The Impact Aerobic and Anaerobic Incubations of Poultry Litter Have on Class 1 Integron Resistome and Microbiome
Abstract
1. Introduction
2. Materials and Methods
2.1. Bench Scale Aerobic and Anaerobic Treatment of Poultry Litter
2.2. DNA Extraction and qPCR
2.3. The 16 S Amplicon Metagenomic Sequencing
2.4. Bioinformatics
2.5. Statistical Analyses
3. Results
3.1. Impact of Poultry Litter Incubation Processes on Class 1 Integron and Abundance of Associated Antimicrobial Resistance Genes aadA1 and sul1
3.2. Changes in Class 1 Integron-Associated Antibiotic Resistance Genes aadA1 and sul1 Reflect Alterations in Bacterial Community Composition in Response to Litter Incubation Conditions
3.3. Poultry Litter Maintains Its Nutrient Concentration as a Soil Amendment Under Various Incubation Conditions
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Data Availability Statement
Conflicts of Interest
References
- Nandi, S.; Maurer, J.J.; Hofacre, C.; Summers, A.O. Gram-positive bacteria are a major reservoir of Class 1 antibiotic resistance integrons in poultry litter. Proc. Natl. Acad. Sci. USA 2004, 101, 7118–7122. [Google Scholar] [CrossRef]
- King, G.M.; Brooks, J.P.; Brown, S.; Gerba, C.; O’Connor, G.A.; Pepper, I.L. Land Application of Organic Residuals: Public Health Threat or Environmental Benefit; American Society for Microbiology: Washington, DC, USA, 2011. [Google Scholar]
- Hutchison, M.L.; Walters, L.D.; Avery, S.M.; Munro, F.; Moore, A. Analyses of livestock production, waste storage, and pathogen levels and prevalences in farm manures. Appl. Environ. Microbiol. 2005, 71, 1231–1236. [Google Scholar] [CrossRef]
- Pornsukarom, S.; Thakur, S. Horizontal Dissemination of Antimicrobial Resistance Determinants in Multiple Salmonella Serotypes following Isolation from the Commercial Swine Operation Environment after Manure Application. Appl. Environ. Microbiol. 2017, 83, e01503-17. [Google Scholar] [CrossRef]
- Bennett, S.D.; Sodha, S.V.; Ayers, T.L.; Lynch, M.F.; Gould, L.H.; Tauxe, R.V. Produce-associated foodborne disease outbreaks, USA, 1998–2013. Epidemiol Infect 2018, 146, 1397–1406. [Google Scholar] [CrossRef]
- Carstens, C.K.; Salazar, J.K.; Darkoh, C. Multistate Outbreaks of Foodborne Illness in the United States Associated With Fresh Produce From 2010 to 2017. Front. Microbiol. 2019, 10, 2667. [Google Scholar] [CrossRef]
- Sivapalasingam, S.; Friedman, C.R.; Cohen, L.; Tauxe, R.V. Fresh produce: A growing cause of outbreaks of foodborne illness in the United States, 1973 through 1997. J. Food Prot. 2004, 67, 2342–2353. [Google Scholar] [CrossRef]
- Luna, S.; Krishnasamy, V.; Saw, L.; Smith, L.; Wagner, J.; Weigand, J.; Tewell, M.; Kellis, M.; Penev, R.; McCullough, L.; et al. Outbreak of E. coli O157:H7 Infections Associated with Exposure to Animal Manure in a Rural Community—Arizona and Utah, June–July 2017. MMWR Morb. Mortal. Wkly Rep. 2018, 67, 659–662. [Google Scholar] [CrossRef]
- Bottichio, L.; Keaton, A.; Thomas, D.; Fulton, T.; Tiffany, A.; Frick, A.; Mattioli, M.; Kahler, A.; Murphy, J.; Otto, M.; et al. Shiga Toxin-Producing Escherichia coli Infections Associated with Romaine Lettuce-United States, 2018. Clin. Infect Dis. 2020, 71, e323–e330. [Google Scholar] [CrossRef]
- Soderstrom, A.; Osterberg, P.; Lindqvist, A.; Jonsson, B.; Lindberg, A.; Blide Ulander, S.; Welinder-Olsson, C.; Lofdahl, S.; Kaijser, B.; De Jong, B.; et al. A large Escherichia coli O157 outbreak in Sweden associated with locally produced lettuce. Foodborne Pathog. Dis. 2008, 5, 339–349. [Google Scholar] [CrossRef]
- Zhang, H.; Schroder, J. Animal Manure Production and Utilization in the US. In Applied Manure and Nutrient Chemistry for Sustainable Agriculture and Environment; Springer Netherlands: Dordrecht, The Netherlands, 2014; pp. 1–21. [Google Scholar] [CrossRef]
- Boesch, D.F.; Brinsfield, R.B.; Magnien, R.E. Chesapeake Bay eutrophication: Scientific understanding, ecosystem restoration, and challenges for agriculture. J. Environ. Qual. 2001, 30, 303–320. [Google Scholar] [CrossRef]
- Lu, J.; Sanchez, S.; Hofacre, C.; Maurer, J.J.; Harmon, B.G.; Lee, M.D. Evaluation of broiler litter with reference to the microbial composition as assessed by using 16S rRNA and functional gene markers. Appl. Environ. Microbiol. 2003, 69, 901–908. [Google Scholar] [CrossRef] [PubMed]
- Zalewska, M.; Błażejewska, A.; Czapko, A.; Popowska, M. Antibiotics and Antibiotic Resistance Genes in Animal Manure—Consequences of Its Application in Agriculture. Front. Microbiol. 2021, 12, 610656. [Google Scholar] [CrossRef] [PubMed]
- He, L.-Y.; Liu, Y.-S.; Su, H.-C.; Zhao, J.-L.; Liu, S.-S.; Chen, J.; Liu, W.-R.; Ying, G.-G. Dissemination of Antibiotic Resistance Genes in Representative Broiler Feedlots Environments: Identification of Indicator ARGs and Correlations with Environmental Variables. Environ. Sci. Technol. 2014, 48, 13120–13129. [Google Scholar] [CrossRef] [PubMed]
- Gillings, M.R. Class 1 integrons as invasive species. Curr. Opin. Microbiol. 2017, 38, 10–15. [Google Scholar] [CrossRef]
- Deng, Y.; Bao, X.; Ji, L.; Chen, L.; Liu, J.; Miao, J.; Chen, D.; Bian, H.; Li, Y.; Yu, G. Resistance integrons: Class 1, 2 and 3 integrons. Ann. Clin. Microbiol. Antimicrob. 2015, 14, 45. [Google Scholar] [CrossRef]
- Hipólito, A.; García-Pastor, L.; Vergara, E.; Jové, T.; Escudero, J.A. Profile and resistance levels of 136 integron resistance genes. npj Antimicrob. Resist. 2023, 1, 13. [Google Scholar] [CrossRef]
- Ghaly, T.M.; Gillings, M.R.; Penesyan, A.; Qi, Q.; Rajabal, V.; Tetu, S.G. The Natural History of Integrons. Microorganisms 2021, 9, 2212. [Google Scholar] [CrossRef]
- Bass, L.; Liebert, C.A.; Lee, M.D.; Summers, A.O.; White, D.G.; Thayer, S.G.; Maurer, J.J. Incidence and characterization of integrons, genetic elements mediating multiple-drug resistance, in avian Escherichia coli. Antimicrob. Agents Chemother. 1999, 43, 2925–2929. [Google Scholar] [CrossRef]
- Meyers, M.A.; Durso, L.M.; Gilley, J.E.; Waldrip, H.M.; Castleberry, L.; Millmier-Schmidt, A. Antibiotic resistance gene profile changes in cropland soil after manure application and rainfall. J. Environ. Qual. 2020, 49, 754–761. [Google Scholar] [CrossRef]
- Lopatto, E.; Choi, J.; Colina, A.; Ma, L.; Howe, A.; Hinsa-Leasure, S. Characterizing the soil microbiome and quantifying antibiotic resistance gene dynamics in agricultural soil following swine CAFO manure application. PLoS ONE 2019, 14, e0220770. [Google Scholar] [CrossRef]
- Ruuskanen, M.; Muurinen, J.; Meierjohan, A.; Parnanen, K.; Tamminen, M.; Lyra, C.; Kronberg, L.; Virta, M. Fertilizing with Animal Manure Disseminates Antibiotic Resistance Genes to the Farm Environment. J. Environ. Qual. 2016, 45, 488–493. [Google Scholar] [CrossRef] [PubMed]
- Guron, G.K.P.; Arango-Argoty, G.; Zhang, L.; Pruden, A.; Ponder, M.A. Effects of Dairy Manure-Based Amendments and Soil Texture on Lettuce- and Radish-Associated Microbiota and Resistomes. mSphere 2019, 4, 1–14. [Google Scholar] [CrossRef] [PubMed]
- Zhang, Y.J.; Hu, H.W.; Chen, Q.L.; Singh, B.K.; Yan, H.; Chen, D.; He, J.Z. Transfer of antibiotic resistance from manure-amended soils to vegetable microbiomes. Environ. Int. 2019, 130, 104912. [Google Scholar] [CrossRef] [PubMed]
- Zhang, Y.J.; Hu, H.W.; Chen, Q.L.; Yan, H.; Wang, J.T.; Chen, D.; He, J.Z. Manure Application Did Not Enrich Antibiotic Resistance Genes in Root Endophytic Bacterial Microbiota of Cherry Radish Plants. Appl. Environ. Microbiol. 2020, 86, e02106-19. [Google Scholar] [CrossRef]
- Henuk, Y.L.; Dingle, J.G. Poultry manure: Source of fertilizer, fuel and feed. World’s Poult. Sci. J. 2003, 59, 350–360. [Google Scholar] [CrossRef]
- Ashworth, A.J.; Chastain, J.P.; Moore, P.A. Nutrient characteristics of poultry manure and litter. In Animal Manure: Production, Characteristics, Environmental Concerns, and Management; Waldrip, H.M., Pagliari, P.H., He, Z., Eds.; Wiley Online Library: Hoboken, NJ, USA, 2020; pp. 63–87. [Google Scholar]
- Vieira, S.; Moran, E., Jr. Effects of delayed placement and used litter on broiler yields. J. Appl. Poultry Res. 1999, 8, 75–81. [Google Scholar] [CrossRef]
- Cressman, M.D.; Yu, Z.; Nelson, M.C.; Moeller, S.J.; Lilburn, M.S.; Zerby, H.N. Interrelations between the microbiotas in the litter and in the intestines of commercial broiler chickens. Appl. Environ. Microbiol. 2010, 76, 6572–6582. [Google Scholar] [CrossRef]
- Hill, D.; Morra, M.J.; Stalder, T.; Jechalke, S.; Top, E.; Pollard, A.T.; Popova, I. Dairy manure as a potential source of crop nutrients and environmental contaminants. J. Environ. Sci. 2021, 100, 117–130. [Google Scholar] [CrossRef]
- Kumar, A.; Gupta, D.K.; Kumar, M. Green manure crops: A boon for agricultural soil. Int. J. Agric. Environ. Biotechnol. 2013, 6, 193–198. [Google Scholar]
- Fussell, L.W. Poultry industry strategies for control of immunosuppressive diseases. Poult. Sci. 1998, 77, 1193–1196. [Google Scholar] [CrossRef]
- Gurtler, J.B.; Doyle, M.P.; Erickson, M.C.; Jiang, X.; Millner, P.; Sharma, M. Composting To Inactivate Foodborne Pathogens for Crop Soil Application: A Review. J. Food Prot. 2018, 81, 1821–1837. [Google Scholar] [CrossRef] [PubMed]
- Arikan, O.A.; Sikora, L.J.; Mulbry, W.; Khan, S.U.; Foster, G.D. Composting rapidly reduces levels of extractable oxytetracycline in manure from therapeutically treated beef calves. Bioresour. Technol. 2007, 98, 169–176. [Google Scholar] [CrossRef] [PubMed]
- Arikan, O.; Mulbry, W.; Ingram, D.; Millner, P. Minimally managed composting of beef manure at the pilot scale: Effect of manure pile construction on pile temperature profiles and on the fate of oxytetracycline and chlortetracycline. Bioresour. Technol. 2009, 100, 4447–4453. [Google Scholar] [CrossRef] [PubMed]
- Sharma, R.; Larney, F.J.; Chen, J.; Yanke, L.J.; Morrison, M.; Topp, E.; McAllister, T.A.; Yu, Z. Selected antimicrobial resistance during composting of manure from cattle administered sub-therapeutic antimicrobials. J. Environ. Qual. 2009, 38, 567–575. [Google Scholar] [CrossRef]
- Kim, K.R.; Owens, G.; Ok, Y.S.; Park, W.K.; Lee, D.B.; Kwon, S.I. Decline in extractable antibiotics in manure-based composts during composting. Waste Manag. 2012, 32, 110–116. [Google Scholar] [CrossRef]
- Qian, X.; Sun, W.; Gu, J.; Wang, X.J.; Sun, J.J.; Yin, Y.N.; Duan, M.L. Variable effects of oxytetracycline on antibiotic resistance gene abundance and the bacterial community during aerobic composting of cow manure. J. Hazard. Mater. 2016, 315, 61–69. [Google Scholar] [CrossRef]
- Dolliver, H.; Gupta, S.; Noll, S. Antibiotic degradation during manure composting. J. Environ. Qual. 2008, 37, 1245–1253. [Google Scholar] [CrossRef]
- Peng, S.; Wang, Y.; Zhou, B.; Lin, X. Long-term application of fresh and composted manure increase tetracycline resistance in the arable soil of eastern China. Sci. Total Environ. 2015, 506–507, 279–286. [Google Scholar] [CrossRef]
- Guan, J.; Wasty, A.; Grenier, C.; Chan, M. Influence of temperature on survival and conjugative transfer of multiple antibiotic-resistant plasmids in chicken manure and compost microcosms. Poult. Sci. 2007, 86, 610–613. [Google Scholar] [CrossRef]
- Cui, E.; Wu, Y.; Zuo, Y.; Chen, H. Effect of different biochars on antibiotic resistance genes and bacterial community during chicken manure composting. Bioresour. Technol. 2016, 203, 11–17. [Google Scholar] [CrossRef]
- Erickson, M.C.; Smith, C.; Jiang, X.; Flitcroft, I.D.; Doyle, M.P. Manure source and age affect survival of zoonotic pathogens during aerobic composting at sublethal temperatures. J. Food Prot. 2015, 78, 302–310. [Google Scholar] [CrossRef] [PubMed]
- Erickson, M.C.; Smith, C.; Jiang, X.; Flitcroft, I.D.; Doyle, M.P. Survival of Salmonella or Escherichia coli O157:H7 during holding of manure-based compost mixtures at sublethal temperatures as influenced by the carbon amendment. J. Food Prot. 2015, 78, 248–255. [Google Scholar] [CrossRef] [PubMed]
- Arikan, O.A.; Sikora, L.J.; Mulbry, W.; Khan, S.U.; Rice, C.; Foster, G.D. The fate and effect of oxytetracycline during the anaerobic digestion of manure from therapeutically treated calves. Process Biochem. 2006, 41, 1637–1643. [Google Scholar] [CrossRef]
- Ghosh, S.; Ramsden, S.J.; LaPara, T.M. The role of anaerobic digestion in controlling the release of tetracycline resistance genes and class 1 integrons from municipal wastewater treatment plants. Appl. Microbiol. Biotechnol. 2009, 84, 791–796. [Google Scholar] [CrossRef]
- Zhang, T.; Yang, Y.; Pruden, A. Effect of temperature on removal of antibiotic resistance genes by anaerobic digestion of activated sludge revealed by metagenomic approach. Appl. Microbiol. Biotechnol. 2015, 99, 7771–7779. [Google Scholar] [CrossRef]
- Byrne-Bailey, K.G.; Gaze, W.H.; Zhang, L.; Kay, P.; Boxall, A.; Hawkey, P.M.; Wellington, E.M. Integron prevalence and diversity in manured soil. Appl. Environ. Microbiol. 2011, 77, 684–687. [Google Scholar] [CrossRef]
- You, Y.; Hilpert, M.; Ward, M.J. Identification of Tet45, a tetracycline efflux pump, from a poultry-litter-exposed soil isolate and persistence of tet (45) in the soil. J. Antimicrob. Chemoth 2013, 68, 1962–1969. [Google Scholar] [CrossRef]
- Gillings, M.R.; Gaze, W.H.; Pruden, A.; Smalla, K.; Tiedje, J.M.; Zhu, Y.-G. Using the class 1 integron-integrase gene as a proxy for anthropogenic pollution. The ISME journal 2015, 9, 1269–1279. [Google Scholar] [CrossRef]
- Marti, R.; Scott, A.; Tien, Y.-C.; Murray, R.; Sabourin, L.; Zhang, Y.; Topp, E. Impact of manure fertilization on the abundance of antibiotic-resistant bacteria and frequency of detection of antibiotic resistance genes in soil and on vegetables at harvest. Appl. Environ. Microbiol. 2013, 79, 5701–5709. [Google Scholar] [CrossRef]
- Subirats, J.; Murray, R.; Yin, X.; Zhang, T.; Topp, E. Impact of chicken litter pre-application treatment on the abundance, field persistence, and transfer of antibiotic resistant bacteria and antibiotic resistance genes to vegetables. Sci. Total Environ. 2021, 801, 149718. [Google Scholar] [CrossRef]
- Zhang, Y.; Li, H.; Gu, J.; Qian, X.; Yin, Y.; Li, Y.; Zhang, R.; Wang, X. Effects of adding different surfactants on antibiotic resistance genes and intI1 during chicken manure composting. Bioresour. Technol. 2016, 219, 545–551. [Google Scholar] [CrossRef] [PubMed]
- Ritz, C.W.; John, W. Poultry Mortality Composting Management Guide. Available online: https://extension.uga.edu/publications/detail.html?number=B1266&title=poultry-mortality-composting-management-guide (accessed on 24 October 2024).
- Liang, C.; Das, K.C.; McClendon, R.W. The influence of temperature and moisture contents regimes on the aerobic microbial activity of a biosolids composting blend. Bioresour. Technol. 2003, 86, 131–137. [Google Scholar] [CrossRef] [PubMed]
- Anonymous. In-Vessel Composting of Municipal Wastewater Sludge; U.S. Environmental Protection Agency, Center for Environmental Research Information: Washington, DC, USA, 1989.
- Leege, P.B. Compost Facility Operating Guide. In The Science of Composting; de Bertoldi, M., Sequi, P., Lemmes, B., Papi, T., Eds.; Springer Netherlands: Dordrecht, The Netherlands, 1996; pp. 126–136. [Google Scholar] [CrossRef]
- Weyers, S.L.; Das, K.C.; Gaskin, J.W.; Liesch, A.M. Pine Chip and Poultry Litter Derived Biochars Affect C and N Dynamics in Two Georgia, USA, Ultisols. Agronomy 2023, 13, 531. [Google Scholar] [CrossRef]
- Anonymous. Test Methods for the Evaluation of Composting And composted Products; The U. S. Composting Council: Alexandria, VA, USA, 1997. [Google Scholar]
- Oxendine, A.; Walsh, A.A.; Young, T.; Dixon, B.; Hoke, A.; Rogers, E.E.; Lee, M.D.; Maurer, J.J. Conditions Necessary for the Transfer of Antimicrobial Resistance in Poultry Litter. Antibiotics 2023, 12, 1006. [Google Scholar] [CrossRef]
- Provence, D.L.; Curtiss, R., III. Gene Transfer in Gram-Negative Bacteria; ASM Press: Washington, DC, USA, 1994. [Google Scholar]
- Callahan, B.J.; McMurdie, P.J.; Rosen, M.J.; Han, A.W.; Johnson, A.J.A.; Holmes, S.P. DADA2: High-resolution sample inference from Illumina amplicon data. Nat. Methods 2016, 13, 581–583. [Google Scholar] [CrossRef]
- Martin, M. Cutadapt removes adapter sequences from high-throughput sequencing reads. EMBnet. J. 2011, 17, 10–12. [Google Scholar] [CrossRef]
- Edgar, R.C. Search and clustering orders of magnitude faster than BLAST. Bioinformatics 2010, 26, 2460–2461. [Google Scholar] [CrossRef]
- Bolyen, E.; Rideout, J.R.; Dillon, M.R.; Bokulich, N.A.; Abnet, C.C.; Al-Ghalith, G.A.; Alexander, H.; Alm, E.J.; Arumugam, M.; Asnicar, F.; et al. Reproducible, interactive, scalable and extensible microbiome data science using QIIME 2. Nat. Biotechnol. 2019, 37, 852–857. [Google Scholar] [CrossRef]
- McDonald, D.; Price, M.N.; Goodrich, J.; Nawrocki, E.P.; DeSantis, T.Z.; Probst, A.; Andersen, G.L.; Knight, R.; Hugenholtz, P. An improved Greengenes taxonomy with explicit ranks for ecological and evolutionary analyses of bacteria and archaea. ISME J. 2012, 6, 610–618. [Google Scholar] [CrossRef]
- Choi, I.; Moore, P., Jr. Effect of various litter amendments on ammonia volatilization and nitrogen content of poultry litter. J. Appl. Poultry Res. 2008, 17, 454–462. [Google Scholar] [CrossRef]
- Zuberer, D.A.; Zibilske, L.M. Composting: The microbiological processing of organic wastes. In Principles and Applications of Soil Microbiology; Elsevier: Amsterdam, The Netherlands, 2021; pp. 655–679. [Google Scholar]
- Goldstein, C.; Lee, M.D.; Sanchez, S.; Hudson, C.; Phillips, B.; Register, B.; Grady, M.; Liebert, C.; Summers, A.O.; White, D.G.; et al. Incidence of class 1 and 2 integrases in clinical and commensal bacteria from livestock, companion animals, and exotics. Antimicrob. Agents Chemother. 2001, 45, 723–726. [Google Scholar] [CrossRef] [PubMed]
- Peng, S.; Li, H.; Song, D.; Lin, X.; Wang, Y. Influence of zeolite and superphosphate as additives on antibiotic resistance genes and bacterial communities during factory-scale chicken manure composting. Bioresour. Technol. 2018, 263, 393–401. [Google Scholar] [CrossRef] [PubMed]
- Tran, T.T.; Scott, A.; Tien, Y.C.; Murray, R.; Boerlin, P.; Pearl, D.L.; Liu, K.; Robertson, J.; Nash, J.H.E.; Topp, E. On-Farm Anaerobic Digestion of Dairy Manure Reduces the Abundance of Antibiotic Resistance-Associated Gene Targets and the Potential for Plasmid Transfer. Appl. Environ. Microbiol. 2021, 87, e0298020. [Google Scholar] [CrossRef] [PubMed]
- Sun, W.; Qian, X.; Gu, J.; Wang, X.J.; Duan, M.L. Mechanism and Effect of Temperature on Variations in Antibiotic Resistance Genes during Anaerobic Digestion of Dairy Manure. Sci. Rep. 2016, 6, 30237. [Google Scholar] [CrossRef]
- Zalewska, M.; Błażejewska, A.; Szadziul, M.; Ciuchciński, K.; Popowska, M. Effect of composting and storage on the microbiome and resistome of cattle manure from a commercial dairy farm in Poland. Environ. Sci. Pollut. Res. Int. 2024, 31, 30819–30835. [Google Scholar] [CrossRef]
- Kubasova, T.; Kollarcikova, M.; Crhanova, M.; Karasova, D.; Cejkova, D.; Sebkova, A.; Matiasovicova, J.; Faldynova, M.; Pokorna, A.; Cizek, A.; et al. Contact with adult hen affects development of caecal microbiota in newly hatched chicks. PLoS ONE 2019, 14, e0212446. [Google Scholar] [CrossRef]
- Smith, A.M.; Sharma, D.; Lappin-Scott, H.; Burton, S.; Huber, D.H. Microbial community structure of a pilot-scale thermophilic anaerobic digester treating poultry litter. Appl. Microbiol. Biotechnol. 2014, 98, 2321–2334. [Google Scholar] [CrossRef]
- Zhou, Z.; Yao, H. Effects of Composting Different Types of Organic Fertilizer on the Microbial Community Structure and Antibiotic Resistance Genes. Microorganisms 2020, 8, 268. [Google Scholar] [CrossRef]
- Zhu, P.; Wu, Y.; Ru, Y.; Hou, Y.; San, K.W.; Yu, X.; Guo, W. Industrial-scale aerobic composting of livestock manures with the addition of biochar: Variation of bacterial community and antibiotic resistance genes caused by various composting stages. Environ. Pollut. 2022, 314, 120270. [Google Scholar] [CrossRef]
- Riaz, L.; Wang, Q.; Yang, Q.; Li, X.; Yuan, W. Potential of industrial composting and anaerobic digestion for the removal of antibiotics, antibiotic resistance genes and heavy metals from chicken manure. Sci. Total Environ. 2020, 718, 137414. [Google Scholar] [CrossRef]
- Kubasova, T.; Faldynova, M.; Crhanova, M.; Karasova, D.; Zeman, M.; Babak, V.; Rychlik, I. Succession, Replacement, and Modification of Chicken Litter Microbiota. Appl. Environ. Microbiol. 2022, 88, e0180922. [Google Scholar] [CrossRef] [PubMed]
- Lévesque, C.; Piché, L.; Larose, C.; Roy, P.H. PCR mapping of integrons reveals several novel combinations of resistance genes. Antimicrob. Agents Chemother. 1995, 39, 185–191. [Google Scholar] [CrossRef] [PubMed]
- Wang, C.; Lin, M.; Yang, Q.; Fu, C.; Guo, Z. The Principle of Steam Explosion Technology and Its Application in Food Processing By-Products. Foods 2023, 12, 3307. [Google Scholar] [CrossRef] [PubMed]
- Simjee, S.; McDermott, P.F.; White, D.G.; Hofacre, C.; Berghaus, R.D.; Carter, P.J.; Stewart, L.; Liu, T.; Maier, M.; Maurer, J.J. Antimicrobial susceptibility and distribution of antimicrobial-resistance genes among Enterococcus and coagulase-negative Staphylococcus isolates recovered from poultry litter. Avian Dis. 2007, 51, 884–892. [Google Scholar] [CrossRef]
- Doyle, M.P.; Busta, F.; Cords, B.R.; Davidson, P.M.; Hawke, J.; Hurd, H.S.; Isaacson, R.E.; Matthews, K.; Maurer, J.; Meng, J. Antimicrobial resistance: Implications for the food system: An expert report, funded by the IFT Foundation. Compr. Rev. Food Sci. Food Saf. 2006, 5, 71–137. [Google Scholar]
- Lee, M.D.; Pedroso, A.A.; Lumpkins, B.; Cho, Y.; Maurer, J.J. Pioneer colonizers: Bacteria that alter the chicken intestinal morphology and development of the microbiota. Front. Physiol. 2023, 14, 1139321. [Google Scholar] [CrossRef]
- Lu, J.; Idris, U.; Harmon, B.; Hofacre, C.; Maurer, J.J.; Lee, M.D. Diversity and succession of the intestinal bacterial community of the maturing broiler chicken. Appl. Environ. Microbiol. 2003, 69, 6816–6824. [Google Scholar] [CrossRef]
Target Gene 1 | Sequence | Amplicon Size (bp) | Annealing Temp (°C) | Reference |
---|---|---|---|---|
16S rrs | F: CGGTGAATACGTTCYCGG | 142 | 56.3 | [1] |
R: GGWTACCTTGTTACGACTT | ||||
aadA1 | F: GTACGGCTCCGCAGTGGA | 244 | 56.3 | [1] |
R: GCGCTGCCATTCTCCAAA | ||||
sul1 | F: TTGGGGCTTCCGCTATTGGTCT | 187 | 62.0 | [1] |
R: GGGTTTCCGAGAAGGTGATTGC | ||||
intI1 | F: CCTCCCGCACGATGATC | 280 | 56.3 | [1] |
R: TCCACGCATCGTCAGGC |
Conditions | Reciprocal Simpson | Chao | Shannon | Observed Species | ||||
---|---|---|---|---|---|---|---|---|
Average 1 | p-Value 2 | Average 1 | p-Value 2 | Average 1 | p-Value 2 | Average 1 | p-Value 2 | |
Control (n = 32) | 20.38 ± 0.74 | 131.20 ± 3.78 | 5.33 ± 0.06 | 129.38 ± 3.67 | ||||
Aeration | ||||||||
Passive (n = 8) | 32.33 ± 2.75 | 0.0015 | 162.26 ± 7.67 | 0.0021 | 5.98 ± 0.08 3 | <0.0001 | 160.77 ± 7.48 | 0.0016 |
Forced (n = 8) | 31.70 ± 2.49 | 0.0011 | 184.39 ± 6.59 | <0.0001 | 6.01 ± 0.07 | <0.0001 | 181.43 ± 6.24 | <0.0001 |
Anaerobic (n = 8) | 20.31 ± 0.79 | 0.4749 | 140.56 ± 4.83 | 0.0729 | 5.37 ± 0.05 | 0.2769 | 138.41 ± 4.67 | 0.0735 |
Static (n = 8) | 15.28 ± 1.35 | 0.0035 | 96.80 ± 2.18 | <0.0001 | 4.87 ± 0.09 | 0.0004 | 95.95 ± 2.14 | <0.0001 |
Family 1/Genus 2/Species | Passive Aeration | |||||
---|---|---|---|---|---|---|
aadA1 | sul1 | intI1 | ||||
r = | p = | r = | p = | r = | p = | |
Actinobacteria | ||||||
Mycobacteriaceae | −0.74 | 0.014 | ||||
Mycobacterium | −0.74 | 0.014 | ||||
Pseudonocardiaceae | −0.80 | 0.005 | −0.760 | 0.010 | ||
Saccharomonospora | −0.90 | <0.001 | −0.87 | 0.001 | ||
Nocardiopsaceae | −0.84 | 0.003 | −0.79 | 0.006 | ||
Nocardiopsis | −0.85 | 0.002 | −0.78 | 0.008 | ||
alba−algeriensis | −0.76 | 0.010 | ||||
nikkonensis | −0.76 | 0.010 | ||||
Firmicutes | ||||||
Paenibacillaceae | ||||||
Ammoniphilus | −0.80 | 0.005 | −0.81 | 0.005 | ||
oxalaticus | −0.80 | 0.005 | ||||
Caldicoprobacteraceae | ||||||
Caldicoprobacter sp30143 | −0.72 | 0.017 | ||||
Clostridiales; Family XI | ||||||
Tepidimicrobium | −0.73 | 0.016 | ||||
Tissierella sp31385−sp31390 | −0.76 | 0.010 | ||||
Clostridiales; Not Assigned | −0.72 | 0.018 | −0.77 | 0.010 | −0.72 | 0.018 |
Peptococcaceae | −0.81 | 0.005 | −0.83 | 0.003 | −0.74 | 0.013 |
Desulfotomaculum | −0.73 | 0.016 | ||||
Proteobacteria | ||||||
Rhodospirillaceae | −0.77 | 0.009 | −0.79 | 0.007 | −0.75 | 0.012 |
Fodinicurvata | −0.79 | 0.0065 | −0.73 | 0.016 | ||
sediminis | −0.79 | 0.006 | ||||
Alcaligenaceae | −0.70 | 0.020 | ||||
Achromobacter | −0.76 | 0.011 | ||||
sp48100 | −0.76 | 0.011 | ||||
Bacteroidetes | −0.73 | 0.015 | ||||
Cytophagia; Not Assigned | −0.71 | 0.019 | ||||
Rhodothermaceae | −0.74 | 0.021 | ||||
Chlorofexi | ||||||
Sphaerobacteraceae | −0.70 | 0.021 | ||||
Static | ||||||
Firmicutes | ||||||
Bacillaceae | ||||||
sp26447 | −0.76 | 0.011 | −0.76 | 0.001 | ||
Anaerobic | ||||||
Firmicutes | ||||||
Bacillaceae | ||||||
Atopostipes sp28157 | −0.78 | <0.001 | ||||
Anaerosalibacter sp31230−sp31231 | −0.74 | 0.002 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Maurer, J.J.; Hoke, A.; Das, K.C.; Wu, J.; Williams, M.A.; Kinstler, S.; Ritz, C.; Pittman, G.P.; Berghaus, R.; Lee, M.D. The Impact Aerobic and Anaerobic Incubations of Poultry Litter Have on Class 1 Integron Resistome and Microbiome. Agriculture 2025, 15, 398. https://doi.org/10.3390/agriculture15040398
Maurer JJ, Hoke A, Das KC, Wu J, Williams MA, Kinstler S, Ritz C, Pittman GP, Berghaus R, Lee MD. The Impact Aerobic and Anaerobic Incubations of Poultry Litter Have on Class 1 Integron Resistome and Microbiome. Agriculture. 2025; 15(4):398. https://doi.org/10.3390/agriculture15040398
Chicago/Turabian StyleMaurer, John J., Alexa Hoke, Keshav C. Das, Jian Wu, Mark A. Williams, Sydney Kinstler, Casey Ritz, Gregory P. Pittman, Roy Berghaus, and Margie D. Lee. 2025. "The Impact Aerobic and Anaerobic Incubations of Poultry Litter Have on Class 1 Integron Resistome and Microbiome" Agriculture 15, no. 4: 398. https://doi.org/10.3390/agriculture15040398
APA StyleMaurer, J. J., Hoke, A., Das, K. C., Wu, J., Williams, M. A., Kinstler, S., Ritz, C., Pittman, G. P., Berghaus, R., & Lee, M. D. (2025). The Impact Aerobic and Anaerobic Incubations of Poultry Litter Have on Class 1 Integron Resistome and Microbiome. Agriculture, 15(4), 398. https://doi.org/10.3390/agriculture15040398