Characterization of PHT Genes in ‘duli’ (Pyrus betulifolia Bunge) and Expression Analysis of PbPHTs in Response to Plant Growth Regulators, P, and Salt Stress
Abstract
1. Introduction
2. Materials and Methods
2.1. Identification of PbPHTs
2.2. Phylogenetic Analysis and Chromosome Localization
2.3. Conserved Motifs, Gene Structure, and Cis-Acting Elements
2.4. Plant Materials and Treatments
2.5. Expression Analysis
2.6. Determination of P Elements
3. Results
3.1. Identification and Physicochemical Properties of PHT Genes in ‘duli’
3.2. Phylogenetic Analysis
3.3. Chromosome Localization and Gene Replication Analysis
3.4. Conserved Motif and Gene Structure Analysis
3.5. Cis-Acting Element Analysis
3.6. Tissue-Specific Expression Patterns of PbPHTs
3.7. Expression Analysis of PbPHTs in Response to Hormone, Salt, and P Stress
3.8. Content, Absorption, Transfer, and Distribution of P Elements in ‘duli’
3.9. Correlation Analysis
4. Discussion
4.1. Identification, Gene Replication, and Gene Structure Analysis of PbPHT Genes in ‘duli’
4.2. Expression Patterns of PbPHTs in Multiple Tissues
4.3. Expression Analysis of PbPHTs in Response to P Stress
4.4. Expression Analysis of PbPHTs in Response to Plant Growth Regulators
4.5. Expression Analysis of PbPHTs in Response to Salt Stress
4.6. Arbuscular Mycorrhizal (AM) Fungi with P Elements
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Data Availability Statement
Conflicts of Interest
References
- Lhamo, D.; Shao, Q.L.; Tang, R.J.; Luan, S. Genome-wide analysis of the five phosphate transporter families in Camelina sativa and their expressions in response to low-P. Int. J. Mol. Sci. 2020, 21, 8365. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ghodszad, L.; Reyhanitabar, A.; Oustan, S.; Alidokht, L. Phosphorus sorption and desorption characteristics of soils as affected by biochar. Soil Till. Res. 2022, 216, 105251. [Google Scholar] [CrossRef] [Scilit]
- Stewart, A.J.; Chapman, W.; Jenkins, G.I.; Graham, I.; Martin, T.; Crozier, A. The effect of nitrogen and phosphorus deficiency on flavonol accumulation in plant tissues. Plant Cell Environ. 2001, 24, 1189–1197. [Google Scholar] [CrossRef] [Scilit]
- Gu, M.; Chen, A.Q.; Sun, S.B.; Xu, G.H. Complex regulation of plant phosphate transporters and the gap between molecular mechanisms and practical application: What is missing? Mol.Plant 2016, 9, 396–416. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wang, D.L.Y.; Lv, S.L.; Jiang, P.; Li, Y.X. Roles, regulation, and agricultural application of plant phosphate transporters. Front. Plant Sci. 2017, 8, 817. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zhang, Y.; Hu, L.Z.; Yu, D.S.; Xu, K.D.; Zhang, J.; Li, X.L.; Wang, P.F.; Chen, G.; Liu, Z.H.; Peng, C.F.; et al. Integrative analysis of the wheat PHT1 gene family reveals a novel member involved in arbuscular mycorrhizal phosphate pransport and pmmunity. Cells 2019, 8, 490. [Google Scholar] [CrossRef] [Scilit]
- Misson, J.; Thibaud, M.C.; Bechtold, N.; Raghothama, K.; Nussaume, L. Transcriptional regulation and functional properties of Arabidopsis Pht1;4, a high affinity transporter contributing greatly to phosphate uptake in phosphate deprived plants. Plant Mol. Biol. 2004, 55, 727–741. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Shin, H.; Shin, H.S.; Dewbre, G.R.; Harrison, M.J. Phosphate transport in Arabidopsis Pht1;1 and Pht1;4 play a major role in phosphate acquisition from both low- and high-phosphate environments. Plant J. 2004, 39, 629–642. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Nagarajan, V.K.; Jain, A.; Poling, M.D.; Lewis, A.J.; Raghothama, K.G.; Smith, A.P. Arabidopsis Pht1;5 Mobilizes Phosphate between Source and Sink Organs and Influences the Interaction between Phosphate Homeostasis and Ethylene Signaling. Plant Physiol. 2011, 156, 1149–1163. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Lin, W.Y.; Huang, T.K.; Chiou, T.J. Nitrogen limitation adaptation, a Target of microRNA827, mediates degradation of plasma membrane-localized phosphate transporters to maintain phosphate homeostasis in Arabidopsis. Plant Cell 2013, 25, 4061–4074. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Takabatake, R.; Hata, S.; Taniguchi, M.; Kouchi, H.; Sugiyama, T.; Izui, K. Isolation and characterization of cDNAs encoding mitochondrial phosphate transporters in soybean, maize, rice, and Arabidopsis. Plant Mol. Biol. 1999, 40, 479–486. [Google Scholar] [CrossRef] [Scilit]
- Wang, G.Y.; Shi, J.L.; Ng, G.; Battle, S.L.; Zhang, C.; Lu, H. Circadian clock-regulated phosphate Transporter PHT4;1 plays an important role in Arabidopsis defense. Mol. Plant 2011, 4, 516–526. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Irigoyen, S.; Karlsson, P.M.; Kuruvilla, J.; Spetea, C.; Versaw, W.K. The sink-specific plastidic phosphate transporter PHT4;2 influences starch accumulation and leaf size in arabidopsis. Plant Physiol. 2011, 157, 1765–1777. [Google Scholar] [CrossRef] [Scilit]
- Cubero, B.; Nakagawa, Y.; Jiang, X.Y.; Miura, K.J.; Li, F.; Raghothama, K.G.; Bressan, R.A.; Hasegawa, P.M.; Pardo, J.M. The phosphate transporter PHT4;6 is a determinant of salt tTolerance that is localized to the golgi apparatus of Arabidopsis. Mol. Plant 2009, 2, 535–552. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Liu, T.Y.; Huang, T.K.; Yang, S.Y.; Hong, Y.T.; Huang, S.M.; Wang, F.N.; Chiang, S.F.; Tsai, S.Y.; Lu, W.C.; Chiou, T.J. Identification of plant vacuolar transporters mediating phosphate storage. Nat. Commun. 2016, 7, 11095. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Luan, M.D.; Zhao, F.G.; Han, X.B.; Sun, G.F.; Yang, Y.; Liu, J.L.; Shi, J.S.; Fu, A.G.; Lan, W.Z.; Luan, S. Vacuolar phosphate transporters contribute to systemic phosphate homeostasis vital for reproductive development in Arabidopsis. Plant Physiol. 2019, 179, 640–655. [Google Scholar] [CrossRef] [Scilit]
- Shane, M.W.; McCully, M.E.; Lambers, H. Tissue and cellular phosphorus storage during development of phosphorus toxicity in Hakea prostrata (Proteaceae). J. Exp. Bot. 2004, 55, 1033–1044. [Google Scholar] [CrossRef] [Scilit]
- Sun, T.T.; Li, M.J.; Shao, Y.; Yu, L.W.; Ma, F.W. Comprehensive genomic identification and expression analysis of the phosphate transporter (PHT) gene family in apple. Front. Plant Sci. 2017, 8, 426. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Rui, W.J.; Ma, J.; Wei, N.; Zhu, X.Y.; Li, Z.F. Genome-wide analysis of the PHT gene family and its response to mycorrhizal symbiosis in tomatoes under phosphate starvation conditions. Int. J. Mol. Sci. 2023, 24, 10246. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Murugan, N.; Palanisamy, V.; Channappa, M.; Ramanathan, V.; Ramaswamy, M.; Govindakurup, H.; Chinnaswamy, A. Genome-wide in silico identification, structural analysis, promoter analysis, and expression profiling of PHT gene family in sugarcane root under salinity stress. Sustainability 2022, 14, 15893. [Google Scholar] [CrossRef] [Scilit]
- Ahmad, I.; Rawoof, A.; Islam, K.; Momo, J.; Ramchiary, N. Identification and expression analysis of phosphate transporter genes and metabolites in response to phosphate stress in capsicum annuum. Environ. Exp. Bot. 2021, 190, 104597. [Google Scholar] [CrossRef] [Scilit]
- Zhang, C.X.; Meng, S.; Li, M.J.; Zhao, Z. Genomic identification and expression analysis of the phosphate transporter gene family in poplar. Front. Plant Sci. 2016, 7, 1398. [Google Scholar] [CrossRef] [Scilit]
- Okumura, S.; Mitsukawa, N.; Shirano, Y.; Shibata, D. Phosphate transporter gene family of Arabidopsis thaliana. DNA Res. 1998, 5, 261–269. [Google Scholar] [CrossRef] [Scilit]
- Wang, J.H.; Yang, Y.; Liao, L.; Xu, J.W.; Liang, X.; Liu, W. Genome-wide identification and functional characterization of the phosphate transporter gene family in Sorghum. Biomolecules 2019, 9, 670. [Google Scholar] [CrossRef] [Scilit]
- Wan, Y.Y.; Wang, Z.; Xia, J.H.; Shen, S.L.; Guan, M.W.; Zhu, M.C.; Qiao, C.L.; Sun, F.J.; Liang, Y.; Li, J.; et al. Genome-wide analysis of phosphorus transporter genes in brassica and their roles in heavy metal stress tolerance. Int. J. Mol. Sci. 2020, 21, 2209. [Google Scholar] [CrossRef] [Scilit]
- Cao, D.; Liu, Y.L.; Ma, L.L.; Liu, Z.H.; Li, J.; Wen, B.B.; Zhang, X.N.; Yin, P.; Jin, X.F.; Huang, J.N. Genome-wide identification and characterization of phosphate transporter gene family members in tea plants (Camellia sinensis L. O. kuntze) under different selenite levels. Plant Physiol. Biochem. 2021, 166, 668–676. [Google Scholar] [CrossRef] [Scilit]
- Luo, S.C.; Xu, P.X.; Cheng, A.; Wang, X.; Xu, J.F.; Ma, H.; Zhang, Y.X.; Zhang, H.X. Comprehensive analysis of the bZIP gene family in ‘Duli’ pear (Pyrus betulifolia Bunge): Insights for research on abiotic stress, especially drought, in pear. Sci. Hortic. 2024, 334, 113302. [Google Scholar] [CrossRef] [Scilit]
- Chen, G.D.; Li, Y.; Jin, C.; Wang, J.Z.; Wang, L.; Wu, J.Y. Physiological and morphological responses of hydroponically grown pear rootstock under phosphorus treatment. Front. Plant Sci. 2021, 12, 696045. [Google Scholar] [CrossRef] [Scilit]
- Song, K.; Qin, Q.; Yang, Y.F.; Sun, L.J.; Sun, Y.F.; Zheng, X.Q.; Lu, W.G.; Xue, Y. Drip fertigation and plant hedgerows significantly reduce nitrogen and phosphorus losses and maintain high fruit yields in intensive orchards. J. Integr. Agr. 2023, 22, 598–610. [Google Scholar] [CrossRef] [Scilit]
- Zhang, W.L.; Yuan, S.; Liu, N.; Zhang, H.X.; Zhang, Y.X. Glutamine synthetase and glutamate synthase family perform diverse physiological functions in exogenous hormones and abiotic stress responses in Pyrus betulifolia Bunge (P.be). Plants 2024, 13, 2759. [Google Scholar] [CrossRef] [Scilit]
- Zhang, W.L.; Cheng, X.H.; Jing, Z.T.; Cao, Y.; Yuan, S.; Zhang, H.X.; Zhang, Y.X. Exogenous GA3 enhances nitrogen uptake and metabolism under low nitrate conditions in ‘Duli’ (Pyrus betulifolia Bunge) seedlings. Int. J. Mol. Sci. 2024, 25, 7967. [Google Scholar] [CrossRef] [Scilit]
- Yuan, S.; Zhang, W.L.; Zhang, Y.X. Characterization of SUPPRESSOR OF MAX2 1-LIKE (SMXL) Genes in ‘duli’ (Pyrus betulifolia L.) and Expression Analysis of PbSMXLs in Response to Plant Growth Regulators and Salt Stress. Agronomy 2024, 14, 2778. [Google Scholar] [CrossRef] [Scilit]
- Liang, B.W.; Ma, C.Q.; Zhang, Z.J.; Wei, Z.W.; Gao, T.T.; Zhao, Q.; Ma, F.W.; Li, C. Long-term exogenous application of melatonin improves nutrient uptake fluxes in apple plants under moderate drought stress. Environ. Exp Bot. 2018, 155, 650–661. [Google Scholar] [CrossRef] [Scilit]
- Liang, B.W.; Gao, T.T.; Zhao, Q.; Ma, C.Q.; Chen, Q.; Wei, Z.W.; Li, C.Y.; Li, C.; Ma, F.W. Effects of exogenous dopamine on the uptake, transport, and resorption of apple ionome under moderate drought. Plant Sci. 2018, 9, 755. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ji, J.H.; He, X.L.; Liu, H.T.; Li, Z.Y.; Zhou, S.S.; Zhang, X.Y.; Xu, J.Z.; Liang, B.W. Influence of dwarfing interstock on the tolerance and nutrient utilization efficiency of apple trees under drought stress. Sci. Hortic. 2023, 315, 111984. [Google Scholar] [CrossRef] [Scilit]
- Sun, Y.M.; Jia, X.Y.; Yang, Z.R.; Fu, Q.J.; Yang, H.H.; Xu, X.Y. Genome-wide identification of PEBP gene family in Solanum lycopersicum. Int. J. Mol. Sci. 2023, 24, 9185. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Rae, A.L.; Cybinski, D.H.; Jarmey, J.M.; Smith, F.W. Characterization of two phosphate transporters from barley; evidence for diverse function and kinetic properties among members of the Pht1 family. Plant Mol. Biol. 2003, 53, 27–36. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Teng, W.; Zhao, Y.Y.; Zhao, X.Q.; He, X.; Ma, W.Y.; Deng, Y.; Chen, X.P.; Tong, Y.P. Genome-wide identification, characterization, and expression analysis of PHT1 phosphate transporters in wheat. Front. Plant Sci. 2017, 8, 543. [Google Scholar] [CrossRef] [Scilit]
- Pudake, R.N.; Mehta, C.M.; Mohanta, T.K.; Sharma, S.; Varma, A.; Sharma, A.K. Expression of four phosphate transporter genes from finger millet (Eleusine coracana L.) in response to mycorrhizal colonization and Pi stress. 3 Biotech 2017, 7, 17. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wang, L.; Xiao, L.; Yang, H.Y.; Chen, G.L.; Zeng, H.Q.; Zhao, H.Y.; Zhu, Y.Y. Genome-wide identification, eexpression profiling, and evolution of phosphate transporter gene family in green algae. Front. Genet. 2020, 11, 590947. [Google Scholar] [CrossRef] [Scilit]
- Aslam, M.M.; Waseem, M.; Xu, W.; ul Qamar, M.T. Identification and expression analysis of phosphate transporter (PHT) gene family in Lupinus albus cluster root under phosphorus stress. Int. J. Biol. Macromol. 2022, 205, 772–781. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Roy, S.W.; Gilbert, W. The evolution of spliceosomal introns: Patterns, puzzles and progress. Nat. Rev. Genet. 2006, 7, 211–221. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Roy, S.W.; Penny, D. A very high fraction of unique intron positions in the intron-rich diatom Thalassiosira pseudonana indicates widespread intron gain. Mol. Biol. Evol. 2007, 24, 1447–1457. [Google Scholar] [CrossRef] [Scilit]
- Mudge, S.R.; Rae, A.L.; Diatloff, E.; Smith, F.W. Expression analysis suggests novel roles for members of the Pht1 family of phosphate transporters in Arabidopsis. Plant J. 2002, 31, 341–353. [Google Scholar] [CrossRef] [Scilit]
- Schünmann, P.H.D.; Richardson, A.E.; Smith, F.W.; Delhaize, E. Characterization of promoter expression patterns derived from the Pht1 phosphate transporter genes of barley (Hordeum vulgare L.). J. Exp. Bot. 2004, 55, 855–865. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Hu, A.Q.; Zhao, Q.Q.; Chen, L.; Zhao, J.P.; Wang, Y.H.; Feng, K.L.; Wu, L.; Xie, M.; Zhou, X.M.; Xiao, L.T.; et al. Identification of Conserved and Divergent Strigolactone Receptors in Sugarcane Reveals a Key Residue Crucial for Plant Branching Control. Front. Plant Sci. 2021, 12, 747160. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Chu, M.Y.; Wang, T.Y.; Li, W.T.; Liu, Y.S.; Bian, Z.Y.; Mao, J.; Chen, B.H. Genome-wide identification and analysis of the genes encoding Q-Type C2H2 zinc finger proteins in grapevine. Int. J. Mol. Sci. 2023, 24, 15180. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zhu, W.; Miao, Q.; Sun, D.; Yang, G.; Wu, C.; Huang, J.; Zheng, C. The mitochondrial phosphate transporters modulate plant responses to salt stress via affecting ATP and gibberellin metabolism in Arabidopsis thaliana. PLoS ONE 2012, 7, e43530. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Nagy, R.; Karandashov, V.; Chague, V.; Kalinkevich, K.; Tamasloukht, M.; Xu, G.; Jakobsen, I.; Levy, A.A.; Amrhein, N.; Bucher, M. The characterization of novel mycorrhiza-specific phosphate transporters from Lycopersicon esculentum and Solanum tuberosum uncovers functional redundancy in symbiotic phosphate transport in solanaceous species. Plant J. 2005, 42, 236–250. [Google Scholar] [CrossRef] [Scilit]
- Javot, H.; Pumplin, N.; Harrison, M.J. Phosphate in the arbuscular mycorrhizal symbiosis: Transport properties and regulatory roles. Plant Cell Environ. 2007, 30, 310–322. [Google Scholar] [CrossRef] [Scilit] [PubMed]








| Gene Name | Forward Primer 5′-3′ | Reverse Primer 5′-3′ |
|---|---|---|
| PbPHT1.9 | CGTTTGTTGTGCCAGTGGAG | GCCTTAGCCGGGTCTTGATT |
| PbPHT1.11 | CGTAGCCGTTGGAGTTGTCA | GTAAGACCCACACCGAGCAA |
| PbPHT1.17 | ATGTTCGGCCGATTTGTTGC | CGAGCCGTCCACCAACG |
| PbPHT1.64 | TGGTGCATCGGTGATGGATA | AGATGCCTTGTGTGCCAAGT |
| PbPHT2.2 | CATTTGCTCATGGCGGGAAT | TCGGAATAACAATCTCCGGACC |
| PbPHT3.32 | CACAGCACATGATCTGGAGAGA | AGGAGTGTCTTCGCCGTTTT |
| PbPHT3.34 | ATGATCAGAGAGAGCGCGG | ATCGCGGATAAAAATGCGGC |
| PbPHT3.49 | CTGTGAAGAACATTGGCCTTG | TCCACTAGATGGCAGTCCACA |
| PbPHT3.66 | CCACGCCGTTGTTTTTGTCT | TCATAGCACGCGATCCCTTC |
| PbPHT4.5 | TGCTGTTTCGTTCGCGTTTC | GACTCCGCTTCCAAATGCTT |
| PbPHT4.7 | ACCACGTTGACCTCAGACAA | AGTAAGCCAAGCAGATGCGA |
| PbPHT4.11 | AGGAAATCGTAAAAGGACCTATGC | GTACAATCACCCAGCGCCTA |
| PbPHT5.2 | TGCCTTTGGGAAAAAGCTGAA | TTCCAACAGGAAAAGGACGATAA |
| PbPHT5.3 | TTCGGGAAGAAGTTGCGAGAA | GAGGCTTTCCCGTGGAACAT |
| PbPHT5.4 | TTCGGGAAGAAGTTGCGAGAA | GCTTGCTAGCACTCCTTGTT |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Yuan, S.; Zhang, W.; Zhang, Y. Characterization of PHT Genes in ‘duli’ (Pyrus betulifolia Bunge) and Expression Analysis of PbPHTs in Response to Plant Growth Regulators, P, and Salt Stress. Agriculture 2025, 15, 199. https://doi.org/10.3390/agriculture15020199
Yuan S, Zhang W, Zhang Y. Characterization of PHT Genes in ‘duli’ (Pyrus betulifolia Bunge) and Expression Analysis of PbPHTs in Response to Plant Growth Regulators, P, and Salt Stress. Agriculture. 2025; 15(2):199. https://doi.org/10.3390/agriculture15020199
Chicago/Turabian StyleYuan, Shuai, Weilong Zhang, and Yuxing Zhang. 2025. "Characterization of PHT Genes in ‘duli’ (Pyrus betulifolia Bunge) and Expression Analysis of PbPHTs in Response to Plant Growth Regulators, P, and Salt Stress" Agriculture 15, no. 2: 199. https://doi.org/10.3390/agriculture15020199
APA StyleYuan, S., Zhang, W., & Zhang, Y. (2025). Characterization of PHT Genes in ‘duli’ (Pyrus betulifolia Bunge) and Expression Analysis of PbPHTs in Response to Plant Growth Regulators, P, and Salt Stress. Agriculture, 15(2), 199. https://doi.org/10.3390/agriculture15020199
