan-Jordá, M.-J.; Mangel, M.; Matthiopoulos, J. Overcoming the Data Crisis in Biodiversity Conservation. Trends Ecol. Evol. 2018, 33, 676–688. [Google Scholar] [CrossRef] [PubMed]
- Farley, S.S.; Dawson, A.; Goring, S.J.; Williams, J.W. Situating Ecology as a Big-Data Science: Current Advances, Challenges, and Solutions. BioScience 2018, 68, 563–576. [Google Scholar] [CrossRef]
- Ahn, J.; Yasukawa, S.; Sonoda, T.; Nishida, Y.; Ishii, K.; Ura, T. An Optical Image Transmission System for Deep Sea Creature Sampling Missions Using Autonomous Underwater Vehicle. IEEE J. Ocean. Eng. 2018, 45, 350–361. [Google Scholar] [CrossRef]
- Dinakaran, R.; Zhang, L.; Li, C.-T.; Bouridane, A.; Jiang, R. Robust and Fair Undersea Target Detection with Automated Underwater Vehicles for Biodiversity Data Collection. Remote Sens. 2022, 14, 3680. [Google Scholar] [CrossRef]
- Rosli, M.S.A.B.; Isa, I.S.; Maruzuki, M.I.F.; Sulaiman, S.N.; Ahmad, I. Underwater Animal Detection Using YOLOV4. In Proceedings of the 2021 11th IEEE International Conference on Control System, Computing and Engineering (ICCSCE), Penang, Malaysia, 27–28 August 2021; pp. 158–163. [Google Scholar]
- Coro, G.; Walsh, M.B. An Intelligent and Cost-Effective Remote Underwater Video Device for Fish Size Monitoring. Ecol. Inform. 2021, 63, 101311. [Google Scholar] [CrossRef]
- Zhang, K.; Yang, M.; Lang, S.D.J.; McInnes, A.M.; Sherley, R.B.; Burghardt, T. Diving with Penguins: Detecting Penguins and Their Prey in Animal-Borne Underwater Videos via Deep Learning. arXiv 2023, arXiv:2308.07267. [Google Scholar]
- Cai, L.; McGuire, N.E.; Hanlon, R.; Mooney, T.A.; Girdhar, Y. Semi-Supervised Visual Tracking of Marine Animals Using Autonomous Underwater Vehicles. Int. J. Comput. Vis. 2023, 131, 1406–1427. [Google Scholar] [CrossRef]
- Bosch, J.; Gracias, N.; Ridao, P.; Ribas, D. Omnidirectional Underwater Camera Design and Calibration. Sensors 2015, 15, 6033–6065. [Google Scholar] [CrossRef]
- Li, C.; Guo, C.; Ren, W.; Cong, R.; Hou, J.; Kwong, S.; Tao, D. An Underwater Image Enhancement Benchmark Dataset and Beyond. IEEE Trans. Image Process. 2020, 29, 4376–4389. [Google Scholar] [CrossRef]
- Han, M.; Lyu, Z.; Qiu, T.; Xu, M. A Review on Intelligence Dehazing and Color Restoration for Underwater Images. IEEE Trans. Syst. Man Cybern. Syst. 2018, 50, 1820–1832. [Google Scholar] [CrossRef]
- López-Vázquez, J.; Pérez-Mayán, L.; Fernández-Fernández, V.; Cela, R.; Rodríguez, I. Direct, Automated and Sensitive Determination of Glyphosate and Related Anionic Pesticides in Environmental Water Samples Using Solid-Phase Extraction on-Line Combined with Liquid Chromatography Tandem Mass Spectrometry. J. Chromatogr. A 2023, 1687, 463697. [Google Scholar] [CrossRef] [PubMed]
- He, K.; Sun, J.; Tang, X. Single Image Haze Removal Using Dark Channel Prior. IEEE Trans. Pattern Anal. Mach. Intell. 2010, 33, 2341–2353. [Google Scholar] [PubMed]
- Chen, Z.; Liu, C.; Zhang, K.; Chen, Y.; Wang, R.; Shi, X. Underwater-Image Super-Resolution via Range-Dependency Learning of Multiscale Features. Comput. Electr. Eng. 2023, 110, 108756. [Google Scholar] [CrossRef]
- Yang, Y.; Wang, C.; Liu, R.; Zhang, L.; Guo, X.; Tao, D. Self-Augmented Unpaired Image Dehazing via Density and Depth Decomposition. In Proceedings of the IEEE/CVF Conference on Computer Vision and Pattern Recognition, New Orleans, LA, USA, 18–24 June 2022; pp. 2037–2046. [Google Scholar]
- Kaiyan, Z.; Xiang, L.; Weibo, S. Underwater Object Detection Using Transfer Learning with Deep Learning. In Proceedings of the 2020 International Conference on Computers, Information Processing and Advanced Education, Ottawa, ON, Canada, 16–18 October 2020; Association for Computing Machinery: New York, NY, USA, 2020; pp. 157–160. [Google Scholar]
- Yang, H.; Tian, F.; Qi, Q.; Wu, Q.M.J.; Li, K. Underwater Image Enhancement with Latent Consistency Learning-Based Color Transfer. IET Image Process. 2022, 16, 1594–1612. [Google Scholar] [CrossRef]
- Kim, G.; Park, J.; Kwon, J. Deep Dehazing Powered by Image Processing Network. In Proceedings of the IEEE/CVF Conference on Computer Vision and Pattern Recognition, Vancouver, BC, Canada, 18–22 June 2023; pp. 1209–1218. [Google Scholar]
- Guo, A.; Dian, R.; Li, S. A Deep Framework for Hyperspectral Image Fusion between Different Satellites. IEEE Trans. Pattern Anal. Mach. Intell. 2022, 45, 7939–7954. [Google Scholar] [CrossRef]
- Kim, J. U-Gat-It: Unsupervised Generative Attentional Networks with Adaptive Layer-Instance Normalization for Image-to-Image Translation. arXiv 2019, arXiv:1907.10830. [Google Scholar]
- Ma, H.; Wang, Y.; Li, Y.; Zhao, Y. Desert Seismic Low-Frequency Noise Attenuation Using Low-Rank Decomposition-Based Denoising Convolutional Neural Network. IEEE Trans. Geosci. Remote Sens. 2022, 60, 5900809. [Google Scholar] [CrossRef]
- Chen, R.; Fu, Z.; Huang, Y.; Cheng, E.; Ding, X. A Robust Object Segmentation Network for Underwater Scenes. In Proceedings of the ICASSP 2022-2022 IEEE International Conference on Acoustics, Speech and Signal Processing (ICASSP), Virtual, 7–13 May 2022; Singapore, 22–27 May 2022. pp. 2629–2633. [Google Scholar]
- Yeh, C.-H.; Lin, C.-H.; Kang, L.-W.; Huang, C.-H.; Lin, M.-H.; Chang, C.-Y.; Wang, C.-C. Lightweight Deep Neural Network for Joint Learning of Underwater Object Detection and Color Conversion. IEEE Trans. Neural Netw. Learn. Syst. 2022, 33, 6129–6143. [Google Scholar] [CrossRef] [PubMed]
- Liu, R.; Fan, X.; Zhu, M.; Hou, M.; Luo, Z. Real-World Underwater Enhancement: Challenges, Benchmarks, and Solutions Under Natural Light. IEEE Trans. Circuits Syst. Video Technol. 2020, 30, 4861–4875. [Google Scholar] [CrossRef]
- Thapa, S.; Li, N.; Ye, J. Learning To Remove Refractive Distortions From Underwater Images. In Proceedings of the IEEE/CVF International Conference on Computer Vision 2021, Virtual, 11–17 October 2021; pp. 5007–5016. [Google Scholar]
- Iakushkin, O.; Pavlova, E.; Pen, E.; Frikh-Khar, A.; Terekhina, Y.; Bulanova, A.; Shabalin, N.; Sedova, O. Automated Marking of Underwater Animals Using a Cascade of Neural Networks. In Proceedings of the Computational Science and Its Applications—ICCSA 2021, Cagliari, Italy, 13–16 September 2021; Gervasi, O., Murgante, B., Misra, S., Garau, C., Blečić, I., Taniar, D., Apduhan, B.O., Rocha, A.M.A.C., Tarantino, E., Torre, C.M., Eds.; Lecture Notes in Computer Science. Springer International Publishing: Cham, Switzerland, 2021; Volume 12956, pp. 460–470, ISBN 978-3-030-87009-6. [Google Scholar]
- Jiang, J.; Ye, T.; Bai, J.; Chen, S.; Chai, W.; Jun, S.; Liu, Y.; Chen, E. Five A+ Network: You Only Need 9K Parameters for Underwater Image Enhancement. arXiv 2023, arXiv:2305.08824. [Google Scholar]
- Zhao, C.; Cai, W.; Dong, C.; Zeng, Z. Toward Sufficient Spatial-Frequency Interaction for Gradient-Aware Underwater Image Enhancement. In Proceedings of the ICASSP 2024—2024 IEEE International Conference on Acoustics, Speech and Signal Processing (ICASSP), Seoul, Republic of Korea, 14–19 April 2024; pp. 3220–3224. [Google Scholar]
- Qi, H.; Dong, X. Physics-Aware Semi-Supervised Underwater Image Enhancement. arXiv 2024, arXiv:2307.11470. [Google Scholar]
- De Langis, K.; Sattar, J. Realtime Multi-Diver Tracking and Re-Identification for Underwater Human-Robot Collaboration. In Proceedings of the 2020 IEEE International Conference on Robotics and Automation (ICRA), Paris, France, 31 May–31 August 2020; pp. 11140–11146. [Google Scholar]
- Le, M.-Q.; Le, T.-N.; Nguyen, T.; Echizen, I.; Tran, M.-T. Multimodal-Based Scene-Aware Framework for Aquatic Animal Segmentation. arXiv 2021, arXiv:2112.06193. [Google Scholar] [CrossRef]
- Liu, H.; Song, P.; Ding, R. Towards Domain Generalization In Underwater Object Detection. In Proceedings of the 2020 IEEE International Conference on Image Processing (ICIP), Virtual, 25–28 October 2020; pp. 1971–1975. [Google Scholar]
- Jiang, L.; Quan, H.; Xie, T.; Qian, J. Fish Recognition in Complex Underwater Scenes Based on Targeted Sample Transfer Learning. Multimed. Tools Appl. 2022, 81, 25303–25317. [Google Scholar] [CrossRef]
- Pietramellara, G.; Ascher, J.; Borgogni, F.; Ceccherini, M.T.; Guerri, G.; Nannipieri, P. Extracellular DNA in Soil and Sediment: Fate and Ecological Relevance. Biol. Fertil. Soils 2009, 45, 219–235. [Google Scholar] [CrossRef]
- Ficetola, G.F.; Miaud, C.; Pompanon, F.; Taberlet, P. Species Detection Using Environmental DNA from Water Samples. Biol. Lett. 2008, 4, 423–425. [Google Scholar] [CrossRef] [PubMed]
- Aylagas, E.; Borja, Á.; Irigoien, X.; Rodríguez-Ezpeleta, N. Benchmarking DNA Metabarcoding for Biodiversity-Based Monitoring and Assessment. Front. Mar. Sci. 2016, 3, 96. [Google Scholar] [CrossRef]
- Cote, D.; McClenaghan, B.; Desforges, J.; Fahner, N.A.; Hajibabaei, M.; Chawarski, J.; Roul, S.; Singer, G.; Aubry, C.; Geoffroy, M. Comparing eDNA Metabarcoding and Conventional Pelagic Netting to Inform Biodiversity Monitoring in Deep Ocean Environments. ICES J. Mar. Sci. 2023, 80, 2545–2562. [Google Scholar] [CrossRef]
- Balint, M.; Pfenninger, M.; Grossart, H.-P.; Taberlet, P.; Vellend, M.; Leibold, M.A.; Englund, G.; Bowler, D. Environmental DNA Time Series in Ecology. Trends Ecol. Evol. 2018, 33, 945–957. [Google Scholar] [CrossRef] [PubMed]
- Zhao, Y.; Chen, J.; Dong, L.; Ma, X.; Bai, J.; Tian, K. Advances in the Application of Environmental DNA in Aquatic Ecosystems. J. Agro- Environ. Sci. 2021, 40, 2057–2065. [Google Scholar] [CrossRef]
- Littlefair, J.E.; Rennie, M.D.; Cristescu, M.E. Environmental Nucleic Acids: A Field-Based Comparison for Monitoring Freshwater Habitats Using eDNA and eRNA. Mol. Ecol. Resour. 2022, 22, 2928–2940. [Google Scholar] [CrossRef] [PubMed]
- Foote, A.D.; Thomsen, P.F.; Sveegaard, S.; Wahlberg, M.; Kielgast, J.; Kyhn, L.A.; Salling, A.B.; Galatius, A.; Orlando, L.; Gilbert, M.T.P. Investigating the Potential Use of Environmental DNA (eDNA) for Genetic Monitoring of Marine Mammals. PLoS ONE. 2012, 7, e41781. [Google Scholar] [CrossRef]
- Deiner, K.; Bik, H.M.; Mächler, E.; Seymour, M.; Lacoursière-Roussel, A.; Altermatt, F.; Creer, S.; Bista, I.; Lodge, D.M.; De Vere, N.; et al. Environmental DNA Metabarcoding: Transforming How We Survey Animal and Plant Communities. Mol. Ecol. 2017, 26, 5872–5895. [Google Scholar] [CrossRef]
- West, K.M.; Adam, A.A.S.; White, N.; Robbins, W.D.; Barrow, D.; Lane, A.T.; Richards, Z. The Applicability of eDNA Metabarcoding Approaches for Sessile Benthic Surveying in the Kimberley Region, North-Western Australia. Environ. DNA 2022, 4, 34–49. [Google Scholar] [CrossRef]
- Rivera, S.F.; Rimet, F.; Vasselon, V.; Vautier, M.; Domaizon, I.; Bouchez, A. Fish eDNA Metabarcoding from Aquatic Biofilm Samples: Methodological Aspects. Mol. Ecol. Resour. 2022, 22, 1440–1453. [Google Scholar] [CrossRef] [PubMed]
- Clarke, L.J.; Suter, L.; Deagle, B.E.; Polanowski, A.M.; Terauds, A.; Johnstone, G.J.; Stark, J.S. Environmental DNA Metabarcoding for Monitoring Metazoan Biodiversity in Antarctic Nearshore Ecosystems. PeerJ 2021, 9, e12458. [Google Scholar] [CrossRef]
- Gelis, E.R.E.; Kamal, M.M.; Subhan, B.; Bachtiar, I.; Sani, L.M.I.; Madduppa, H. Environmental Biomonitoring of Reef Fish Community Structure with eDNA Metabarcoding in the Coral Triangle. Environ. Biol. Fish. 2021, 104, 887–903. [Google Scholar] [CrossRef]
- Tagliabue, A.; Matterson, K.O.; Ponti, M.; Turicchia, E.; Abbiati, M.; Costantini, F. Sediment and Bottom Water eDNA Metabarcoding to Support Coastal Management. Ocean Coast. Manag. 2023, 244, 106785. [Google Scholar] [CrossRef]
- Pawlowski, J.; Apothéloz-Perret-Gentil, L.; Mächler, E.; Altermatt, F. Environmental DNA Applications in Biomonitoring and Bioassessment of Aquatic Ecosystems: Guidelines; Federal Office for the Environment: Bern, Switzerland, 2020; 71p, (Environmental Studies. no. 2010). [Google Scholar] [CrossRef]
- Thomsen, P.F.; Kielgast, J.; Iversen, L.L.; Møller, P.R.; Rasmussen, M.; Willerslev, E. Detection of a Diverse Marine Fish Fauna Using Environmental DNA from Seawater Samples. PLoS ONE 2012, 7, e41732. [Google Scholar] [CrossRef]
- Nichols, P.K.; Marko, P.B. Rapid Assessment of Coral Cover from Environmental DNA in Hawai’i. Environ. DNA 2019, 1, 40–53. [Google Scholar] [CrossRef]
- Truelove, N.K.; Patin, N.V.; Min, M.; Pitz, K.J.; Preston, C.M.; Yamahara, K.M.; Zhang, Y.; Raanan, B.Y.; Kieft, B.; Hobson, B.; et al. Expanding the Temporal and Spatial Scales of Environmental DNA Research with Autonomous Sampling. Environ. DNA 2022, 4, 972–984. [Google Scholar] [CrossRef]
- Andres, K.J.; Lambert, T.D.; Lodge, D.M.; Andrés, J.; Jackson, J.R. Combining Sampling Gear to Optimally Inventory Species Highlights the Efficiency of eDNA Metabarcoding. Environ. DNA 2023, 5, 146–157. [Google Scholar] [CrossRef]
- von Ammon, U.; Pochon, X.; Casanovas, P.; Trochel, B.; Zirngibl, M.; Thomas, A.; Witting, J.; Joyce, P.; Zaiko, A. Net Overboard: Comparing Marine eDNA Sampling Methodologies at Sea to Unravel Marine Biodiversity. Mol. Ecol. Resour. 2023, 23, 440–452. [Google Scholar] [CrossRef]
- Thomsen, P.F.; Møller, P.R.; Sigsgaard, E.E.; Knudsen, S.W.; Jørgensen, O.A.; Willerslev, E. Environmental DNA from Seawater Samples Correlate with Trawl Catches of Subarctic, Deepwater Fishes. PLoS ONE 2016, 11, e0165252. [Google Scholar] [CrossRef]
- McClenaghan, B.; Fahner, N.; Cote, D.; Chawarski, J.; McCarthy, A.; Rajabi, H.; Singer, G.; Hajibabaei, M. Harnessing the Power of eDNA Metabarcoding for the Detection of Deep-Sea Fishes. PLoS ONE 2020, 15, e0236540. [Google Scholar] [CrossRef]
- Pawlowski, J.; Bruce, K.; Panksep, K.; Aguirre, F.I.; Amalfitano, S.; Apothéloz-Perret-Gentil, L.; Baussant, T.; Bouchez, A.; Carugati, L.; Cermakova, K.; et al. Environmental DNA Metabarcoding for Benthic Monitoring: A Review of Sediment Sampling and DNA Extraction Methods. Sci. Total Environ. 2022, 818, 151783. [Google Scholar] [CrossRef]
- Geraldi, N.R.; Krause-Jensen, D.; Ørberg, S.B.; Frühe, L.; Sejr, M.K.; Hansen, J.L.S.; Lund-Hansen, L.; Duarte, C.M. Environmental Drivers of Arctic Communities Based on Metabarcoding of Marine Sediment eDNA. Proc. R. Soc. B 2024, 291, 20231614. [Google Scholar] [CrossRef] [PubMed]
- Laramie, M.B.; Pilliod, D.S.; Goldberg, C.S. Characterizing the Distribution of an Endangered Salmonid Using Environmental DNA Analysis. Biol. Conserv. 2015, 183, 29–37. [Google Scholar] [CrossRef]
- Bruce, K.; Blackman, R.C.; Bourlat, S.J.; Hellström, M.; Bakker, J.; Bista, I.; Bohmann, K.; Bouchez, A.; Brys, R.; Clark, K.; et al. A Practical Guide to DNA-Based Methods for Biodiversity Assessment; Pensoft Advanced Books. 2021. Available online: https://ab.pensoft.net/article/68634/ (accessed on 27 August 2024).
- Goldberg, C.S.; Strickler, K.M.; Fremier, A.K. Degradation and Dispersion Limit Environmental DNA Detection of Rare Amphibians in Wetlands: Increasing Efficacy of Sampling Designs. Sci. Total Environ. 2018, 633, 695–703. [Google Scholar] [CrossRef]
- Thomas, A.C.; Howard, J.; Nguyen, P.L.; Seimon, T.A.; Goldberg, C.S. eDNA Sampler: A Fully Integrated Environmental DNA Sampling System. Methods Ecol. Evol. 2018, 9, 1379–1385. [Google Scholar] [CrossRef]
- Doi, H.; Akamatsu, Y.; Watanabe, Y.; Goto, M.; Inui, R.; Katano, I.; Nagano, M.; Takahara, T.; Minamoto, T. Water Sampling for Environmental DNA Surveys by Using an Unmanned Aerial Vehicle. Limnol. Ocean Methods 2017, 15, 939–944. [Google Scholar] [CrossRef]
- Nishitsuji, K.; Nagahama, S.; Narisoko, H.; Shimada, K.; Okada, N.; Shimizu, Y.; Satoh, N. Possible Monitoring of Mesophotic Scleractinian Corals Using an Underwater Mini-ROV to Sample Coral eDNA. R. Soc. Open Sci. 2024, 11, 221586. [Google Scholar] [CrossRef] [PubMed]
- Yamahara, K.M.; Preston, C.M.; Birch, J.; Walz, K.; Marin, R.; Jensen, S.; Pargett, D.; Roman, B.; Ussler, W.; Zhang, Y.; et al. In Situ Autonomous Acquisition and Preservation of Marine Environmental DNA Using an Autonomous Underwater Vehicle. Front. Mar. Sci. 2019, 6, 373. [Google Scholar] [CrossRef]
- Preston, C.; Yamahara, K.; Pargett, D.; Weinstock, C.; Birch, J.; Roman, B.; Jensen, S.; Connon, B.; Jenkins, R.; Ryan, J.; et al. Autonomous eDNA Collection Using an Uncrewed Surface Vessel over a 4200-Km Transect of the Eastern Pacific Ocean. Environ. DNA 2024, 6, e468. [Google Scholar] [CrossRef]
- Formel, N.; Enochs, I.C.; Sinigalliano, C.; Anderson, S.R.; Thompson, L.R. Subsurface Automated Samplers for eDNA (SASe) for Biological Monitoring and Research. HardwareX 2021, 10, e00239. [Google Scholar] [CrossRef]
- Govindarajan, A.F.; McCartin, L.; Adams, A.; Allan, E.; Belani, A.; Francolini, R.; Fujii, J.; Gomez-Ibañez, D.; Kukulya, A.; Marin, F. Improved Biodiversity Detection Using a Large-Volume Environmental DNA Sampler with In Situ Filtration and Implications for Marine eDNA Sampling Strategies. Deep Sea Res. Part I Oceanogr. Res. Pap. 2022, 189, 103871. [Google Scholar] [CrossRef]
- Hendricks, A.; Mackie, C.M.; Luy, E.; Sonnichsen, C.; Smith, J.; Grundke, I.; Tavasoli, M.; Furlong, A.; Beiko, R.G.; LaRoche, J. Compact and Automated eDNA Sampler for In Situ Monitoring of Marine Environments. Sci. Rep. 2023, 13, 5210. [Google Scholar] [CrossRef]
- Bessey, C.; Neil Jarman, S.; Simpson, T.; Miller, H.; Stewart, T.; Kenneth Keesing, J.; Berry, O. Passive eDNA Collection Enhances Aquatic Biodiversity Analysis. Commun. Biol. 2021, 4, 236. [Google Scholar] [CrossRef]
- van der Heyde, M.; Alexander, J.; Nevill, P.; Austin, A.D.; Stevens, N.; Jones, M.; Guzik, M.T. Rapid Detection of Subterranean Fauna from Passive Sampling of Groundwater eDNA. Environ. DNA 2023, 5, 1706–1719. [Google Scholar] [CrossRef]
- Chen, X.; Kong, Y.; Zhang, S.; Zhao, J.; Li, S.; Yao, M. Comparative Evaluation of Common Materials as Passive Samplers of Environmental DNA. Environ. Sci. Technol. 2022, 56, 10798–10807. [Google Scholar] [CrossRef]
- Miya, M. Environmental DNA Metabarcoding: A Novel Method for Biodiversity Monitoring of Marine Fish Communities. Annu. Rev. Mar. Sci. 2022, 14, 161–185. [Google Scholar] [CrossRef] [PubMed]
- Nelson, J.S.; Grande, T.C.; Wilson, M.V.H. Fishes of the World; John Wiley & Sons: Hoboken, NJ, USA, 2016; ISBN 978-1-119-22082-4. [Google Scholar]
- Shanlin, L. DNA Barcoding and Emerging Reference Construction and Data Analysis Technologies. Biodivers. Sci. 2019, 27, 526. [Google Scholar] [CrossRef]
- Kasmi, Y.; Eschbach, E.; Hanel, R. Mare-MAGE Curated Reference Database of Fish Mitochondrial Genes. BMC Genom. Data 2023, 24, 18. [Google Scholar] [CrossRef] [PubMed]
- Gold, Z.; Curd, E.E.; Goodwin, K.D.; Choi, E.S.; Frable, B.W.; Thompson, A.R.; Walker, H.J.; Burton, R.S.; Kacev, D.; Martz, L.D.; et al. Improving Metabarcoding Taxonomic Assignment: A Case Study of Fishes in a Large Marine Ecosystem. Mol. Ecol. Resour. 2021, 21, 2546–2564. [Google Scholar] [CrossRef]
- Chen, Z.; Cai, X.; Zhang, Q.; Li, G.; Ma, C.; Shen, Z. Preliminary Construction and Comparative Analysis of Environmental DNA Metabarcoding Reference Database of Freshwater Fishes in Hainan Island. South China Fish. Sci. 2022, 18, 1–12. [Google Scholar] [CrossRef]
- Jiang, P.; Li, M.; Zhang, S.; Chen, Z.; Xu, S. Construction of DNA meta-barcode database of fish in Pearl River Estuary based on mitochondrial cytochrome COI and 12S rDNA gene. South China Fish. Sci. 2022, 18, 13–21. [Google Scholar] [CrossRef]
- Vaulot, D.; Sim, C.W.H.; Ong, D.; Teo, B.; Biwer, C.; Jamy, M.; Lopes dos Santos, A. metaPR: A Database of Eukaryotic 18S rRNA Metabarcodes with an Emphasis on Protists. Mol. Ecol. Resour. 2022, 22, 3188–3201. [Google Scholar] [CrossRef] [PubMed]
- Takahashi, M.; Saccò, M.; Kestel, J.H.; Nester, G.; Campbell, M.A.; van der Heyde, M.; Heydenrych, M.J.; Juszkiewicz, D.J.; Nevill, P.; Dawkins, K.L.; et al. Aquatic Environmental DNA: A Review of the Macro-Organismal Biomonitoring Revolution. Sci. Total Environ. 2023, 873, 162322. [Google Scholar] [CrossRef] [PubMed]
- Cannon, M.V.; Hester, J.; Shalkhauser, A.; Chan, E.R.; Logue, K.; Small, S.T.; Serre, D. In Silico Assessment of Primers for eDNA Studies Using PrimerTree and Application to Characterize the Biodiversity Surrounding the Cuyahoga River. Sci. Rep. 2016, 6, 22908. [Google Scholar] [CrossRef]
- Ardura, A.; Zaiko, A.; Martinez, J.L.; Samulioviene, A.; Semenova, A.; Garcia-Vazquez, E. eDNA and Specific Primers for Early Detection of Invasive Species–A Case Study on the Bivalve Rangia Cuneata, Currently Spreading in Europe. Mar. Environ. Res. 2015, 112, 48–55. [Google Scholar] [CrossRef] [PubMed]
- Xiong, F.; Shu, L.; Zeng, H.; Gan, X.; He, S.; Peng, Z. Methodology for Fish Biodiversity Monitoring with Environmental DNA Metabarcoding: The Primers, Databases and Bioinformatic Pipelines. Water Biol. Secur. 2022, 1, 100007. [Google Scholar] [CrossRef]
- Jo, T.; Arimoto, M.; Murakami, H.; Masuda, R.; Minamoto, T. Particle Size Distribution of Environmental DNA from the Nuclei of Marine Fish. Environ. Sci. Technol. 2019, 53, 9947–9956. [Google Scholar] [CrossRef] [PubMed]
- Wang, S.; Yan, Z.; Hänfling, B.; Zheng, X.; Wang, P.; Fan, J.; Li, J. Methodology of Fish eDNA and Its Applications in Ecology and Environment. Sci. Total Environ. 2021, 755, 142622. [Google Scholar] [CrossRef] [PubMed]
- Xing, Y.; Gao, W.; Shen, Z.; Zhang, Y.; Bai, J.; Cai, X.; Ouyang, J.; Zhao, Y. A Review of Environmental DNA Field and Laboratory Protocols Applied in Fish Ecology and Environmental Health. Front. Environ. Sci. 2022, 10, 725360. [Google Scholar] [CrossRef]
- Miya, M.; Sato, Y.; Fukunaga, T.; Sado, T.; Poulsen, J.Y.; Sato, K.; Minamoto, T.; Yamamoto, S.; Yamanaka, H.; Araki, H.; et al. MiFish, a Set of Universal PCR Primers for Metabarcoding Environmental DNA from Fishes: Detection of More than 230 Subtropical Marine Species. R. Soc. Open Sci. 2015, 2, 150088. [Google Scholar] [CrossRef] [PubMed]
- Valentini, A.; Taberlet, P.; Miaud, C.; Civade, R.; Herder, J.; Thomsen, P.F.; Bellemain, E.; Besnard, A.; Coissac, E.; Boyer, F.; et al. Next-Generation Monitoring of Aquatic Biodiversity Using Environmental DNA Metabarcoding. Mol. Ecol. 2016, 25, 929–942. [Google Scholar] [CrossRef]
- Evans, N.T.; Olds, B.P.; Renshaw, M.A.; Turner, C.R.; Li, Y.; Jerde, C.L.; Mahon, A.R.; Pfrender, M.E.; Lamberti, G.A.; Lodge, D.M. Quantification of Mesocosm Fish and Amphibian Species Diversity via Environmental DNA Metabarcoding. Mol. Ecol. Resour. 2016, 16, 29–41. [Google Scholar] [CrossRef] [PubMed]
- Zhang, S.; Zhao, J.; Yao, M. A Comprehensive and Comparative Evaluation of Primers for Metabarcoding eDNA from Fish. Methods Ecol. Evol. 2020, 11, 1609–1625. [Google Scholar] [CrossRef]
- Leray, M.; Yang, J.Y.; Meyer, C.P.; Mills, S.C.; Agudelo, N.; Ranwez, V.; Boehm, J.T.; Machida, R.J. A New Versatile Primer Set Targeting a Short Fragment of the Mitochondrial COI Region for Metabarcoding Metazoan Diversity: Application for Characterizing Coral Reef Fish Gut Contents. Front. Zool. 2013, 10, 34. [Google Scholar] [CrossRef]
- Holman, L.E.; de Bruyn, M.; Creer, S.; Carvalho, G.; Robidart, J.; Rius, M. Detection of Introduced and Resident Marine Species Using Environmental DNA Metabarcoding of Sediment and Water. Sci. Rep. 2019, 9, 11559. [Google Scholar] [CrossRef] [PubMed]
- Shi, X.; Jiang, Y.; Cao, L.; Zeng, C. Development of Environmental DNA Metabarcoding Primers for Marine Mollusks and Comparison with Published Primers. BMC Ecol. EvoL. 2024, 24, 73. [Google Scholar] [CrossRef] [PubMed]
- Liu, J.; Zhang, H. Combining Multiple Markers in Environmental DNA Metabarcoding to Assess Deep-Sea Benthic Biodiversity. Front. Mar. Sci. 2021, 8, 684955. [Google Scholar] [CrossRef]
- Shea, M.M.; Kuppermann, J.; Rogers, M.P.; Smith, D.S.; Edwards, P.; Boehm, A.B. Systematic Review of Marine Environmental DNA Metabarcoding Studies: Toward Best Practices for Data Usability and Accessibility. PeerJ 2023, 11, e14993. [Google Scholar] [CrossRef] [PubMed]
- Cristescu, M.E.; Hebert, P.D.N. Uses and Misuses of Environmental DNA in Biodiversity Science and Conservation. Annu. Rev. Ecol. Evol. Syst. 2018, 49, 209–230. [Google Scholar] [CrossRef]
- Yang, J.; Zhang, X.; Jin, X.; Seymour, M.; Richter, C.; Logares, R.; Khim, J.S.; Klymus, K. Recent Advances in Environmental DNA-Based Biodiversity Assessment and Conservation. Divers. Distrib. 2021, 27, 1876–1879. [Google Scholar] [CrossRef]
- Zeng, Y.; Chen, Z.; Cao, J.; Li, S.; Xia, Z.; Sun, Y.; Zhang, J.; He, P. Revolutionizing Early-Stage Green Tide Monitoring: eDNA Metabarcoding Insights into Ulva Prolifera and Microecology in the South Yellow Sea. Sci. Total Environ. 2024, 912, 169022. [Google Scholar] [CrossRef]
- Sigsgaard, E.E.; Torquato, F.; Frøslev, T.G.; Moore, A.B.M.; Sørensen, J.M.; Range, P.; Ben-Hamadou, R.; Bach, S.S.; Møller, P.R.; Thomsen, P.F. Using Vertebrate Environmental DNA from Seawater in Biomonitoring of Marine Habitats. Conserv. Biol. 2020, 34, 697–710. [Google Scholar] [CrossRef]
- He, X.; Jeffery, N.W.; Stanley, R.R.E.; Hamilton, L.C.; Rubidge, E.M.; Abbott, C.L. eDNA Metabarcoding Enriches Traditional Trawl Survey Data for Monitoring Biodiversity in the Marine Environment. ICES J. Mar. Sci. 2023, 80, 1529–1538. [Google Scholar] [CrossRef]
- Bakker, J.; Wangensteen, O.S.; Baillie, C.; Buddo, D.; Chapman, D.D.; Gallagher, A.J.; Guttridge, T.L.; Hertler, H.; Mariani, S. Biodiversity Assessment of Tropical Shelf Eukaryotic Communities via Pelagic eDNA Metabarcoding. Ecol. Evol. 2019, 9, 14341–14355. [Google Scholar] [CrossRef]
- Pikitch, E.K. A Tool for Finding Rare Marine Species. Science 2018, 360, 1180–1182. [Google Scholar] [CrossRef]
- Bakker, J.; Wangensteen, O.S.; Chapman, D.D.; Boussarie, G.; Buddo, D.; Guttridge, T.L.; Hertler, H.; Mouillot, D.; Vigliola, L.; Mariani, S. Environmental DNA Reveals Tropical Shark Diversity in Contrasting Levels of Anthropogenic Impact. Sci. Rep. 2017, 7, 16886. [Google Scholar] [CrossRef] [PubMed]
- Boussarie, G.; Bakker, J.; Wangensteen, O.S.; Mariani, S.; Bonnin, L.; Juhel, J.-B.; Kiszka, J.J.; Kulbicki, M.; Manel, S.; Robbins, W.D.; et al. Environmental DNA Illuminates the Dark Diversity of Sharks. Sci. Adv. 2018, 4, eaap9661. [Google Scholar] [CrossRef] [PubMed]
- Juhel, J.-B.; Marques, V.; Fernández, A.P.; Borrero-Pérez, G.H.; Martinezguerra, M.M.; Valentini, A.; Dejean, T.; Manel, S.; Loiseau, N.; Velez, L. Detection of the Elusive Dwarf Sperm Whale (Kogia Sima) Using Environmental DNA at Malpelo Island (Eastern Pacific, Colombia). Ecol. Evol. 2021, 11, 2956. [Google Scholar] [CrossRef] [PubMed]
- Alter, S.E.; King, C.D.; Chou, E.; Chin, S.C.; Rekdahl, M.; Rosenbaum, H.C. Using Environmental DNA to Detect Whales and Dolphins in the New York Bight. Front. Conserv. Sci. 2022, 3, 820377. [Google Scholar] [CrossRef]
- Mariani, S.; Fernandez, C.; Baillie, C.; Magalon, H.; Jaquemet, S. Shark and Ray Diversity, Abundance and Temporal Variation around an Indian Ocean Island, Inferred by eDNA Metabarcoding. Conserv. Sci. Pract. 2021, 3, e407. [Google Scholar] [CrossRef]
- Boyse, E.; Robinson, K.P.; Beger, M.; Carr, I.M.; Taylor, M.; Valsecchi, E.; Goodman, S.J. Environmental DNA Reveals Fine-scale Spatial and Temporal Variation of Marine Mammals and Their Prey Species in a Scottish Marine Protected Area. Environ. DNA 2024, 6, e587. [Google Scholar] [CrossRef]
- De La Hoz Schilling, C.; Jabado, R.W.; Veríssimo, A.; Caminiti, L.; Sidina, E.; Gandega, C.Y.; Serrão, E.A. eDNA Metabarcoding Reveals a Rich but Threatened and Declining Elasmobranch Community in West Africa’s Largest Marine Protected Area, the Banc d’Arguin. Conserv. Genet. 2024, 25, 805–821. [Google Scholar] [CrossRef]
- Albonetti, L.; Maiello, G.; Cariani, A.; Carpentieri, P.; Ferrari, A.; Sbrana, A.; Shum, P.; Talarico, L.; Russo, T.; Mariani, S. DNA Metabarcoding of Trawling Bycatch Reveals Diversity and Distribution Patterns of Sharks and Rays in the Central Tyrrhenian Sea. ICES J. Mar. Sci. 2023, 80, 664–674. [Google Scholar] [CrossRef]
- Jeunen, G.; Knapp, M.; Spencer, H.G.; Lamare, M.D.; Taylor, H.R.; Stat, M.; Bunce, M.; Gemmell, N.J. Environmental DNA (eDNA) Metabarcoding Reveals Strong Discrimination among Diverse Marine Habitats Connected by Water Movement. Mol. Ecol. Resour. 2019, 19, 426–438. [Google Scholar] [CrossRef]
- Brandl, S.J.; Goatley, C.H.R.; Bellwood, D.R.; Tornabene, L. The Hidden Half: Ecology and Evolution of Cryptobenthic Fishes on Coral Reefs. Biol. Rev. 2018, 93, 1846–1873. [Google Scholar] [CrossRef]
- Mathon, L.; Marques, V.; Mouillot, D.; Albouy, C.; Andrello, M.; Baletaud, F.; Borrero-Pérez, G.H.; Dejean, T.; Edgar, G.J.; Grondin, J.; et al. Cross-Ocean Patterns and Processes in Fish Biodiversity on Coral Reefs through the Lens of eDNA Metabarcoding. Proc. R. Soc. B Biol. Sci. 2022, 289, 20220162. [Google Scholar] [CrossRef] [PubMed]
- Ip, Y.C.A.; Chang, J.J.M.; Tun, K.P.P.; Meier, R.; Huang, D. Multispecies Environmental DNA Metabarcoding Sheds Light on Annual Coral Spawning Events. Mol. Ecol. 2023, 32, 6474–6488. [Google Scholar] [CrossRef] [PubMed]
- Shinzato, C.; Narisoko, H.; Nishitsuji, K.; Nagata, T.; Satoh, N.; Inoue, J. Novel Mitochondrial DNA Markers for Scleractinian Corals and Generic-Level Environmental DNA Metabarcoding. Front. Mar. Sci. 2021, 8, 758207. [Google Scholar] [CrossRef]
- Alexander, J.B.; Bunce, M.; White, N.; Wilkinson, S.P.; Adam, A.A.S.; Berry, T.; Stat, M.; Thomas, L.; Newman, S.J.; Dugal, L.; et al. Development of a Multi-Assay Approach for Monitoring Coral Diversity Using eDNA Metabarcoding. Coral Reefs 2020, 39, 159–171. [Google Scholar] [CrossRef]
- West, K.M.; Stat, M.; Harvey, E.S.; Skepper, C.L.; DiBattista, J.D.; Richards, Z.T.; Travers, M.J.; Newman, S.J.; Bunce, M. eDNA Metabarcoding Survey Reveals Fine-Scale Coral Reef Community Variation across a Remote, Tropical Island Ecosystem. Mol. Ecol. 2020, 29, 1069–1086. [Google Scholar] [CrossRef] [PubMed]
- Dugal, L.; Thomas, L.; Wilkinson, S.P.; Richards, Z.T.; Alexander, J.B.; Adam, A.A.S.; Kennington, W.J.; Jarman, S.; Ryan, N.M.; Bunce, M.; et al. Coral Monitoring in Northwest Australia with Environmental DNA Metabarcoding Using a Curated Reference Database for Optimized Detection. Environ. DNA 2022, 4, 63–76. [Google Scholar] [CrossRef]
- Dugal, L.; Thomas, L.; Meenakshisundaram, A.; Simpson, T.; Lines, R.; Colquhoun, J.; Jarman, S.; Meekan, M. Distinct Coral Reef Habitat Communities Characterized by Environmental DNA Metabarcoding. Coral Reefs 2023, 42, 17–30. [Google Scholar] [CrossRef]
- Gösser, F.; Schweinsberg, M.; Mittelbach, P.; Schoenig, E.; Tollrian, R. An Environmental DNA Metabarcoding Approach versus a Visual Survey for Reefs of Koh Pha-ngan in Thailand. Environ. DNA 2023, 5, 297–311. [Google Scholar] [CrossRef]
- Gold, Z.; Sprague, J.; Kushner, D.J.; Zerecero Marin, E.; Barber, P.H. eDNA Metabarcoding as a Biomonitoring Tool for Marine Protected Areas. PLoS ONE 2021, 16, e0238557. [Google Scholar] [CrossRef]
- Pratomo, A.; Bengen, D.G.; Zamani, N.P.; Lane, C.; Humphries, A.T.; Borbee, E.; Subhan, B.; Madduppa, H. Diversity and Distribution of Symbiodiniaceae Detected on Coral Reefs of Lombok, Indonesia Using Environmental DNA Metabarcoding. PeerJ 2022, 10, e14006. [Google Scholar] [CrossRef] [PubMed]
- Madduppa, H.; Cahyani, N.K.D.; Anggoro, A.W.; Subhan, B.; Jefri, E.; Sani, L.M.I.; Arafat, D.; Akbar, N.; Bengen, D.G. eDNA Metabarcoding Illuminates Species Diversity and Composition of Three Phyla (Chordata, Mollusca and Echinodermata) across Indonesian Coral Reefs. Biodivers. Conserv. 2021, 30, 3087–3114. [Google Scholar] [CrossRef]
- Byrne, I.; Riginos, C.; Uthicke, S.; Brookes, D.; Popovic, I. DNA Metabarcoding as a Tool for Characterising the Spatio-Temporal Distribution of Planktonic Larvae in the Phylum Echinodermata. Coral Reefs 2024, 43, 717–731. [Google Scholar] [CrossRef]
- Merten, V.; Bayer, T.; Reusch, T.B.H.; Puebla, O.; Fuss, J.; Stefanschitz, J.; Lischka, A.; Hauss, H.; Neitzel, P.; Piatkowski, U.; et al. An Integrative Assessment Combining Deep-Sea Net Sampling, in situ Observations and Environmental DNA Analysis Identifies Cabo Verde as a Cephalopod Biodiversity Hotspot in the Atlantic Ocean. Front. Mar. Sci. 2021, 8, 760108. [Google Scholar] [CrossRef]
- Kim, E.-B.; Ju, S.-J.; Suh, Y.J. Biodiversity and Community Structures across the Magellan Seamounts and Abyssal Plains in the Western Pacific Ocean Revealed by Environmental DNA Metabarcoding Analysis. Front. Mar. Sci. 2024, 11, 1412678. [Google Scholar] [CrossRef]
- Maeda, A.; Nishijima, M.; Iguchi, A.; Ota, Y.; Suzumura, M.; Suzuki, A. Environmental DNA Metabarcoding of Foraminifera for Biological Monitoring of Bottom Water and Sediments on the Takuyo-Daigo Seamount in the Northwestern Pacific. Front. Mar. Sci. 2024, 10, 1243713. [Google Scholar] [CrossRef]
- Sinniger, F.; Pawlowski, J.; Harii, S.; Gooday, A.J.; Yamamoto, H.; Chevaldonné, P.; Cedhagen, T.; Carvalho, G.; Creer, S. Worldwide Analysis of Sedimentary DNA Reveals Major Gaps in Taxonomic Knowledge of Deep-Sea Benthos. Front. Mar. Sci. 2016, 3, 92. [Google Scholar] [CrossRef]
- Stuart-Smith, R.D.; Brown, C.J.; Ceccarelli, D.M.; Edgar, G.J. Ecosystem Restructuring along the Great Barrier Reef Following Mass Coral Bleaching. Nature 2018, 560, 92–96. [Google Scholar] [CrossRef]
- Agersnap, S.; Sigsgaard, E.E.; Jensen, M.R.; Avila, M.D.P.; Carl, H.; Møller, P.R.; Krøs, S.L.; Knudsen, S.W.; Wisz, M.S.; Thomsen, P.F. A National Scale “BioBlitz” Using Citizen Science and eDNA Metabarcoding for Monitoring Coastal Marine Fish. Front. Mar. Sci. 2022, 9, 824100. [Google Scholar] [CrossRef]
- Sutherland, W.J.; Aveling, R.; Brooks, T.M.; Clout, M.; Dicks, L.V.; Fellman, L.; Fleishman, E.; Gibbons, D.W.; Keim, B.; Lickorish, F.; et al. A Horizon Scan of Global Conservation Issues for 2014. Trends Ecol. Evol. 2014, 29, 15–22. [Google Scholar] [CrossRef]
- Li, F.; Yang, J.; Yang, Y.; Zhang, X. Using Environmental DNA Metabarcoding to Monitor the Changes and Health Status of Aquatic Ecosystems. Environ. Monit. China 2018, 34, 37–46. [Google Scholar]
- Dully, V.; Wilding, T.A.; Mühlhaus, T.; Stoeck, T. Identifying the Minimum Amplicon Sequence Depth to Adequately Predict Classes in eDNA-Based Marine Biomonitoring Using Supervised Machine Learning. Comput. Struct. Biotechnol. J. 2021, 19, 2256–2268. [Google Scholar] [CrossRef] [PubMed]
- Kimura, M.; Yamanaka, H.; Nakashima, Y. Application of Machine Learning to Environmental DNA Metabarcoding. IEEE Access 2022, 10, 101790–101794. [Google Scholar] [CrossRef]
- Kolios, S.; Maurodimou, O.; Stylios, C. Integrated Large-Scale Environmental Information Systems: A Short Survey. In Proceedings of the Collaborative Systems for Reindustrialization; Camarinha-Matos, L.M., Scherer, R.J., Eds.; Springer: Berlin/Heidelberg, Germany, 2013; pp. 164–171. [Google Scholar]
- Matějíček, L.; Engst, P.; Jaňour, Z. A GIS-Based Approach to Spatio-Temporal Analysis of Environmental Pollution in Urban Areas: A Case Study of Prague’s Environment Extended by LIDAR Data. Ecol. Model. 2006, 199, 261–277. [Google Scholar] [CrossRef]
- Muenzel, D.; Bani, A.; De Brauwer, M.; Stewart, E.; Djakiman, C.; Halwi; Purnama, R.; Yusuf, S.; Santoso, P.; Hukom, F.D.; et al. Combining Environmental DNA and Visual Surveys Can Inform Conservation Planning for Coral Reefs. Proc. Natl. Acad. Sci. USA 2024, 121, e2307214121. [Google Scholar] [CrossRef]
- Rey, A.; Viard, F.; Lizé, A.; Corre, E.; Valentini, A.; Thiriet, P. Coastal Rocky Reef Fish Monitoring in the Context of the Marine Strategy Framework Directive: Environmental DNA Metabarcoding Complements Underwater Visual Census. Ocean Coast. Manag. 2023, 241, 106625. [Google Scholar] [CrossRef]
- Stat, M.; John, J.; DiBattista, J.D.; Newman, S.J.; Bunce, M.; Harvey, E.S. Combined Use of eDNA Metabarcoding and Video Surveillance for the Assessment of Fish Biodiversity. Conserv. Biol. 2019, 33, 196–205. [Google Scholar] [CrossRef] [PubMed]
- Valdivia-Carrillo, T.; Rocha-Olivares, A.; Reyes-Bonilla, H.; Domínguez-Contreras, J.F.; Munguia-Vega, A. Integrating eDNA Metabarcoding and Simultaneous Underwater Visual Surveys to Describe Complex Fish Communities in a Marine Biodiversity Hotspot. Mol. Ecol. Resour. 2021, 21, 1558–1574. [Google Scholar] [CrossRef]
- Bohan, D.A.; Vacher, C.; Tamaddoni-Nezhad, A.; Raybould, A.; Dumbrell, A.J.; Woodward, G. Next-Generation Global Biomonitoring: Large-Scale, Automated Reconstruction of Ecological Networks. Trends Ecol. Evol. 2017, 32, 477–487. [Google Scholar] [CrossRef] [PubMed]
- Thomsen, P.F.; Jensen, M.R.; Sigsgaard, E.E. A Vision for Global eDNA-Based Monitoring in a Changing World. Cell 2024, 187, 4444–4448. [Google Scholar] [CrossRef]
- Hartig, F.; Abrego, N.; Bush, A.; Chase, J.M.; Guillera-Arroita, G.; Leibold, M.A.; Ovaskainen, O.; Pellissier, L.; Pichler, M.; Poggiato, G. Novel Community Data in Ecology-Properties and Prospects. Trends Ecol. Evol. 2024, 39, 280–293. [Google Scholar] [CrossRef]
Markers | Primer Name | Primer Sequence (5′-3′) | Target Length (bp) | References |
---|---|---|---|---|
16S rRNA | HICOR16S_F1 | CCGGTATGAATGGTRTCMCGA | Nichols & Marko [77] | |
HICOR16S_R1 | TMCAGTAAAGYTCCATGGGG | 120 | ||
HICOR16S_R2 | GTAACTTTTATTTGYTTATC | 400 | ||
COI | HICORCOX_F1 | GAACAAGGRGCKGGBAC | ||
HICORCOX_R1 | CCVGGRGCYCKCATRTTAAA | 120 | ||
HICORCOX_R2 | GCAACAAAAGTYGGKATTAT | 400 | ||
Nuclear ITS | SCLER5.8SFor | GARTCTTTGAACGCAAATGGC | Alexander et al. [143]; West et al. [70]; Dugal et al. [145] | |
SCLER28SRev | GCTTATTAATATGCTTAAATTCAGCG | |||
Coralacro_874Rev | TCGCCGTTACTGAGGGAATC | |||
12S rRNA | Scle_12S_Fw | CCAGCMGACGCGGTRANACTTA | ~366–465 | Shinzato et al. [142] |
Scle_12S_Rv | AAWTTGACGACGGCCATGC | |||
COI | Scle_CO1_Fw | ATTGTNTGRGCNCAYCATATGTTTA | ~296–302 | |
Scle_CO1_Rv | CCCATAGARAGNACATARTGAAA |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Yang, J.; Li, C.; Lo, L.S.H.; Zhang, X.; Chen, Z.; Gao, J.; U, C.; Dai, Z.; Nakaoka, M.; Yang, H.; et al. Artificial Intelligence-Assisted Environmental DNA Metabarcoding and High-Resolution Underwater Optical Imaging for Noninvasive and Innovative Marine Environmental Monitoring. J. Mar. Sci. Eng. 2024, 12, 1729. https://doi.org/10.3390/jmse12101729
Yang J, Li C, Lo LSH, Zhang X, Chen Z, Gao J, U C, Dai Z, Nakaoka M, Yang H, et al. Artificial Intelligence-Assisted Environmental DNA Metabarcoding and High-Resolution Underwater Optical Imaging for Noninvasive and Innovative Marine Environmental Monitoring. Journal of Marine Science and Engineering. 2024; 12(10):1729. https://doi.org/10.3390/jmse12101729
Chicago/Turabian StyleYang, Jing, Chao Li, Linus Shing Him Lo, Xu Zhang, Zhikui Chen, Jing Gao, Clara U, Zhijun Dai, Masahiro Nakaoka, Huayong Yang, and et al. 2024. "Artificial Intelligence-Assisted Environmental DNA Metabarcoding and High-Resolution Underwater Optical Imaging for Noninvasive and Innovative Marine Environmental Monitoring" Journal of Marine Science and Engineering 12, no. 10: 1729. https://doi.org/10.3390/jmse12101729
APA StyleYang, J., Li, C., Lo, L. S. H., Zhang, X., Chen, Z., Gao, J., U, C., Dai, Z., Nakaoka, M., Yang, H., & Cheng, J. (2024). Artificial Intelligence-Assisted Environmental DNA Metabarcoding and High-Resolution Underwater Optical Imaging for Noninvasive and Innovative Marine Environmental Monitoring. Journal of Marine Science and Engineering, 12(10), 1729. https://doi.org/10.3390/jmse12101729