Next Article in Journal
The Influence of Ecological Factors on the Contents of Nutritional Components and Minerals in Laver Based on Open Sea Culture System
Next Article in Special Issue
Verification of an Environmental Impact Assessment Using a Multivariate Statistical Model
Previous Article in Journal
Stochastic Medium Model for the Settlement Calculation of Prefabricated Vertical Drains of Soft Soil Foundations in the Coastal Area of South China
Previous Article in Special Issue
Assessing the Effects of Ocean Warming and Acidification on the Seagrass Thalassia hemprichii
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Effect of Various Local Anthropogenic Impacts on the Diversity of Coral Mucus-Associated Bacterial Communities

by
Emad I. Hussein
1,2,
Abdul-Salam F. Juhmani
3,*,
Jacob H. Jacob
4,
Mahmoud A. Telfah
2,
Mutaz A. Abd Al-razaq
5,
Fuad A. Al-Horani
6,
Mazhar Salim Al Zoubi
7 and
Hanan I. Malkawi
2
1
Department of Food Science and Human Nutrition, College of Applied and Health Sciences, A’Sharqiyah University, P.O. Box 42, Ibra 400, Oman
2
Department of Biological Sciences, Yarmouk University, Irbid 21163, Jordan
3
Department of Environmental Sciences, Informatics and Statistics, Ca’ Foscari University of Venice, 30175 Venice, Italy
4
Department of Biological Sciences, Al Al-Bayt University, Al-Mafraq 25113, Jordan
5
Department of Radiation Oncology, Saarland University, 66424 Homburg, Germany
6
School of Basic and Marine Science, The University of Jordan, Aqaba 77111, Jordan
7
Faculty of Medicine, Yarmouk University, Irbid 21163, Jordan
*
Author to whom correspondence should be addressed.
J. Mar. Sci. Eng. 2022, 10(7), 863; https://doi.org/10.3390/jmse10070863
Submission received: 15 May 2022 / Revised: 16 June 2022 / Accepted: 17 June 2022 / Published: 24 June 2022
(This article belongs to the Special Issue The Impact of Changes in the Marine Environment on Marine Organisms)

Abstract

The global continued decline in coral reefs is intensifying the need to understand the response of corals to local environmental stressors. Coral-associated bacterial communities have been suggested to have a swift response to environmental pollutants. This study aims to determine the variation in the bacterial communities associated with the mucus of two coral species, Pocillopora damicornis (Linnaeus, 1758) and Stylophora pistillata (Esper, 1792), and the coral-surrounding seawater from three areas exposed to contamination at the Jordanian coast of the Gulf of Aqaba (Red Sea), and also explores the antibacterial activity of these bacteria. Corals were collected from three contaminated zones along the coast, and the bacteria were quantified and identified by conventional morphological and biochemical tests, as well as 16S rRNA gene sequencing. The average number of bacteria significantly varied among the coral mucus from the sampling zones and between the coral mucus and the surrounding seawater. The P. damicornis mucus-associated bacterial community was dominated by members of the classes Gammaproteobacteria, Cytophagia, and Actinomycetia, while the mucus of S. pistillata represented higher bacterial diversity, with the dominance of the bacterial classes Gammaproteobacteria, Actinomycetia, Alphaproteobacteria, and Bacilli. The effects of local anthropogenic impacts on coral mucus bacterial communities were represented in the increased abundance of bacterial species related to coral diseases. Furthermore, the results demonstrated the existence of bacterial isolates with antibacterial activity that possibly acted as a first line of defense to protect and maintain the coral host against pathogens. Indeed, the dynamics of coral-associated microbial communities highlight the importance of holistic studies that focus on microbial interactions across the coral reef ecosystem.

1. Introduction

Marine ecosystems are among the largest and most diverse ecosystems, and are characterized by their biological productivity [1]. Coral reefs host about 25% of marine species, even though they represent less than 0.1% of the marine environments [2]. However, this fundamental ecosystem is degenerating over time, since 27% of coral reefs were destroyed in the last few decades worldwide, and the rest are under threat of being lost [2,3].
Coral hosts dense, dynamic, and highly diverse consortia of microorganisms, such as dinoflagellates, Bacteria, Archaea, viruses, and fungi, forming a complex mutualistic relationship with corals (coral holobiont) [4]. These microorganisms inhabit the range of ecological niches provided by corals, such as the surface mucus layer, tissue layers, and the skeleton [5]. The interactions of corals and their associated microbial community contribute to various aspects of coral biology, including nutrition, protection, growth, survival, and their general health status [6,7]. However, the mechanisms for acquiring bacterial associations with host corals are poorly understood.
Different processes of the coral holobiont are promoted by microbial communities associated with corals, including the carbon cycle [8], the sulfur cycle [9], phosphorus fixation, metal homeostasis, organic matter treatment [10], antibiotic production [11], and secondary metabolism [10]. Many coral-associated bacteria protect corals, for example (coral Acropora palmata (Lamarck, 1816) [11]), by secreting antimicrobial compounds to prevent the entry of pathogens or other exogenous bacteria. Additionally, some coral-resident bacteria actively predate upon some pathogens within coral mucus [12]. Indeed, the disruption or destabilization of the coral holobiont can affect the host’s fitness and ecosystem dynamics [12].
The diversity of coral-associated bacterial communities is affected by local environmental factors. For example, a change in the bacterial communities associated with the coral Acropora hemprichii (Ehrenberg, 1834) was induced by enrichment with inorganic nutrients in a coral reef habitat [13] and caused outbreaks of coral disease [14,15]. Furthermore, increased nutrients coupled with overfishing have indirectly affected coral bacterial communities by promoting algal growth that induces coral mortality by microbes [16]. Discharged sewage enters coastal ecosystems, carrying high loads of inorganic nutrients, sediments, and organic compounds, which can have deleterious effects on coral reefs [17,18]. Moreover, sewage is also expected to introduce many new microbial taxa belonging to sewage-associated human pathogens and may consequently induce the development of coral disease [19,20]. The acidification of marine water is a consequence of anthropogenic CO2 emissions that is negatively impacting coral reefs. The study conducted by Shore et al. [21] on three coral species sampled from three sites with different seawater pH levels revealed that acidification has multiple consequences on coral bacterial communities, and suggests that the abundance of bacterial species Endozoicomonas may be an indicator of the coral’s response to the acidification of marine environments. Generally, coral-associated bacterial communities’ responses to environmental stressors are consistent across multiple stressors, with increased relative abundances for members of the Vibrionales, Flavobacteriales, Rhodobacteriales, and Alteromonadales [22].
The mechanisms of coral interaction with the epi-biotic marine bacteria are known to play a significant role in the marine ecosystem. One of the potential mechanisms involves the maintenance of antimicrobial chemicals against pathogens [23]. It has been hypothesized that the coral holobiont may protect corals from pathogens by occupying niches and/or producing antibiotics [4]. The mucus of several coral species is characterized by their secretion of allochemicals with antimicrobial properties [24,25,26]. A previous study reported that a high percentage (30%) of bacteria isolated from coral species have antimicrobial capabilities [27]. Nithyanand and Pandian [28], for example, reported the presence of actinomycetes in the coral mucus of Acropora digitifera (Dana, 1846), which had high activity against pathogens.
The Gulf of Aqaba is one of the unique aquatic ecosystems that has one of the world’s richest coral communities [29]. However, the Gulf of Aqaba is highly affected by anthropogenic stressors in the Middle East [30]. Coral reefs on the Jordanian coast of the Gulf of Aqaba have been subjected to various sources of environmental stressors in the last few years [29]. The main stressors include coral reef damage caused by tourism, oil spills, air pollution associated with land transportation, disposal of solid waste, phosphate dust deposition from ship loading activities, chemical and thermal pollution from coastal mega industries, and sewage discharges into the marine environment [31,32].
The aim of the current study was to assess the bacterial communities associated with the mucus of two species of coral and the coral-surrounding seawater from sites affected by various types of anthropogenic stressors in the Gulf of Aqaba (Jordan), to explore their antimicrobial activities, and to explore whether the diversity of and spatial variations in bacterial communities are affected by the sources of anthropogenic stressors in the study areas.

2. Materials and Methods

2.1. Sample Collection

Samples from two hard coral species (S. pistillata and P. damicornis) were collected by SCUBA divers (at a depth of 4–11 m) from three sites on the Jordanian coast of the Gulf of Aqaba: the Industrial Zone (I.Z), the Public Beach (P. Beach), and the Phosphate Berth (P. Berth) (Figure 1). The selected sites vary in terms of the source and level of anthropogenic stressors (Table S1). Coral samples were collected during the spring season (March 2016). Three replicates of both coral species were collected from each site. The samples were immediately placed in plastic tubes underwater and transported to the laboratory in an icebox within one hour of collection, as described by Koren and Rosenberg [33]. The seawater surrounding the coral species was also sampled using pre-sterilized 50 mL falcon tubes. The samples were stored at 4 °C and transported immediately to the laboratory.

2.2. Mucus Extraction

The extraction of coral mucus was carried out as described by Omry and Eugene [34]. Briefly, the coral samples were broken into small pieces and placed in sterile centrifuge tubes. The coral samples were then centrifuged for 10 min at 10,000 rpm at 4 °C to remove the mucus. After centrifugation, the mucus was collected in a 2 mL Eppendorf tube and stored at 4 °C until processing. Extraction was conducted in triplicate.

2.3. Isolation and Enumeration of Bacteria

Tenfold serial dilution of coral mucus and seawater samples was prepared and cultivated on marine agar (MA) media (Marine Agar 2216, PanReac, Castellar del Vallès, Spain). MA plates were incubated at 30 °C for 48 h. The viable plate count method was used to enumerate the viable bacteria of the samples and expressed in colony-forming units per ml (CFU/mL) as described by Lampert et al. [35]. The grown colonies were sub-cultured on new fresh MA plates several times to obtain a pure culture of bacterial isolates.

2.4. Morphological and Biochemical Characterization

The bacterial isolates were identified by performing a series of morphological and biochemical tests according to Bergey’s manual of determinative bacteriology [36] (Tables S2 and S3). The characterization of the bacterial isolates was conducted by the Gram reaction; after that, the colonial morphology was determined. A series of selective media (MacConkey agar, Pseudomonas agar, Simmons Citrate agar, Eosin Methylene Blue agar, and Salmonella agar) was used to characterize these isolates, as described by Garrity et al. [37]. All biochemical tests were performed according to the standard protocols using filtered seawater for media preparation to fulfill the halophilic requirement of marine bacteria.

2.5. Molecular Identification

Bacterial isolates that were not identified using conventional biochemical tests were subjected to identification based on molecular techniques (16S rRNA gene sequencing). Genomic DNA from the coral mucus-associated bacterial isolates was extracted using Bacteria DNA Extraction Kits (Thermo Fisher Scientific Inc., Waltham, MA, USA) following the manufacturer’s instructions. The extracted DNA was quantified using an UV- spectrophotometer (DNA concentration > 50 ng/µL).
The 16S rRNA gene of the bacteria was amplified from the extracted genomic DNA using the following eubacterial universal primers: forward primer (5’ AGAGTTTGATCCTGGCTCAG 3’) and reverse primer (5’ GGTTACCTTGTTACGACTT 3’) [35]. PCR was performed in a 25 mL reaction mixture with initial denaturation for 3 min at 95 °C, 40 cycles consisting of denaturation at 95 °C for 1 min, annealing at 55 °C for 1 min, and extension at 72 °C for 2 min, and a final extension step of 5 min at 72 °C. The amplification of the 16S rRNA gene was confirmed by running the amplification product in 1% agarose gel.
Sequencing of the amplified PCR products was performed at Macrogen Inc., Seoul, Korea. The obtained sequences were matched with previously published sequences available in NCBI using BLAST (http://blast.ncbi.nlm.nih.gov/Blast (accessed on 8 April 2018)) [38] and the BLASTn tool. Molecular phylogenetic analysis was conducted using the neighbor-joining statistical method [39]. The trees were drawn to scale, with the branch lengths measured in the number of substitutions per site. Phylogenetic analyses were conducted in MEGA11 (version 11.0.11) [Institute of Molecular Evolutionary Genetics, State College, PA, USA]. To validate the reproducibility of the branching pattern, a bootstrap analysis was performed with 500 replications [40].

2.6. Antimicrobial Activity Assay

Screening of the isolates’ antibacterial activity was conducted following the agar well diffusion method [41]. The reference bacterial strains were freshly prepared in nutrient broth and incubated at 37 °C for 18 h. The turbidity of each culture was adjusted to 0.5 McFarland standard, and each culture was spread onto nutrient agar media plates. Equidistant wells (8 mm diameter) were created in the inoculated nutrient agar plates using a sterile cork borer. The pure cultures’ bacterial isolates containing the antimicrobial were inoculated in marine broth for 48 or 72 h (according to the growth rate of the isolate). An amount of 100 µL of the pure culture broth was added to each well and the plates were incubated at 37 °C for 24 h. The antibacterial activity was measured in terms of the diameter of the inhibition zone in triplicate. The positive control for these experiments was ampicillin (10 mg mL−1), whereas the negative control was marine broth media. The antibacterial activity of the extract was evaluated against four test bacteria: Pseudomonas aeruginosa ATCC13048 and Serratia marcescens ATCC27117 (as representatives of Gram-negative bacteria), as well as Micrococcus luteus ATCC9341 and Bacillus cereus ATCC11778 (as representatives of Gram-positive bacteria).

2.7. Statistical Analyses

Statistically significant differences in the CFU/mL values with different factors (coral species, sampling sites, and sample matrix (coral mucus vs. seawater)) were determined by a one-way ANOVA test using PAST software [42]. Differences were considered significant at p < 0.05. The data met the assumptions for independence and normality. Dunn’s post hoc test was applied to the obtained significant calculated statistical differences [42]. To identify the shared and unique bacterial isolates from the coral mucus and surrounding seawater bacterial communities, a Venn diagram was constructed using Venny 2.0 [43]. Similarity percentage analysis (SIMPER) was used to represent the species of bacterial communities contributing to the differences between sampling sites and between the bacterial matrices (mucus vs. seawater), and analyses were performed in PRIMER v. 6 [44]. The visualization of the spatial variation in coral mucus and the surrounding seawater bacterial communities was conducted using unconstrained ordination plots with principal coordinate analysis (PCoA) based on the Euclidean similarity index created by PAST software (version 4.10) [42].

3. Results

3.1. Coral Mucus and Seawater Viable Bacterial Count

The viable bacterial count was determined for the coral mucus of both S. pistillata and P. damicornis (Figure 2). The highest viable bacterial number was detected in the mucus samples of P. damicornis obtained from the Phosphate Berth, whereas the lowest viable bacterial count was detected in the mucus samples of both corals obtained from the Industrial Zone. Significant statistical differences (one-way ANOVA, p < 0.05) were detected between the bacterial counts (in CFU/mL) from the three sampling sites, where F (2,6) = 5779 and p = 1.4 × 10−10 in case of P. damicornis. Dunn’s multiple comparison test found that the mean value of the bacterial counts was significantly different between the Industrial Zone and Phosphate Berth sites (p = 0.00729). However, in the case of S. pistillata, F (2,6) = 2640 and p = 1.46 × 10−9, and the one-way ANOVA and Dunn’s multiple comparison test found that the mean value of the bacterial counts was significantly different between the Industrial Zone and Phosphate Berth sites (p = 0.00704). However, no significant differences were obtained for the bacterial count values between the two coral species (one-way ANOVA, F (1,16) = 0.617, p = 0.443)).
The viable bacterial count of the seawater surrounding both corals, S. pistillata and P. damicornis, was lower in comparison to that of the mucus (Figure 3). The maximum value was detected at the Phosphate Berth site for P. damicornis coral species (1.22 × 106), while the lowest values were obtained from the seawater around both coral species from the Public Beach site. The variations in the bacterial viable count values between the coral mucus and surrounding seawater were significantly different ((F (1,10) = 6.536, p = 0.028, one-way ANOVA), post hoc comparison (Dunn’s-test, p = 0.0039)). Furthermore, significant differences were obtained for a viable bacterial count between the mucus of S. pistillata and the surrounding seawater ((F (1,8) = 131.4, p = 3.3 × 10−6, one-way ANOVA), post hoc comparisons (Dunn’s-test, p = 0.0088)). However, no significant differences were obtained between the mucus of P. damicornis and the surrounding seawater (one-way ANOVA, F (1,10) = 4.74, p = 0.054).

3.2. Biochemical Identification of Bacteria

A total of 58 different bacterial colonies were isolated from the coral mucus samples from the sampling sites for both coral species based on the unique colonial characteristics of the MA medium. Of them, 22 of the bacteria isolated were obtained from the mucus of P. damicornis, whereas the remaining 36 isolated were obtained from S. pistillata mucus. The distinct morphological and colony characteristics of the isolated bacteria are shown in Table S2.
Following the morphological and biochemical pathway for the taxonomical identification of the bacterial isolate from P. damicornis mucus, 15 isolates were identified at the family level (Figure 4). The bacterial isolates belonged to the classes Gammaproteobacteria (73%), Cytophagia (20%), and Actinomycetia (7%). High variability in Public Beach isolates was detected as compared with those from the other sampling sites (Tables S2 and S4).
Bacterial species belonging to the families Yersiniaceae and Cytophagaceae were found to be dominant in P. damicornis mucus. Bacterial species of the families Micrococcaceae and Pseudomonadaceae showed the lowest abundance among the sampling sites.
Higher diversity of bacterial species was identified from coral S. pistillata mucus samples among the sampling sites. The taxonomical identification using morphological and biochemical tests resulted in 26 bacterial isolates (at the family level) (Figure 5). The bacterial isolates were distributed among the classes Gammaproteobacteria (58%), Actinomycetia (23%), Alphaproteobacteria (11%), and Bacilli (8%). The Public Beach site was characterized by higher diversity in comparison with the other sites. The S. pistillata mucus bacterial communities were characterized by the dominance of species belonging to the families Pseudomonadaceae, Vibrionaceae, Corynebacteriaceae, and Yersiniaceae. The bacterial families from the class Bacilli (Caryophanaceae and Streptococcaceae) showed the lowest abundance in the S. pistillata mucus bacterial community.
Regarding seawater isolates, a total of 62 bacterial isolates with unique colonial characteristics were obtained from both seawater samples (Tables S3 and S5). Thirty isolates were obtained from the seawater collected around P. damicornis, and 32 isolates from the seawater around S. pistillata. From the total isolates, 48 bacterial isolates were identified using a conventional biochemical test (Figure 6). The seawater bacterial community surrounding P. damicornis was mainly composed of Gammaproteobacteria (78%), Fusobacteriota (13%), and Bacilli (9%), whereas the S. pistillata-surrounding seawater bacterial community was composed of Gammaproteobacteria (84%), Actinomycetia (8%), Fusobacteriota (4%), and Bacilli (4%). More than three quarters of the bacterial isolates from both seawater samples belonged to the families Pseudoalteromonadaceae, Pseudomonadaceae, and Yersiniaceae. The lowest abundances were noticed for the bacterial families Enterobacteriaceae, Nocardiacaea, and Actinomycetaceae.

3.3. Molecular Identification of Bacteria and Phylogenetic Analysis

Among the bacterial isolates that could not be identified by conventional biochemical tests, a total of 17 mucus-associated bacterial isolates were identified at the species level based on 16 S rRNA gene sequencing; among them, 7 and 10 isolates were isolated from the P. damicornis and S. pistillata mucus, respectively (Table 1).
The Public Beach site was characterized by the highest bacterial diversity. The most common bacterial species isolated from the mucus of P. damicornis belonged to the genera Pseudoalteromonas and Psychrobacter. Interestingly, the species Pseudoalteromonas sp. was isolated from the mucus of P. damicornis at all sampling sites, whereas the species Cellulophaga lytica (family: Flavobacteriaceae) was exclusively isolated from samples from the Phosphate Berth site.
Fourteen bacterial isolates from seawater samples around the two coral species were identified using a molecular approach (Table 2). They were divided equally between both coral species. The bacterial species belong to Gammaproteobacteria and Bacilli classes. Bacteria from the genus Bacillus were isolated from seawater samples from both Industrial Zone and Phosphate Berth sites. The bacterial strains from the Public Beach site belonged to the Gammaproteobacteria class.
Phylogenetic analysis of the isolated bacteria from the coral (P. damicornis) mucus and the surrounding seawater revealed the presence of two major groups of bacterial taxa, the Gram-positive Bacillota (also called Firmicutes) and the Gram-negative Gammaproteobacteria (Figure 7). Phylogenetic analysis of the coral mucus and seawater strains showed that there were 10 strains clustered within the Gammaproteobacteria group belonging to several Pseudomonadales, Alteromonadales, and Oceanospirillales bacterial orders with 96–99% similarity to sequences in the NCBI databases. Gram-positive Bacillus strains were clustered in a distinct cluster. BLAST analysis showed that the bacterial strain BPw9 was a member of the Gammaproteobacteria, with the lowest similarity percentage (95.7%) with Acinetobacter schindleri (accession number MG581287.1). A single cluster was noticed for Psychrobacter species with similarity of >97% with the BLAST database.
Similarly, two major groups of bacterial domains, Gram-positive Bacillota and the Gram-negative Gammaproteobacteria, were obtained from the phylogenetic analyses of bacterial isolate sequences from the coral (S. pistillata) mucus and the surrounding seawater (Figure 8). From the four bacilli isolates cluster, one isolate was isolated from S. Pistillata mucus (BSm36), which had 99% similarity with Bacillus sp. MML3 (accession number JX847617.1). A total of 13 strains were clustered within the Gammaproteobacteria group belonging to several Pseudomonadales, Alteromonadales, Oceanospirillales, and Vibrionales bacterial orders with 96–98.4% similarity with NCBI database sequences. Each bacterial member of the Gammaproteobacteria showed a unique cluster with the same phylogenetic distance, except for the species Marinovum algicola (family: Oceanospirillaceae) (BSw2), which was isolated from the Public Beach site seawater; this strain had a distinct cluster.

3.4. Distribution of Shared and Non-Ubiquitous Bacterial Isolates

The intersection among the coral species and sampling sites through Venn diagrams (Figure 9a) showed that S. pistillata exhibited the highest number of non-ubiquitous bacterial genera (10 genera). The diagram showed that bacterial isolates belonging to seven genera were commonly distributed in the mucus of both coral species, while bacterial species belonging to three genera—Cellulophaga, Cytophaga, and Klebsiella—were exclusively distributed in the mucus of P. damicornis.
Bacterial species belonging to the three genera Brevundimonas, Pseudomonas, and Vibrio were shared between all sampling sites (Figure 9b). Interestingly, no unique bacterial species were present at the Industrial Zone site. However, bacterial species belonging to six genera—Bacillus, Klebsiella, Mesophilobacter, Mycobacterium, Photobacterium, and Planococcus—were exclusively distributed at the Public Beach site. SIMPER analysis indicated that the lowest similarity between the bacterial communities was obtained for the Industrial Zone and Phosphate berth site (26.2%), where the species of the bacteria genera Pseudoalteromonas, Serratia, Pseudomonas, Cytophaga, Bacillus, Cellulophaga, Streptobacillus, Vibrio, and Yersinia contributed to ca. 60% of the dissimilarity between the two sites. By comparing the distribution of the bacterial communities between coral mucus and the surrounding seawater, the Venn diagram (Figure 9c) showed that bacterial species from 10 genera were shared between the two matrices. SIMPER analysis revealed that high dissimilarity was obtained between the coral mucus and seawater bacterial community (76.7%). The species of bacterial genera belonging to Serratia, Pseudomonas, Pseudoalteromonas, Vibrio, Bacillus, Yersinia, Cytophaga, and Streptobacillus contributed to ca. 51% of the dissimilarity between the coral mucus and seawater bacterial communities.

3.5. Distribution of Coral Mucus and Seawater Bacterial Communities

The distribution of the coral mucus and surrounding seawater bacterial communities among the sampling sites were elucidated by principal coordinates analysis (PCoA) (Figure 10). The first two coordinates of PCoA expressed 55% of the total variations between the bacterial communities. The coral mucus bacterial communities’ samples were clustered together, whereas the seawater bacterial community samples were clustered in a distinct cluster. Interestingly, samples from the Industrial Zone site were clustered together away from the other sampling sites.

3.6. Antimicrobial Activity of Coral Mucus and Seawater Bacterial Isolates

Out of the 120 bacterial isolates that were examined for antibacterial activity, 10 isolates exhibited antimicrobial activities against at least one indicator strain (8.6% of mucus and 8.0% of seawater) (Table 3). Strain BPw9 was found to be active against P. aeruginosa, S. marcescens, and S. aureus (inhibition zones: 16, 13, and 13 mm, respectively). Six strains exhibited activity against S. marcescens ATCC27117. The strain CPw4 only showed activity against M. luteus ATCC9341 (inhibition zone, 12 mm). The highest antimicrobial activity was noticed for the strains against P. aeruginosa ATCC13048, with the highest diameter in the zone of inhibition.

4. Discussion

The study of microbial communities under a range of anthropogenic pollutants along the Jordanian coast of the Gulf of Aqaba revealed an influence of prevailing anthropogenic pressures on the microbial communities associated with the mucus and surrounding seawater of the corals P. damicornis and S. pistillata. The effect of anthropogenic pollutants was clearly evidenced by the prevalence of bacterial species that are known to be related to coral diseases, such as white plague-like, pinkblue spot syndrome, and dark spots [45]. These bacterial communities may originate from the pollutants discharged into seawater from the adjacent environment and the industrial activities on the coastline of the Gulf of Aqaba [46]. Intriguingly, the experiment by Ziegler et al. [47] found that the coral Acropora hemprichii harbored a highly flexible microbiome that differed in response to the level of anthropogenic impact for the transplanted corals. However, Pocillopora verrucosa (Ellis and Solander, 1786) remained remarkably stable.
The average viable bacterial count from coral mucus for both studied corals ranged between 107 and 109 CFU/mL. These concentrations of bacteria in mucus agreed with Omry and Eugene [34], who investigated the number of bacteria in the mucus of the Mediterranean coral Oculina patagonica de Angelis D’Ossat, 1908; they found that the average viable bacterial count was 3 × 108. Furthermore, the viable bacterial count values from mucus from the studied sites is consistent with the results obtained by Jaber [48] who studied the bacterial communities associated with the corals S. pistillata and Galaxea fascicularis (Linnaeus, 1767) at the Marine Science Station (MSS) in the Gulf of Aqaba (Jordan). This high number of bacteria in coral mucus could be related to the sufficient nitrogen and phosphorus (eutrophication) in the mucus that support the growth of bacteria [49]. However, a lower bacterial count was recorded for seawater surrounding the studied coral species. The oligotrophic condition of Gulf of Aqaba seawater may be attributed to the inhibition of bacterial growth in the water column [50].
The heterotrophic cultivable bacterial communities associated with the mucus of these corals consisted of the bacterial phyla Proteobacteria (82%), Actinomycetia (7%), Cytophagia (6%), and Bacilli (6%). The bacteria diversity was similar to that of those isolated from the mucus of four coral species present along the Brazilian coast [51], where a higher abundance of Proteobacteria was also detected. Indeed, this phylum has already been detected in association with the mucus of the coral Fungia scutaira Lamarck, 1801, which was studied by Lampert et al. [35] in the Red Sea area. In the coral holobiont, the phylum Proteobacteria has shown antimicrobial properties and the ability to induce larval settlement [52], suggesting an important role for this phylum in protecting coral health. Gammaproteobacteria (76%) and Alphaproteobacteria (6%) were the most dominant classes. Gammaproteobacteria was the most abundant group of cultivable bacteria in Mussismilia hispida (Verrill, 1901) and Madracis decactis (Lyman, 1859) coral mucus samples [51]. The high proportions of these bacteria in the coral mucus could be indicative of the importance of these bacteria in the coral holobiont.
The use of coral-surrounding seawater bacterial community data, together with coral mucus data, may enhance our ability to evaluate the effect of anthropogenic stressors and environmental changes more holistically. For example, the seawater bacterial communities could change in response to temperature fluctuations [50], which is consequently correlated with coral bleaching [53]. The seawater bacterial communities were predominated by Gammaproteobacteria (76%), Bacilli (15%), Fusobacteriia (6%), and Actinomycetia (3%) classes. These findings disagreed with the previous results obtained by Kooperman et al. [54], where they studied the bacterial association between two coral species and the surrounding seawater in the Red Sea. They found that the most abundant group in seawater samples was cyanobacteria (30%), whereas the Gammaproteobacteria group accounted for only 5%. Consistent with our results, Jorge et al. [55] found that Gammaproteobacteria was the most abundant group in the seawater around the coral Montastrea cavernosa (Linnaeus, 1767) in the Caribbean.
Spatial variations among the coral mucus-associated bacterial communities were verified between the sampling sites from the Gulf of Aqaba (Figure 10). The distinct cluster of Industrial Zone samples located in the southern part of the Gulf of Aqaba might be correlated with the higher pollutant levels (e.g., metals [30]). Mesophilobacter sp. (which was isolated exclusively from the Public beach) showed antagonistic activity against 17 multi-drug-resistant pathogens, including bacteria and fungi [56]. The sewage discharge and swimming activities may have been attributed to the presence of this species in the seawater column [57]. The emission of hydrocarbons from touristic boats may be related to the enrichment of Planococcus bacteria. The genus Planococcus has been reported to have the ability of aromatic hydrocarbon degradation with biosurfactants/bioemulsifiers secretion [58]. Remarkably, some species of the genus Photobacterium (Photobacterium rosenbergii) that were cultivated at the Public Beach site are known to be associated with coral bleaching [59]. Similarly, the level of putative pathogenic bacteria Klebsiella was higher in diseased stony corals (Acropora Cytherea (Dana, 1846)) from India [60]. These bacterial species may be originated from swimming activities and sewage discharge at the Public Beach. Some of the common bacterial isolates in the Industrial Zone and Phosphate Berth sites belonged to the species Pseudoalteromonas, which were found to have the ability to convert different forms of aromatic compounds into the corresponding catechol, which, consequently, may be introduced into the bioremediation of chemically contaminated marine environments [61]. The dominance of this bacterial species at these sites might be correlated with oil and aromatic compound contamination. Furthermore, Cytophaga sp. was previously isolated from coral surfaces infected with black band disease [55]. The presence of this species can be related to the effect of coastal industrial activities that discharge at these sites on coral health.
Species from three ubiquitous bacterial genera were presented among the sampling sites (Brevundimonas, Pseudomonas, and Vibrio). The bacterial communities associated with three species of Acropora from Orpheus Island that comprised the greatest portion of the clone libraries belonged to Brevundimonas sp. (4–22%), which are possible candidates for investigation in coral nutrient cycling or the production of antimicrobial properties [62]. Bacteria from the genus Pseudomonas are among the mucus’ core microbiome and constituted the most abundant taxa in the corals from the Red Sea and Persian/Arabian Gulf [63]. Furthermore, Lalucat et al. [64] reported that Pseudomonas is one of the highest taxonomic clusters of known denitrifying bacteria. Pseudomonas sp. are considered to be the most active denitrifying heterotrophic bacteria in the environment, which include metal cycling and the degradation of biogenic and xenobiotic compounds [64]. Interestingly, some coral pathogens belonging to Vibrio, (ex., Vibrio coralliilyticus, a Red Sea pathogen of P. damicornis [65]) increase their efficiency and motility behaviors with rising seawater temperatures [66], and the higher abundance of these microbes among sampling sites may explain the increased prevalence of coral disease post-bleaching [45,67].
Bacterial species-specific associations were noticed between the mucus coral species, such as Cytophaga sp., which was exclusively present in association with P. damicornis mucus. Arboleda and Reichardt [68] demonstrated that diseased P. damicornis was dominated by Cytophaga (Bacteroidota) in the Lingayen Gulf, Philippines. Moreover, bacteria from the genus Pseudomonas were found to be highly associated with the Red Sea coral S. pistillata [69]. Corynebacterium sp. was one of the eight genera with relatively high abundance and was detected in ≥80% samples of S. pistillata during a long-term survey conducted by Yang et al. [70] in Taiwan. Intriguingly, during a study on the influence of species specificity on bacteria associated with the coral S. pistillata in Taiwan, Mei-Jhu et al. [71] found that the largest operational taxonomic unit (OUT) belonged to Bacillus sp. (ex. Bacillus cereus or Bacillus thuringiensis), appearing mainly in winter samples, which was the same sampling period of our study. Overall, the variations in the mucus associated-bacterial communities between the coral species P. damicornis and S. pistillata suggest the different degrees of coral holobiont flexibility. These potentially represent differences in the underlying strategy employed by the two species to cope with environmental stressors [47].
Remarkably, the seawater samples surrounding the corals had a distinct bacterial clustering (Figure 10) characterized by the presence of non-ubiquitous bacteria, including representatives of the Gammaproteobacteria, Actinomycetia, Bacilli, and Fusobacteriia classes. Unlike the results obtained by Osman et al. [72] regarding the stability of microbes in reef-associated seawater affected by anthropogenic development in the Red Sea, we found variations in the bacterial communities among the seawater samples surrounding the corals at the different sites. Intriguingly, the bacterium Marinobacter, which was present exclusively in seawater, was found to be the predominant oil-degrading bacteria in polluted seawater of the Yellow Sea, China [73]. Rajeev et al. [74] noticed that the thermal discharge-impacted coastal areas were overrepresented by several potential pathogenic bacteria (e.g., Acinetobacter) and other native marine bacterial genera (e.g., Marinobacter and Halomonas). Streptobacillus sp., for instance, which was exclusively isolated from seawater samples, was related to seawater disease in farmed Atlantic salmon [75].
Several bacteria from the coral holobiont are known to produce antimicrobial agents for survival and defense purposes. Both coral mucus-associated bacterial samples and coral-surrounding seawater bacterial samples were screened for the presence of antimicrobial activity. Among these, ten isolates (8.3%) showed antimicrobial activity toward at least one ATCC-tested bacteria. This percentage is slightly higher than the previous study that showed that 5.77% of cultivable bacteria isolated from the mucus of Oculina patagonica produced antimicrobial activity [76]. However, isolates from the coral A. palmata showed a higher percentage (20%) of antibiotic producers [11]. This can be related to the assay method, as well as the species and the number of indictor bacterial strains used in screening.
The antimicrobial screening test revealed that high bacterial diversity was able to inhibit the growth of a S. marcescens strain. Many strains of S. marcescens are known as opportunistic pathogens responsible for white pox disease, causing coral tissue necrosis [77]. These pathogenic bacteria colonize the coral mucus layer, utilizing the complex polymers of the mucus as a carbon source [78,79]. Nissimov et al. [76] suggested that the commensal bacteria present in the coral mucus can prevent the complete establishment of S. marcescens by niche occupation or antimicrobial production. These support the hypothesis that the members of the mucus microbiome may support the defense mechanism of corals. The bacteria Vibrio halioticoli and Acinetobacter schindleri showed the highest inhibitive effects against the pathogenic indicator bacteria P. aurgenosa, indicating the production of bioactive materials to inhibit the growth of specific marine microbial competitors [76]. All of the above results suggest that the interactions of the coral holobiont could be diverse and complicated, where different coral bacteria may contribute differently to the protection of the coral from marine pathogens.

5. Conclusions

The findings of this study obviously highlight the variations in bacterial communities among the studied mucus coral samples and among contaminated sampling sites. Habitat specificity was observed among the coral mucus-associated bacterial communities and the surrounding seawater microbes, confirming the compositional variability of microbial communities. The diversity and spatial variations of bacterial communities represented by clustering may reflect the response of bacterial communities to local environmental stressors. Habitat specificity contributes to the overall diversity of microbial communities, highlighting the importance of holistic studies that focus on microbial interactions across the coral reef ecosystem.

Supplementary Materials

The following supporting information can be downloaded at: https://www.mdpi.com/article/10.3390/jmse10070863/s1, Table S1: Sources and level of anthropogenic pressure in the sampling site of the Gulf of Aqaba [29,30,31,32,80,81,82], Table S2: Morphological characterization of mucus bacterial isolates, Table S3: Morphology and characterization of seawater bacteria isolates, Table S4: Biochemical and physiological characterization of bacterial isolates from mucus, Table S5: Biochemical and physiological characterization of bacterial isolates from seawater, Table S6: Phylogeny of bacterial species from coral mucus and surrounding seawater.

Author Contributions

Conceptualization, E.I.H. and H.I.M.; methodology, M.A.T. and F.A.A.-H.; software, M.A.A.A.-r.; validation, M.S.A.Z.; formal analysis, A.-S.F.J.; investigation, M.A.T.; writing—original draft preparation, A.-S.F.J., F.A.A.-H.; writing—review and editing, A.-S.F.J. and J.H.J.; supervision, E.I.H., H.I.M. All authors have read and agreed to the published version of the manuscript.

Funding

This research received no external funding.

Institutional Review Board Statement

Not applicable.

Informed Consent Statement

Not applicable.

Data Availability Statement

Not applicable.

Acknowledgments

This project was done as part of work towards a master student thesis at Department of Biological Sciences, Yarmouk University (Jordan). The authors gratefully acknowledge the divers at the Marine Science Station (MSS) in the Gulf of Aqaba for their technical help.

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. Rix, L.; de Goeij, J.M.; Mueller, C.E.; Struck, U.; Middelburg, J.J.; van Duyl, F.C.; Al-Horani, F.A.; Wild, C.; Naumann, M.S.; van Oevelen, D. Coral mucus fuels the sponge loop in warm- and cold-water coral reef ecosystems. Sci. Rep. 2016, 6, 18715. [Google Scholar] [CrossRef] [PubMed]
  2. Frias-Lopez, J.; Klaus, J.S.; Bonheyo, G.T.; Fouke, B.W. Bacterial community associated with black band disease in corals. Appl. Environ. Microbiol. 2004, 70, 5955–5962. [Google Scholar] [CrossRef] [PubMed]
  3. Burke, L.; Maidens, J. Reefs at Risk in the Caribbean; World Resources Institute: Washington, DC, USA, 2004. [Google Scholar]
  4. Rohwer, F.; Seguritan, V.; Azam, F. Diversity and distribution of coral-associated bacteria. Mar. Ecol. Prog. Ser. 2002, 243, 1–10. [Google Scholar] [CrossRef]
  5. Bourne, D.G.; Munn, C.B. Diversity of bacteria associated with the coral Pocillopora damicornis from the Great Barrier Reef. Environ. Microbiol. 2005, 7, 1162–1174. [Google Scholar] [CrossRef]
  6. Bourne, D.G.; Morrow, K.M.; Webster, N.S. Insights into the Coral Microbiome: Underpinning the Health and Resilience of Reef Ecosystems. Annu. Rev. Microbiol. 2016, 70, 317–340. [Google Scholar] [CrossRef]
  7. Peixoto, R.S.; Rosado, P.M.; Leite, D.C.D.A.; Rosado, A.; Bourne, D.G. Beneficial Microorganisms for Corals (BMC): Proposed Mechanisms for Coral Health and Resilience. Front. Microbiol. 2017, 8, 341. [Google Scholar] [CrossRef]
  8. Kimes, N.E.; Van Nostrand, J.D.; Weil, E.; Zhou, J.; Morris, P.J. Microbial functional structure of Montastraea faveolata, an important Caribbean reef-building coral, differs between healthy and yellow-band diseased colonies. Environ. Microbiol. 2010, 12, 541–556. [Google Scholar] [CrossRef]
  9. Raina, J.-B.; Tapiolas, D.; Willis, B.L.; Bourne, D.G. Coral-Associated Bacteria and Their Role in the Biogeochemical Cycling of Sulfur. Appl. Environ. Microbiol. 2009, 75, 3492–3501. [Google Scholar] [CrossRef]
  10. Zhang, Y.; Ling, J.; Yang, Q.; Wen, C.; Yan, Q.; Sun, H.; Van Nostrand, J.D.; Shi, Z.; Zhou, J.; Dong, J. The functional gene composition and metabolic potential of coral-associated microbial communities. Sci. Rep. 2015, 5, 16191. [Google Scholar] [CrossRef]
  11. Ritchie, K. No TiRegulation of microbial populations by coral surface mucus and mucus-associated bacteriatle. Mar. Ecol. Prog. Ser. 2006, 322, 1–14. [Google Scholar] [CrossRef]
  12. Welsh, R.M.; Zaneveld, J.R.; Rosales, S.M.; Payet, J.P.; Burkepile, D.E.; Thurber, R.V. Bacterial predation in a marine host-associated microbiome. ISME J. 2016, 10, 1540–1544. [Google Scholar] [CrossRef]
  13. Jessen, C.; Villa Lizcano, J.F.; Bayer, T.; Roder, C.; Aranda, M.; Wild, C.; Voolstra, C.R. In-situ Effects of Eutrophication and Overfishing on Physiology and Bacterial Diversity of the Red Sea Coral Acropora hemprichii. PLoS ONE 2013, 8, e62091. [Google Scholar] [CrossRef]
  14. Bruno, J.F.; Petes, L.E.; Drew Harvell, C.; Hettinger, A. Nutrient enrichment can increase the severity of coral diseases. Ecol. Lett. 2003, 6, 1056–1061. [Google Scholar] [CrossRef]
  15. Vega Thurber, R.L.; Burkepile, D.E.; Fuchs, C.; Shantz, A.A.; McMinds, R.; Zaneveld, J.R. Chronic nutrient enrichment increases prevalence and severity of coral disease and bleaching. Glob. Chang. Biol. 2014, 20, 544–554. [Google Scholar] [CrossRef]
  16. Smith, J.E.; Shaw, M.; Edwards, R.A.; Obura, D.; Pantos, O.; Sala, E.; Sandin, S.A.; Smriga, S.; Hatay, M.; Rohwer, F.L. Indirect effects of algae on coral: Algae-mediated, microbe-induced coral mortality. Ecol. Lett. 2006, 9, 835–845. [Google Scholar] [CrossRef]
  17. Fabricius, K.E. Effects of terrestrial runoff on the ecology of corals and coral reefs: Review and synthesis. Mar. Pollut. Bull. 2005, 50, 125–146. [Google Scholar] [CrossRef]
  18. Lamb, J.B.; Williamson, D.H.; Russ, G.R.; Willis, B.L. Protected areas mitigate diseases of reef-building corals by reducing damage from fishing. Ecology 2015, 96, 2555–2567. [Google Scholar] [CrossRef]
  19. Wear, S.L.; Thurber, R.V. Sewage pollution: Mitigation is key for coral reef stewardship. Ann. N. Y. Acad. Sci. 2015, 1355, 15–30. [Google Scholar] [CrossRef]
  20. Paulino, G.V.B.; Broetto, L.; Pylro, V.S.; Landell, M.F. Compositional shifts in bacterial communities associated with the coral Palythoa caribaeorum due to anthropogenic effects. Mar. Pollut. Bull. 2017, 114, 1024–1030. [Google Scholar] [CrossRef]
  21. Shore, A.; Day, R.D.; Stewart, J.A.; Burge, C.A. Dichotomy between Regulation of Coral Bacterial Communities and Calcification Physiology under Ocean Acidification Conditions. Appl. Environ. Microbiol. 2022, 87, e02189-20. [Google Scholar] [CrossRef]
  22. McDevitt-Irwin, J.M.; Baum, J.K.; Garren, M.; Vega Thurber, R.L. Responses of Coral-Associated Bacterial Communities to Local and Global Stressors. Front. Mar. Sci. 2017, 4, 262. [Google Scholar] [CrossRef]
  23. Engel, S.; Jensen, P.R.; Fenical, W. Chemical Ecology of Marine Microbial Defense. J. Chem. Ecol. 2002, 28, 1971–1985. [Google Scholar] [CrossRef] [PubMed]
  24. Brown, B.E. Perspectives on mucus secretion in reef corals. Mar. Ecol. Prog. Ser. 2005, 296, 291–309. [Google Scholar] [CrossRef]
  25. Raina, J.-B.; Tapiolas, D.; Motti, C.A.; Foret, S.; Seemann, T.; Tebben, J.; Willis, B.L.; Bourne, D.G. Isolation of an antimicrobial compound produced by bacteria associated with reef-building corals. PeerJ 2016, 4, e2275. [Google Scholar] [CrossRef]
  26. Rivera-Ortega, J.; Thomé, P.E. Contrasting Antibacterial Capabilities of the Surface Mucus Layer From Three Symbiotic Cnidarians. Front. Mar. Sci. 2018, 5, 392. [Google Scholar] [CrossRef]
  27. Castillo, I.; Lodeiros, C.; Núñez, M.; Campos, I. In vitro evaluation of antibacterial substances produced by bacteria isolated from different marine organisms. Rev. Biol. Trop. 2001, 49, 1213–1222. [Google Scholar]
  28. Nithyanand, P.; Pandian, S.K. Phylogenetic characterization of culturable bacterial diversity associated with the mucus and tissue of the coral Acropora digitifera from the Gulf of Mannar. FEMS Microbiol. Ecol. 2009, 69, 384–394. [Google Scholar] [CrossRef]
  29. Al-Horani, F.A.; Al-Rousan, S.A.; Al-Zibdeh, M.; Khalaf, M.A. The status of coral reefs on the Jordanian coast of the Gulf of Aqaba, Red Sea. Zool. Middle East 2006, 38, 99–110. [Google Scholar] [CrossRef]
  30. Al-Taani, A.A.; Rashdan, M.; Nazzal, Y.; Howari, F.; Iqbal, J.; Al-Rawabdeh, A.; Al Bsoul, A.; Khashashneh, S. Evaluation of the Gulf of Aqaba Coastal Water, Jordan. Water 2020, 12, 2125. [Google Scholar] [CrossRef]
  31. Wahsha, M.; Juhmani, A.-S.; Buosi, A.; Sfriso, A.; Sfriso, A. Assess the environmental health status of macrophyte ecosystems using an oxidative stress biomarker. Case studies: The Gulf of Aqaba and the Lagoon of Venice. Energy Procedia 2017, 125, 19–26. [Google Scholar] [CrossRef]
  32. Al-Halasah, N.; Ammary, B.Y. Potential Risk And Control of Contamination in The Gulf of Aqaba-Jordan BT—Managing Critical Infrastructure Risks; Linkov, I., Wenning, R.J., Kiker, G.A., Eds.; Springer Netherlands: Dordrecht, The Netherlands, 2007; pp. 435–444. [Google Scholar]
  33. Koren, O.; Rosenberg, E. Bacteria associated with the bleached and cave coral Oculina patagonica. Microb. Ecol. 2008, 55, 523–529. [Google Scholar] [CrossRef]
  34. Omry, K.; Eugene, R. Bacteria Associated with Mucus and Tissues of the Coral Oculina patagonica in Summer and Winter. Appl. Environ. Microbiol. 2006, 72, 5254–5259. [Google Scholar] [CrossRef]
  35. Lampert, Y.; Kelman, D.; Dubinsky, Z.; Nitzan, Y.; Hill, R.T. Diversity of culturable bacteria in the mucus of the Red Sea coral Fungia scutaria. FEMS Microbiol. Ecol. 2006, 58, 99–108. [Google Scholar] [CrossRef]
  36. Holt, J.G.; Krieg, N.R.; Sneath, P.H.A.; Stanley, J.T.; William, S.T. Bergey’s Manual of Determinative Bacteriology; Williams and Wilikins, Ed.; Williams & Wilkins: Baltimore, MD, USA, 1994. [Google Scholar]
  37. Garrity, G.M.; Brenner, J.G.; Krieg, N.R.; Staley, J.R.; Manual, B.S. The road map to the manual. In Bergey’s Manual of Systemic Bacteriology, 2nd ed.; Garrity, G.M., Ed.; Springer: New York, NY, USA, 2001; pp. 119–166. [Google Scholar]
  38. Morgulis, A.; Coulouris, G.; Raytselis, Y.; Madden, T.L.; Agarwala, R.; Schäffer, A.A. Database indexing for production MegaBLAST searches. Bioinformatics 2008, 24, 1757–1764. [Google Scholar] [CrossRef]
  39. Tamura, K.; Stecher, G.; Kumar, S. MEGA11: Molecular Evolutionary Genetics Analysis Version 11. Mol. Biol. Evol. 2021, 38, 3022–3027. [Google Scholar] [CrossRef]
  40. Thompson, J.D.; Gibson, T.J.; Plewniak, F.; Jeanmougin, F.; Higgins, D.G. The CLUSTAL_X Windows Interface: Flexible Strategies for Multiple Sequence Alignment Aided by Quality Analysis Tools. Nucleic Acids Res. 1997, 25, 4876–4882. [Google Scholar] [CrossRef]
  41. Heindl, H.; Wiese, J.; Thiel, V.; Imhoff, J.F. Phylogenetic diversity and antimicrobial activities of bryozoan-associated bacteria isolated from Mediterranean and Baltic Sea habitats. Syst. Appl. Microbiol. 2010, 33, 94–104. [Google Scholar] [CrossRef]
  42. Hammer, Ø.; Harper, D.A.T.; Ryan, P.D. PAST: Paleontological statistics software package for education and data analysis. Palaeontol. Electron. 2001, 4, 9. [Google Scholar]
  43. Oliveros, J.C.; (2007–2015) Venny. An interactive Tool for Comparing Lists with Venn’s Diagrams. Available online: https://bioinfogp.cnb.csic.es/tools/venny/index.html (accessed on 5 May 2022).
  44. Clarke, K.R.; Gorley, R.N. PRIMER v6: User Manual/Tutorial (Plymouth Routines in Multivariate Ecological Research); PRIMER-E: Plymouth, UK, 2006. [Google Scholar]
  45. Al-Karablieh, N.; Al-Horani, F.A.; Alnaimat, S.; Abu Zarga, M.H. Prevalence of Vibrio coralliilyticus in stony coral Porites sp. in the Gulf of Aqaba, Jordan. Lett. Appl. Microbiol. 2022. [Google Scholar] [CrossRef]
  46. Hussien, E.; Juhmani, A.-S.; AlMasri, R.; Al-Horani, F.; Al-Saghir, M. Metagenomic analysis of microbial community associated with coral mucus from the Gulf of Aqaba. Heliyon 2019, 5, e02876. [Google Scholar] [CrossRef]
  47. Ziegler, M.; Grupstra, C.G.B.; Barreto, M.M.; Eaton, M.; BaOmar, J.; Zubier, K.; Al-Sofyani, A.; Turki, A.J.; Ormond, R.; Voolstra, C.R. Coral bacterial community structure responds to environmental change in a host-specific manner. Nat. Commun. 2019, 10, 3092. [Google Scholar] [CrossRef]
  48. Jaber, F. Identification and Characterization and Seasonality of Bacterial Communities Associated with Coral Reef in the Gulf of Aqaba—Jordan; Yarmouk University: Irbid, Jordan, 2012. [Google Scholar]
  49. Klaus, J.S.; Janse, I.; Heikoop, J.M.; Sanford, R.A.; Fouke, B.W. Coral microbial communities, zooxanthellae and mucus along gradients of seawater depth and coastal pollution. Environ. Microbiol. 2007, 9, 1291–1305. [Google Scholar] [CrossRef]
  50. Roik, A.; Röthig, T.; Roder, C.; Ziegler, M.; Kremb, S.G.; Voolstra, C.R. Year-Long Monitoring of Physico-Chemical and Biological Variables Provide a Comparative Baseline of Coral Reef Functioning in the Central Red Sea. PLoS ONE 2016, 11, e0163939. [Google Scholar] [CrossRef]
  51. Pereira, L.B.; Palermo, B.R.Z.; Carlos, C.; Ottoboni, L.M.M. Diversity and antimicrobial activity of bacteria isolated from different Brazilian coral species. FEMS Microbiol. Lett. 2017, 364, fnx164. [Google Scholar] [CrossRef]
  52. Rypien, K.L.; Ward, J.R.; Azam, F. Antagonistic interactions among coral-associated bacteria. Environ. Microbiol. 2010, 12, 28–39. [Google Scholar] [CrossRef]
  53. Brown, B.E. Coral bleaching: Causes and consequences. Coral Reefs 1997, 16, S129–S138. [Google Scholar] [CrossRef]
  54. Kooperman, N.; Ben-Dov, E.; Kramarsky-Winter, E.; Barak, Z.; Kushmaro, A. Coral mucus-associated bacterial communities from natural and aquarium environments. FEMS Microbiol. Lett. 2007, 276, 106–113. [Google Scholar] [CrossRef]
  55. Frias-Lopez, J.; Zerkle, A.; Bonheyo, G.; Fouke, B.W. Partitioning of Bacterial Communities between Seawater and Healthy, Black Band Diseased, and Dead Coral Surfaces. Appl. Environ. Microbiol. 2002, 68, 2214–2228. [Google Scholar] [CrossRef]
  56. Madeswaran, P. Seasonal and spatial distribution of heterotrophic bacteria in relation to physico-chemical properties along Ennore coastal waters. Indian J. Mar. Geo Sci. 2018, 47, 587–597. [Google Scholar]
  57. Michalska, M.; Zorena, K.; Marks, R.; Wąż, P. The emergency discharge of sewage to the Bay of Gdańsk as a source of bacterial enrichment in coastal air. Sci. Rep. 2021, 11, 20959. [Google Scholar] [CrossRef]
  58. Labuzek, S.; Hupert-Kocurek, K.T.; Skurnik, M. Isolation and characterisation of new Planococcus sp. strain able for aromatic hydrocarbons degradation. Acta Microbiol. Pol. 2003, 52, 395–404. [Google Scholar] [PubMed]
  59. Thompson, F.L.; Thompson, C.C.; Naser, S.; Hoste, B.; Vandemeulebroecke, K.; Munn, C.; Bourne, D.; Swings, J. Photobacterium rosenbergii sp. nov. and Enterovibrio coralii sp. nov., vibrios associated with coral bleaching. Int. J. Syst. Evol. Microbiol. 2005, 55, 913–917. [Google Scholar] [CrossRef] [PubMed]
  60. Rajasabapathy, R.; Ramasamy, K.P.; Manikandan, B.; Mohandass, C.; Arthur James, R. Bacterial Communities Associated With Healthy and Diseased (Skeletal Growth Anomaly) Reef Coral Acropora cytherea From Palk Bay, India. Front. Mar. Sci. 2020, 7. [Google Scholar] [CrossRef]
  61. Parrilli, E.; Papa, R.; Tutino, M.L.; Sannia, G. Engineering of a psychrophilic bacterium for the bioremediation of aromatic compounds. Bioeng. Bugs 2010, 1, 213–216. [Google Scholar] [CrossRef]
  62. Littman, R.A.; Willis, B.L.; Pfeffer, C.; Bourne, D.G. Diversities of coral-associated bacteria differ with location, but not species, for three acroporid corals on the Great Barrier Reef. FEMS Microbiol. Ecol. 2009, 68, 152–163. [Google Scholar] [CrossRef]
  63. Hadaidi, G.; Röthig, T.; Yum, L.K.; Ziegler, M.; Arif, C.; Roder, C.; Burt, J.; Voolstra, C.R. Stable mucus-associated bacterial communities in bleached and healthy corals of Porites lobata from the Arabian Seas. Sci. Rep. 2017, 7, 45362. [Google Scholar] [CrossRef]
  64. Lalucat, J.; Bennasar, A.; Bosch, R.; García-Valdés, E.; Palleroni, N.J. Biology of Pseudomonas stutzeri. Microbiol. Mol. Biol. Rev. 2006, 70, 510–547. [Google Scholar] [CrossRef]
  65. Yael, B.-H.; Maya, Z.-K.; Eugene, R. Temperature-Regulated Bleaching and Lysis of the Coral Pocillopora damicornis by the Novel Pathogen Vibrio coralliilyticus. Appl. Environ. Microbiol. 2003, 69, 4236–4242. [Google Scholar] [CrossRef]
  66. Garren, M.; Son, K.; Tout, J.; Seymour, J.R.; Stocker, R. Temperature-induced behavioral switches in a bacterial coral pathogen. ISME J. 2016, 10, 1363–1372. [Google Scholar] [CrossRef]
  67. Muller, E.M.; Rogers, C.S.; Spitzack, A.S.; van Woesik, R. Bleaching increases likelihood of disease on Acropora palmata (Lamarck) in Hawksnest Bay, St John, US Virgin Islands. Coral Reefs 2008, 27, 191–195. [Google Scholar] [CrossRef]
  68. Arboleda, M.; Reichardt, W. Epizoic communities of prokaryotes on healthy and diseased scleractinian corals in Lingayen Gulf, Philippines. Microb. Ecol. 2009, 57, 117–128. [Google Scholar] [CrossRef]
  69. Bayer, T.; Neave, M.J.; Alsheikh-Hussain, A.; Aranda, M.; Yum, L.K.; Mincer, T.; Hughen, K.; Apprill, A.; Voolstra, C.R. The Microbiome of the Red Sea Coral Stylophora pistillata Is Dominated by Tissue-Associated Endozoicomonas Bacteria. Appl. Environ. Microbiol. 2013, 79, 4759–4762. [Google Scholar] [CrossRef]
  70. Yang, S.-H.; Tseng, C.-H.; Huang, C.-R.; Chen, C.-P.; Tandon, K.; Lee, S.T.M.; Chiang, P.-W.; Shiu, J.-H.; Chen, C.A.; Tang, S.-L. Long-Term Survey Is Necessary to Reveal Various Shifts of Microbial Composition in Corals. Front. Microbiol. 2017, 8, 1094. [Google Scholar] [CrossRef]
  71. Hong, M.-J.; Yu, Y.-T.; Chen, C.A.; Chiang, P.-W.; Tang, S.-L. Influence of Species Specificity and Other Factors on Bacteria Associated with the Coral Stylophora pistillata in Taiwan. Appl. Environ. Microbiol. 2009, 75, 7797–7806. [Google Scholar] [CrossRef]
  72. Osman, E.O.; Suggett, D.J.; Voolstra, C.R.; Pettay, D.T.; Clark, D.R.; Pogoreutz, C.; Sampayo, E.M.; Warner, M.E.; Smith, D.J. Coral microbiome composition along the northern Red Sea suggests high plasticity of bacterial and specificity of endosymbiotic dinoflagellate communities. Microbiome 2020, 8, 8. [Google Scholar] [CrossRef]
  73. Wang, W.; Zhong, R.; Shan, D.; Shao, Z. Indigenous oil-degrading bacteria in crude oil-contaminated seawater of the Yellow sea, China. Appl. Microbiol. Biotechnol. 2014, 98, 7253–7269. [Google Scholar] [CrossRef]
  74. Rajeev, M.; Sushmitha, T.J.; Aravindraja, C.; Toleti, S.R.; Pandian, S.K. Thermal discharge-induced seawater warming alters richness, community composition and interactions of bacterioplankton assemblages in a coastal ecosystem. Sci. Rep. 2021, 11, 17341. [Google Scholar] [CrossRef]
  75. Maher, M.; Palmer, R.; Gannon, F.; Smith, T. Relationship of a Novel Bacterial Fish Pathogen to Streptobacillus moniliformis and the Fusobacteria Group, based on 16S Ribosomal RNA Analysis. Syst. Appl. Microbiol. 1995, 18, 79–84. [Google Scholar] [CrossRef]
  76. Nissimov, J.; Rosenberg, E.; Munn, C.B. Antimicrobial properties of resident coral mucus bacteria of Oculina patagonica. FEMS Microbiol. Lett. 2009, 292, 210–215. [Google Scholar] [CrossRef]
  77. Renzi, J.; Shaver, E.; Burkepile, D.; Silliman, B. The etiology of white pox, a lethal disease of the Caribbean elkhorn coral, Acropora palmata. Proc. Natl. Acad. Sci. USA 2002, 99, 8725–8730. [Google Scholar] [CrossRef]
  78. Krediet, C.J.; Ritchie, K.B.; Cohen, M.; Lipp, E.K.; Sutherland, K.P.; Teplitski, M. Utilization of mucus from the coral Acropora palmata by the pathogen Serratia marcescens and by environmental and coral commensal bacteria. Appl. Environ. Microbiol. 2009, 75, 3851–3858. [Google Scholar] [CrossRef]
  79. Krediet, C.J.; Ritchie, K.B.; Paul, V.J.; Teplitski, M. Coral-associated micro-organisms and their roles in promoting coral health and thwarting diseases. Proc. Biol. Sci. 2013, 280, 20122328. [Google Scholar] [CrossRef]
  80. Al-Absi, E.; Manasrah, R.; Wahsha, M.; Al-Makahleh, M. Radionuclides levels in marine sediment and seagrass in the northern Gulf of Aqaba, Red Sea. Fresenius Environ. Bull. 2016, 25, 3461–3474. [Google Scholar]
  81. Al-Zibdah, M.; Damhoureyeh, S. Spatial and Temporal Distribution of Macroalgae Along the Jordanian Coast of the Gulf of Aqaba, Red Sea. Dirasat 2006, 33, 35–47. [Google Scholar]
  82. Al-Rousan, S.; Al-Shloul, R.; Al-Horani, F.; Abu-Hilal, A. Heavy metal contents in growth bands of Porites corals: Record of anthropogenic and human developments from the Jordanian Gulf of Aqaba. Mar. Pollut. Bull. 2007, 54, 1912–1922. [Google Scholar] [CrossRef] [PubMed]
Figure 1. Sample sites in the Gulf of Aqaba (Jordan) (I.Z: Industrial Zone, P. Beach: Public Beach, and P. Berth: Phosphate Berth).
Figure 1. Sample sites in the Gulf of Aqaba (Jordan) (I.Z: Industrial Zone, P. Beach: Public Beach, and P. Berth: Phosphate Berth).
Jmse 10 00863 g001
Figure 2. Viable bacterial count associated with the mucus of P. damicornis and S. pistillata expressed in colony-forming units per mL (CFU/mL). (I.Z: Industrial Zone, P. Beach: Public Beach, P. Berth: Phosphate Berth).
Figure 2. Viable bacterial count associated with the mucus of P. damicornis and S. pistillata expressed in colony-forming units per mL (CFU/mL). (I.Z: Industrial Zone, P. Beach: Public Beach, P. Berth: Phosphate Berth).
Jmse 10 00863 g002
Figure 3. Viable bacterial counts of seawater surrounding P. damicornis and S. pistillata expressed in colony-forming units per mL (CFU/mL). (I.Z: Industrial Zones, P. Beach: Public Beach, P. Berth: Phosphate Berth).
Figure 3. Viable bacterial counts of seawater surrounding P. damicornis and S. pistillata expressed in colony-forming units per mL (CFU/mL). (I.Z: Industrial Zones, P. Beach: Public Beach, P. Berth: Phosphate Berth).
Jmse 10 00863 g003
Figure 4. Proportion of coral (P. damicornis) mucus bacterial isolates based on the biochemical approach (A: Actinomycetia; C: Cytophagia; and G: Gammaproteobacteria).
Figure 4. Proportion of coral (P. damicornis) mucus bacterial isolates based on the biochemical approach (A: Actinomycetia; C: Cytophagia; and G: Gammaproteobacteria).
Jmse 10 00863 g004
Figure 5. Proportion of bacterial isolates in coral (S. pistillata) mucus based on a biochemical approach (A: Actinomycetia; B: Bacilli; AP: Alphaproteobacteria; C: Cytophagia; G: Gammaproteobacteria).
Figure 5. Proportion of bacterial isolates in coral (S. pistillata) mucus based on a biochemical approach (A: Actinomycetia; B: Bacilli; AP: Alphaproteobacteria; C: Cytophagia; G: Gammaproteobacteria).
Jmse 10 00863 g005
Figure 6. Number of bacterial isolates in seawater surrounding coral based on a biochemical approach.
Figure 6. Number of bacterial isolates in seawater surrounding coral based on a biochemical approach.
Jmse 10 00863 g006
Figure 7. Phylogenetic tree for bacterial species associated with P. damicornis mucus and the surrounding seawater. Phylogenetic analyses were conducted in MEGA11. There were a total of 2303 positions in the final dataset. A: Industrial Zones, B: Public Beach, C: Phosphate Berth, P: P. damicornis, m: mucus, w: seawater.
Figure 7. Phylogenetic tree for bacterial species associated with P. damicornis mucus and the surrounding seawater. Phylogenetic analyses were conducted in MEGA11. There were a total of 2303 positions in the final dataset. A: Industrial Zones, B: Public Beach, C: Phosphate Berth, P: P. damicornis, m: mucus, w: seawater.
Jmse 10 00863 g007
Figure 8. Phylogenetic tree for bacterial species associated with S. pistillata mucus and the surrounding seawater. Phylogenetic analyses were conducted in MEGA11. There were a total of 1739 positions in the final dataset. A: Industrial Zone, B: Public Beach, C: Phosphate Berth, S: S. pistillata, m: mucus, w: seawater.
Figure 8. Phylogenetic tree for bacterial species associated with S. pistillata mucus and the surrounding seawater. Phylogenetic analyses were conducted in MEGA11. There were a total of 1739 positions in the final dataset. A: Industrial Zone, B: Public Beach, C: Phosphate Berth, S: S. pistillata, m: mucus, w: seawater.
Jmse 10 00863 g008
Figure 9. Distribution of shared and non-ubiquitous bacterial isolates (a) between coral species, (b) between sampling sites, and (c) between seawater and coral mucus.
Figure 9. Distribution of shared and non-ubiquitous bacterial isolates (a) between coral species, (b) between sampling sites, and (c) between seawater and coral mucus.
Jmse 10 00863 g009
Figure 10. Principal coordinates analysis plot (PCoA) based on a Euclidean distance matrix calculated of the mucus bacterial community and the surrounding seawater. (Brown marks represent coral mucus samples and blue marks represent seawater samples) [X: Industrial zone samples, ■: Public Beach samples, ∆: Phosphate Berth samples].
Figure 10. Principal coordinates analysis plot (PCoA) based on a Euclidean distance matrix calculated of the mucus bacterial community and the surrounding seawater. (Brown marks represent coral mucus samples and blue marks represent seawater samples) [X: Industrial zone samples, ■: Public Beach samples, ∆: Phosphate Berth samples].
Jmse 10 00863 g010
Table 1. Identification of coral mucus-associated bacterial isolates based on 16S rRNA gene identity.
Table 1. Identification of coral mucus-associated bacterial isolates based on 16S rRNA gene identity.
SampleSiteClosest Match in GenBank% IdentityAccession Number
P. damicornisAPm25I.ZPseudoalteromonas sp. strain 70410 97.8KX833144.1
APm32Pseudoalteromonas sp. strain 7036797.7KX889955.1
BPm9P. BeachPsychrobacter celer strain Mcap_H298.6KP640590.1
BPm21Pseudoalteromonas sp. strain 70607 96.9KY272021.1
CPm6P. BerthPsychrobacter celer strain 3297.2FJ613610.1
CPm13Pseudoalteromonas sp. strain 70004 98.0MF061257.1
CPm48Cellulophaga lytica strain IMCC34136 96.7MG456766.1
S. pistillataASm14I.ZPseudoalteromonas sp. strain NBTE-X3 97.7MW709811.1
ASm17Vibrio sp. strain 201705CJKOP-47 96.8MG309360.1
BSm20P. BeachVibrio sp. Mj76 96.0GQ455012.1
BSm24Vibrio halioticoli strain Msp2-197.9MK334316.1
BSm36Bacillus sp. MML399.0JX847617.1
CSm16P. BerthAgarivorans sp. VibC-Oc-065 98.0KF577091.1
CSm18Psychrobacter celer strain 3297.1FJ613610.1
CSm34Psychrobacter sp. strain 201705CJKOP-10496.0MG309417.1
CSm37Shewanella fidelis strain 3313 98.0KY696838.1
CSm38Shewanella sp. strain MH6 97.6MN049712.1
I.Z: Industrial Zone, P. Beach: Public Beach, P. Berth: Phosphate Berth.
Table 2. Identification of bacterial isolates from seawater surrounding coral based on 16S rRNA gene identity.
Table 2. Identification of bacterial isolates from seawater surrounding coral based on 16S rRNA gene identity.
SampleSiteClosest Match in GenBank% IdentityAccession Number
P. damicornisAPw2I.ZMarinomonas aquiplantarum strain IVIA-Po-18396.0EU188446.1
APw5Bacillus thuringiensis isolate PG05 98.0EU161995.1
BPw9P. BeachAcinetobacter schindleri strain LUH5832 95.7MG581287.1
CPw2P. BerthPsychrobacter marincola strain MTa2-2-198.4MW675164.1
CPw5 Bacillus cereus isolate PGO6 97.9EU161996.1
CPw8Bacillus firmus strain C2196.1MT457439.1
CPw4Halomonas venusta strain 009998.3KP236234.1
S. pistillataASw1I.ZBacillus cereus strain CC2H2P97.9KX424371.1
ASw8Bacillus oceanisediminis strain SH-6397.5KX959969.1
BSw5P. BeachHalomonas venusta strain 009998.3KP236234.1
BSw2Marinovum algicola strain ROA15098.4MW965560.1
BSw9Vibrio chagasii strain 3-7 97.8MN938232.1
BSw11Shewanella fidelis strain S84197.0MK452729.1
CSw8P.BerthBacillus horikoshii strain M2-197.7KF358263.1
I.Z: Industrial Zone, P. Beach: Public Beach, P. Berth: Phosphate Berth.
Table 3. Antibacterial activity of isolated strains from the coral mucus and the surrounding seawater.
Table 3. Antibacterial activity of isolated strains from the coral mucus and the surrounding seawater.
Mucus Seawater
ASm14BPm21BSm24BSm36CSm16APw2ASw8BPw9CPw3CPw4
S. marcescens7.4
(1.3) *
8.0
(1.1)
-6.2
(1.4)
16.2
(2.2) *
9.1
(1.5)
-19.4
(1.6)
--
P. aurgenosa--24.1
(3.2)
-23.4
(2.1) *
--25.0
(3.6)
--
S. aureus9.3
(1.2) *
-----15.0
(2.2)
20.2
(2.3)
20.6
(2.1)
-
M. luteus---------17.4
(2.5)
* Isolate grown in media for 72 h; all other isolates grown in marine broth for 48 h.; - Zone of inhibition (mm (SD)).
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Share and Cite

MDPI and ACS Style

Hussein, E.I.; Juhmani, A.-S.F.; Jacob, J.H.; Telfah, M.A.; Abd Al-razaq, M.A.; Al-Horani, F.A.; Al Zoubi, M.S.; Malkawi, H.I. Effect of Various Local Anthropogenic Impacts on the Diversity of Coral Mucus-Associated Bacterial Communities. J. Mar. Sci. Eng. 2022, 10, 863. https://doi.org/10.3390/jmse10070863

AMA Style

Hussein EI, Juhmani A-SF, Jacob JH, Telfah MA, Abd Al-razaq MA, Al-Horani FA, Al Zoubi MS, Malkawi HI. Effect of Various Local Anthropogenic Impacts on the Diversity of Coral Mucus-Associated Bacterial Communities. Journal of Marine Science and Engineering. 2022; 10(7):863. https://doi.org/10.3390/jmse10070863

Chicago/Turabian Style

Hussein, Emad I., Abdul-Salam F. Juhmani, Jacob H. Jacob, Mahmoud A. Telfah, Mutaz A. Abd Al-razaq, Fuad A. Al-Horani, Mazhar Salim Al Zoubi, and Hanan I. Malkawi. 2022. "Effect of Various Local Anthropogenic Impacts on the Diversity of Coral Mucus-Associated Bacterial Communities" Journal of Marine Science and Engineering 10, no. 7: 863. https://doi.org/10.3390/jmse10070863

APA Style

Hussein, E. I., Juhmani, A.-S. F., Jacob, J. H., Telfah, M. A., Abd Al-razaq, M. A., Al-Horani, F. A., Al Zoubi, M. S., & Malkawi, H. I. (2022). Effect of Various Local Anthropogenic Impacts on the Diversity of Coral Mucus-Associated Bacterial Communities. Journal of Marine Science and Engineering, 10(7), 863. https://doi.org/10.3390/jmse10070863

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop