Next Article in Journal
Evaluating Urban Sewage Sludge Distribution on Agricultural Land Using Interpolation and Machine Learning Techniques
Previous Article in Journal
Characterization of the Pore Network of a Cohesive Oxisol Through Morphological and Pore Complexity Analyses
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Characterization of PHT Genes in ‘duli’ (Pyrus betulifolia Bunge) and Expression Analysis of PbPHTs in Response to Plant Growth Regulators, P, and Salt Stress

1
College of Horticulture, Hebei Agricultural University, Baoding 071001, China
2
Pear Technology and Innovation Center of Hebei Province, Baoding 071001, China
*
Author to whom correspondence should be addressed.
These authors contributed equally to this work.
Agriculture 2025, 15(2), 199; https://doi.org/10.3390/agriculture15020199
Submission received: 11 December 2024 / Revised: 8 January 2025 / Accepted: 16 January 2025 / Published: 17 January 2025
(This article belongs to the Section Crop Genetics, Genomics and Breeding)

Abstract

The phosphate transporter (PHT) family plays an important role in the uptake and transport of P elements in plants. A total of 158 PbPHTs were identified from the genome of ‘duli’ (Pyrus betulifolia Bunge) in this study, including 70 PbPHT1s, 2 PbPHT2s, 70 PbPHT3s, 12 PbPHT4s, and 4 PbPHT5s. Among the 158 PHT genes, 150 were localized to 17 ‘duli’ chromosomes. Gene duplication analysis identified 18 tandemly duplicated gene pairs. The promoter analysis showed that there were a large number of cis-acting elements related to phytohormones, growth, development, stress, and light response in PbPHTs. qRT-PCR analysis revealed that most PHT genes in ‘duli’ were highly expressed in the fruits, flowers, leaves, stems, and roots, and 15 PbPHT genes were responsive to 5 μM, 0.5 mM, 5 mM H2PO4, NaCl, GR24 (synthetic SL analog), GA3 (gibberellin 3), ABA (abscisic acid), and IAA (indole-3-acetic acid). GR24, GA3, IAA, and 5 mM KH2PO4 treatments could increase the concentration, absorption, transport, and distribution of P elements in the rhizomes and leaves of ‘duli’, but 5 μM KH2PO4, NaCl, and ABA had the opposite effect. This study therefore provides a list of PbPHT genes with substantial roles in abiotic stress response, as well as important information to understand the functional characteristics of PbPHT during ‘duli’ abiotic stress tolerance, and explores the function of PbPHTs in exogenous hormones, phosphorus, and salt stress in the future.

1. Introduction

Phosphorus (P) is one of the most important macroelements necessary for plants and is an important component of nucleic acids, phospholipids, nucleoproteins, and ATP [1]. It is also involved in multiple biological processes in plants, such as photosynthesis, respiration, and sugar and starch transport. Although P is abundant in soil, it often forms insoluble phosphate with Ca2+, Fe3+, and Al3+, which cannot be easily absorbed and utilized by plants [2]. However, P deficiency can reduce anthocyanin synthesis, reduce crop tillering, reduce the rate of bud and flower formation in fruit trees, and accelerate leaf shedding, thereby limiting plant growth [3]. Plants absorb P elements from the roots through the formation of inorganic phosphates through PHT proteins (phosphate transporters), including HPO42− and H2PO4.
In plants, the PHT family is divided into five subfamilies (PHT1, PHT2, PHT3, PHT4, and PHT5) according to their subcellular localization and sequence [4,5]. The PHT1 (phosphate transporter 1) family is a plasma membrane PHT protein. These are mainly responsible for P absorption in plant roots and P transport. PHT1 is currently the most well-studied family of phosphorus transporters [6]. The PHT1 family contains nine members, namely, AtPHT1.1-AtPHT1.9 in Arabidopsis thaliana, and AtPHT1.1 and AtPHT1.4 are mainly involved in the uptake of P elements from soil [7,8]. AtPHT1.5 is involved in the transport and distribution of P elements from the source organ to the sink organ [9]. The PHT2 family contains only one member in Arabidopsis thaliana. AtPHT2 is a chloroplast phosphate transporter, which is involved in the transport and distribution of P elements in plants [10]. The PHT3 family is a group of mitochondrial localized transporters, and three genes have been identified in Arabidopsis thaliana, which are responsible for Pi exchange between the mitochondrial matrix and the cytoplasm to support ATP [11]. There are six PHT4 family members in Arabidopsis thaliana. AtPHT4.1 is involved in the balance of Pi and pH in chloroplasts [12], AtPHT4.2 is mainly involved in carbon metabolism in Arabidopsis thaliana [13], and AtPHT4.6 is involved in the response of Arabidopsis thaliana to salt stress [14]. PHT5 family proteins (SPX-MFS) are located in the vacuole membrane. It has been found that the PHT5 family can regulate the homeostasis of P elements in plants. They play an important role in reproduction and plant growth. Under Pi-sufficient conditions, PHT5 family members regulate excess Pi storage in vacuoles to prevent cytoplasmic toxemia, whereas in the case of Pi deficiency, the PHT5 family regulates the export of Pi from vacuoles into the cytosol [15,16,17]. Although each subfamily plays an important role in the utilization of P in plants, the absorption, transport, and distribution of P depend on the interactions of each PHT family. With the development of genomics and bioinformatics, PHT families have been identified in the apple (Malus domestica) [18], tomato (Solanum lycopersicum) [19], sugarcane (Saccharum officinarum) [20], capsicum (Capsicum annuum) [21], poplar (Populus simonii) [22], arabidopsis (Arabidopsis thaliana) [23], and other species [24,25,26]. Such genomic analyses of phosphorus transporters have not been performed in ‘duli’ (Pyrus betulifolia Bunge).
Many soils in northern China are deficient in P. So, in pear production, abundant phosphorus fertilizers are applied to the fields every year. However, the heavy use of Pi fertilizers can pollute water resources, which has raised environmental concerns [27,28]. ‘Duli’ has high drought resistance and cold resistance, and it is a commonly used pear rootstock in northern China. Increasing the capacity of ’duli’ roots to absorb P is important for improving the yield and quality of pear trees and reducing Pi pollution [29]. Phosphate transporters play an important role in the uptake and utilization of P elements in ‘duli’. So, we identified the PbPHT gene; detected its expression patterns in the roots, stems, leaves, flowers, fruits, plant growth regulators, P, and salt stress; and analyzed the concentration, absorption, transfer, and distribution of P elements in the roots, stems, and leaves of ‘duli’ under hormone and Pi treatment. The results of our study will aid future investigations of the function of PbPHT family members. Genetic engineering approaches can be used to improve the efficiency of Pi uptake and transport by pear.

2. Materials and Methods

2.1. Identification of PbPHTs

In this study, the protein sequences and GFF/gff3 file of ‘duli’ were downloaded from GDR (https://www.rosaceae.org/organism/26137) (accessed on 21 April 2024). The protein sequences of the AtPHTs were downloaded from Tair (https://www.arabidopsis.org/) (accessed on 21 April 2024). To identify members of the ‘duli’ PHT family, 22 AtPHT protein sequences were used as queries and searched against the ‘duli’ genome database with an E-value ≤ 10−5. Profile information for the PHT1 (MFS, PF00083), PHT2 (PHO4, PF01384), PHT3 (Mito_carr, PF00153), PHT4 (MFS_1, PF07690), and PHT5 (MFS_1, PF07690 and SPX, PF03105) domain was obtained from the Pfam database (http://pfam-legacy.xfam.org/) (accessed on 21 April 2024). After redundancies were removed, domains contained in all protein sequences were verified by Pfam (http://pfam.janelia.org) (accessed on 21 April 2024) and SMART (https://smart.embl.de/) (accessed on 21 April 2024).
To analyze the physicochemical properties of ‘duli’ PHT proteins. The molecular weights, isoelectric points, hydrophilicity, and instability coefficients of each member of the horse ‘duli’ PHT gene family were analyzed using the Expasy website (https://web.expasy.org/protparam/) (accessed on 21 April 2024). Cell-PLoc 2.0 online software (http://www.csbio.sjtu.edu.cn/bioinf/Cell-PLoc-2/) (accessed on 21 April 2024) was used to analyze the subcellular localization of each PbPHT. The online software Some Secondary Structure Prediction (https://npsa-prabi.ibcp.fr) (accessed on 21 April 2024) was used to analyze the protein secondary structure of PbPHTs.

2.2. Phylogenetic Analysis and Chromosome Localization

Phylogenetic trees were made using the program MEGA11 with the neighbor-joining method with the Poisson correction model and 1000 bootstrap replicates; they were then annotated and visualized using Itol (https://itol.embl.de/) (accessed on 21 April 2024). The chromosomal distribution and collinearity of PbPHTs were analyzed using TBtools (version 2.119, College of Horticulture, South China Agricultural University, Guangzhou, China).

2.3. Conserved Motifs, Gene Structure, and Cis-Acting Elements

The shared conserved motifs and gene structure of the ‘duli’ PHT family were analyzed online using the MEME website (https://meme-suite.org/meme/tools/meme) (accessed on 24 April 2024) and visualized using Tbtools. After extracting 2000 bp sequences upstream of each member of the PHT family ‘duli’ using Tbtools, these sequences were then uploaded to the PlantCARE website (https://bioinformatics.psb.ugent.be/webtools/plantcare/html/) (accessed on 24 April 2024) to predict cis-acting elements in the promoter region and visualized using TBtools.

2.4. Plant Materials and Treatments

Tissue samples (roots, stem, leaves, flowers, and fruits) and semi-annual ‘duli’ seedlings with consistent growth and no pests and diseases were obtained from the Innovation Experimental Park of Hebei Agricultural University. Semi-annual ‘duli’ seedlings were used in experiments. Seedlings of similar size were transferred to gray plastic basins (30 × 15 × 10 cm), and the seedlings with were fixed onto sponges, each containing 2.5 L of a 1/2-strength Hoagland nutrient solution, and 2 air pumps were placed in each basin. After 10 d of pre-cultivation, stress treatments were initiated. Each stress treatment had three biological replicates, and each replicate contained 15 plants. The treatments were as follows: (1) control KH2PO4 (500 μM); (2) low-P treatment KH2PO4 (5 μM); (3) high-P treatment KH2PO4 (5 mM) [18]; (4) NaCl treatment (200 mM); (5) GA3 treatment (0.1 mM); (6) IAA treatment (100 μM); (7) ABA treatment (300 μM); (8) and GR24 treatment [30,31].

2.5. Expression Analysis

Samples were collected at 0, 24, 48, and 168 h after the start of the experiment. All tissue samples were flash-frozen in liquid nitrogen, triturated, and stored at −80 °C. RNA was extracted using an RNA kit (Omega, Beijing, China), and RNA was reverse-transcribed using a reverse-transcribed kit (Yeasen, Shanghai, China). Primers for the 15 PbPHT genes were designed using the NCBI website (https://blast.ncbi.nlm.nih.gov/Blast.cgi) (accessed on 28 April 2024) (Table 1). The primers were synthesized by Beijing Biomed Company (Beijing, China). The qRT-PCR reaction system and procedures were carried out according to the method of Yuan Shuai et al. [32]. PbeActin was used as the internal reference standard [30]. The expression levels of PbPHTs were calculated using the 2−ΔΔCT method.

2.6. Determination of P Elements

The leaves, stems, and roots were harvested and washed with deionized water after 168 h of treatment. Samples were fixed at 105 °C for 15 min and then dried in an oven at 70 °C until a constant weight was reached; these samples were then used for analyses of nutrient concentrations. The samples (0.1 g) were placed in glasses, and 1 mL of ultrapure water was added to each glass, followed by 8 mL of concentrated sulfuric acid and perchloric acid mixture (10:1). The samples were then heated to 300 °C in a heavy-metal digestion apparatus (Multiwave PRO; Anton–Paar GmbH, Graz, Austria). Once the solution was clarified, the solution in the tube was reduced to 100 mL with ultrapure water. P was measured using a segmented flow analyzer (Auto Analyzer 3, SEAL Analytical, Norderstedt, Germany) [33]. Each treatment had three independent biological replicates. The distribution, transfer, and absorption of P were determined following the methods of Liang Bowen [34,35].

3. Results

3.1. Identification and Physicochemical Properties of PHT Genes in ‘duli’

A total of 158 PbPHTs were identified in the ‘duli’ genome using bioinformatics methods. Based on conserved domain analysis, we divided the PbPHT genes into five subfamilies, PHT1 (MFS), PHT2 (PHO4), PHT3 (Mito_Carr), PHT4 (MFS_1), and PHT5 (MFS_1 and SPX), and these genes were named PbPHT1.1–PbPHT1.70, PbPHT2.1–PbPHT2.2, PbPHT3.1–PbPHT3.70, PbPHT4.1–PbPHT4.12, and PbPHT5.1–PbPHT5.4 according to their position on the chromosomes, respectively. The physical and chemical properties of the proteins encoded by PbPHT genes are summarized in Table S1 in the Supplementary Materials. The lengths of PHT1 family members ranged from 294 aa to 1094 aa, the molecular weights ranged from 33.07 kDa to 120.77 kDa, and the pI ranged from 5.09 to 9.54. The lengths of PHT3 family members ranged from 229 aa to 1797 aa, and the pI ranged from 6.33 to 9.92. The lengths of PHT4 family members ranged from 184 aa to 610 aa, the molecular weights ranged from 23.34 kDa to 203.17 kDa, and the pI ranged from 6.12 to 10.24. With the exception of PbPHT5.2, the other members of the PHT5 family were 699 aa in length, the molecular weights ranged from 77.82 kDa to 82.19 kDa, and the pI ranged from 5.97 to 8.30. PHT2 and PHT5 family members are unstable proteins and hydrophobic proteins. With the exception of PbPHT3.26, PbPHT3.27, and PbPHT3.28, the other members of the PHT3 family are hydrophilic proteins. Except for PbPHT4.1, PbPHT4.3, and PbPHT4.12, the other members of the PHT4 family are stable proteins. The secondary structure of PHT family members was dominated by alpha helices, and the beta turn angle of all members was 0.
Subcellular localization plays an important role in studying gene function and studying protein interactions. In this study, subcellular localization prediction showed that PHT1 and PHT4 family members are located in cell membranes, PHT2 family members are located in chloroplasts, PHT3 family members are located in mitochondria, PbPHT5.1 and PbPHT5.4 are located in vacuoles, and PbPHT5.2 and PbPHT5.3 are located in cell membranes.

3.2. Phylogenetic Analysis

To analyze the evolutionary relationships among ‘duli’ SMXL proteins, the phylogenetic relationships between ‘duli’ and Arabidopsis PHT genes were constructed. We divided the PHT gene (158 from ‘duli’ and 22 from Arabidopsis) and divided the PHT gene family into five subfamilies: PHT1, PHT2, PHT3, PHT4, and PHT5 (Figure 1). The PHT1 group contained the most members, with 79 PHT proteins. The PHT2 group contained the least number of members, with only three PHT proteins. Both ‘duli’ and Arabidopsis PHT members were clustered under smaller branches, and the homology of members clustered in smaller branches was as high as 100%, suggesting that they had similar biological functions.

3.3. Chromosome Localization and Gene Replication Analysis

To investigate the genomic distribution of PHT genes on the chromosomes, TBtools software was also used to analyze the chromosomal locations of PHT family genes. These 158 genes are located on 17 chromosomes (Figure 2A). Chr5 and Chr10 had the largest number of PbPHT genes, both containing 15 PbPHT members; this was followed by Chr 04 and Chr 11, with 13 PbPHT members each. Chr 14 had the lowest number of PbPHT genes, including three PbPHT members. There were also six unnamed chromosomes: Scaffold 21, Scaffold 5, Scaffold 2, Contig 15, Scaffold 28, and Contig 11. Gene clusters within a 100 kb range of the same chromosomal regions were defined as tandem duplicates [36]. We identified 18 pairs of PbPHT genes with tandem duplicates (Figure 2B,C). These pairs included PbPHT1.29 and PbPHT1.30, PbPHT1.37 and PbPHT3.44, PbPHT1.53 and PbPHT1.54, PbPHT1.54 and PbPHT1.55, PbPHT1.18 and PbPHT1.19, PbPHT1.57 and PbPHT1.18, PbPHT1.68 and PbPHT1.69, PbPHT4.3 and PbPHT4.4, PbPHT1.40 and PbPHT3.49, PbPHT1.41 and PbPHT1.42, PbPHT1.35 and PbPHT1.36, PbPHT1.32 and PbPHT1.33, PbPHT1.33 and PbPHT1.34, PbPHT1.63 and PbPHT1.64, PbPHT1.65 and PbPHT1.66, PbPHT1.11 and PbPHT1.12, PbPHT1.13 and PbPHT1.14, and PbPHT1.15 and PbPHT1.16. These tandem replication events were most prevalent on Chr 01, Chr 04, Chr 05, Chr 06, Chr 07, Chr 10, Chr 11, and Chr 15 and were mainly observed in PbPHT1 family members.

3.4. Conserved Motif and Gene Structure Analysis

To further clarify the functions of PbPHTs, the structure and conserved motifs of all PHT proteins were analyzed using the ‘duli’ whole-genome sequence and genome annotation file. PbPHTs had the most diverse structures (Figure 3A), with the number of exons ranging from 0 to 17, which indicates a high degree of variation between genes. In the PHT5 subfamily, except for PbPHT5.1, which contains 9 introns, the other members contained 10 introns. The distribution of introns/exons is relatively uniform within each subfamily, and structurally similar genes may have similar functions. Furthermore, a total of 20 motifs (Motif 1–Motif 20) were identified in 158 PbPHTs (Figure 3B). PHT1 subfamily members contained Motif 1. The PHT2 subfamily members only contained Motif 15, Motif 19, and Motif 20. All members of the PHT3 subfamily contained Motif 4 and Motif 5. The PHT5 family contained only three motifs, and all PHT5 family members contained Motif 7 and Motif 14.

3.5. Cis-Acting Element Analysis

The distribution and number of cis-acting elements of the 158 PbPHTs are shown in Figure 4. Light-responsive elements, short-effector elements, stress-responsive elements, and hormone-responsive elements were found in the promoter region upstream. Hormone-related elements included abscisic acid-related ABREs (427), jasmonic acid-related TGACG-motifs (274), and CGTCA-motifs (272), gibberellin-related P-box elements (86), GARE-motifs (49), auxin-related TGA-elements (96), and salicylic acid-related TCA-elements (101). PHT2, PHT4, and PHT5 contained ABRE elements; both PHT2 and PHT5 contained elements related to methy jasmonate. PHT1.17, PHT3.22, PHT3.28, PHT3.56, PHT3.70, and PHT4.12 contained the highest number of ABRE components (each containing eight ABRE components). There were cis-elements associated with abiotic stress in PbPHTs, such as MBS (111), LTR (141), and AREs (365). In addition, cis-acting elements related to light responses and growth were identified, including 3-AF1 binding sites (17), Sp1 binding sites (39), and the GT1-motif (207) related to light reactions, the GCN4_motif (41) related to endosperm expression, and the CAT-box (81) related to the meristem. PbPHT4.7 contained the largest number of cis-acting elements (28), followed by PbPHT3.22 (24 cis-acting elements). Most PbPHT family members contained hormonal and abiotic stress-related elements, but the numbers of these genes varied among species.

3.6. Tissue-Specific Expression Patterns of PbPHTs

The qRT-PCR analysis revealed that 15 PbPHTs were ubiquitously expressed in ‘duli’ fruits, flowers, leaves, stems, and roots (Figure 5). For PHT1 members, PbPHT1.9 and PbPHT1.17 were upregulated in the leaves. The expression levels of PbPHT1.11 were higher in the leaves than in other tissues. The expression levels of PbPHT1.11 were highest in the leaves, and their expression was 10.71 times higher in the leaves than in the roots. PbPHT 2.2 was highly expressed in almost all tissues, but its expression was highest in the stems, and its expression was 1.91 times higher in the stems than in the roots. PbPHT4.5 was downregulated in the fruits but upregulated in other tissues. The expression levels of PbPHT3.49, PbPHT3.66, and PbPHT4.7 were high in all tissues. The expression of PbPHT1.17 was significantly higher in the roots than in the stems, flowers, and fruits. The expressions of PbPHT1.17, PbPHT5.2, and PbPHT5.3 were significantly higher in the roots than in the stems and fruits. The expressions of PbPHT4.5 and PbPHT4.11 were high in the stems, leaves, and flowers, and the expressions of these genes were highest in the leaves. PbPHT5.3 was upregulated in the leaves but downregulated in other tissues. Thus, the expression levels of PbPHTs in the roots, stems, leaves, flowers, and fruits of ‘duli’ were different.

3.7. Expression Analysis of PbPHTs in Response to Hormone, Salt, and P Stress

We examined the expression patterns of 15 PbPHTs for ‘duli’ under 5 μM KH2PO4, 5 mM KH2PO4, 0.5 mM KH2PO4, NaCl, GR24, GA3, IAA, and ABA treatments (Figure 6). After treatment with 5 mM KH2PO4, the expression levels of PbPHT1.64, PbPHT2.2, PbPHT3.34, and PbPHT3.66 were highest at 48 h. After treatment with 5 μM KH2PO4, the expression level of PbPHT4.11 was the highest at 168 h, and the expression level at 168 h was 8.77 times higher than that at 0 h. After treatment with NaCl, the expressions of eight PbPHTs peaked at 24 h, and the expressions of PbPHT1.11, PbPHT1.17, PbPHT1.64, PbPHT1.9, PbPHT3.32, PbPHT3.34, PbPHT3.49, and PbPHT5.4 then decreased dramatically after 24 h. Thus, the majority of PbPHTs were induced to express by H2PO4 and NaCl but displayed with variant expression patterns.
After GR24 treatment, the expressions of PbPHT1.9, PbPHT1.17, and PbPHT1.64 continued to increase. The expression level of PbPHT1.17 was the highest at 168 h, and the expression level at 168 h was 14.69 times higher than that at 0 h. After GA3 treatment, the expressions of PbPHT4.7, PbPHT4.11, PbPHT5.2, PbPHT5.3, and PbPHT5.4 first increased and then decreased. After IAA treatment, the expressions of PbPHT1.11, PbPHT1.17, PbPHT1.9, PbPHT3.32, PbPHT3.34, PbPHT4.7, PbPHT4.11, and PbPHT5.3 continued to increase. The expression level of PbPHT3.34 was the highest at 168 h, and the expression level at 168 h was 10.71 times higher than that at 0 h. After 24 h of treatment at ABA, the expressions of PbPHT4.11 and PbPHT5.4 peaked. These analyses indicated that the expression of PbPHTs was induced by KH2PO4, NaCl, GR24, IAA, GA3, and ABA treatment, but with differences in response speeds and expression levels.

3.8. Content, Absorption, Transfer, and Distribution of P Elements in ‘duli’

The concentrations of P in the roots, stems, and leaves of ‘duli’ changed significantly under each treatment (Figure 7). The concentration of P elements in the leaves, stems, and roots was significantly increased in the 5 mM KH2PO4, GR24, GA3, and IAA treatments. The concentrations of P were significantly increased by 9.42%, 39.65%, 15.06%, and 9.11% compared with 0.5 mM KH2PO4 in the roots; the concentrations of P were significantly increased by 8.92%, 61.35%, 32.75%, and 13.61% compared with 0.5 mM KH2PO4 in the stems; the concentrations of P were significantly increased by 11.63%, 39.93%, 13.26%, and 15.11% compared with 0.5 mM KH2PO4 in the leaves. The P element absorption of ‘duli’ was significantly reduced by the 5 μM KH2PO4, NaCl, and ABA treatments, and it was 28.73%, 64.92%, and 33.44% lower in these treatments than in the 0.5 mM KH2PO4 treatment, respectively. The P absorption of ‘duli’ was significantly increased by the 5 mM KH2PO4, GR24, GA3, and IAA treatments, and the P absorption was highest under the GR24 treatment; specifically, it was 180.13% higher in the GR24 treatment than in the 0.5 mM KH2PO4 treatment. It is known through the transport (leaves and stems) and accumulation (roots) of P elements in ‘duli’ that the transport rate of P ranged from 0.22 to 3.54 μg g−1 day−1 in the stems, the transport rate of P ranged from 0.21 to 1.88 μg g−1 day−1 in the leaves, the accumulation of P ranged from 0.15 to 1.12 μg g−1 day−1 in the roots. It is known through the distribution of P elements in ‘duli’ (roots, stems, and leaves) that under the 5 mM KH2PO4, GR24, GA3, and IAA treatment, compared with 0.5 mM KH2PO4 treatment, the content of P increased by 18.76%, 73.42%, 31.99%, and 26.88% in the roots; the content of P increased by 12.85%, 82.77%, 51.44%, and 28.30% in the stems; and the content of P increased by 26.23%, 57.89%, 30.11%, and 28.47% in the leaves. Under the of 5 μm KH2PO4, NaCl, and ABA treatments, the contents of P decreased by 23.87%, 22.93%, and 13.48% in the roots; the contents of P decreased by 25.07%, 33.32%, and 18.33% in the stems; and the contents of P decreased by 20.31%, 34.94%, and 20.16% in the leaves.

3.9. Correlation Analysis

Correlation analysis was performed on 10 physiological indicators and the expression patterns of 15 genes (Figure 8). The expressions of PbPHT1.9, PbPHT1.11, PbPHT1.17, PbPHT1.64, and PbPHT4.7 were significantly positively correlated with the uptake of P, and the concentration, transport, and distribution of P in the roots, stems, and leaves. The expression of PbPHT5.4 was significantly negatively correlated with the uptake of P and the concentration, transport, and distribution of P in the roots, stems, and leaves. The expression of PbPHT1.9 was significantly positively correlated with the expressions of PbPHT1.11, PbPHT1.17, PbPHT1.64, PbPHT3.32, PbPHT3.34, PbPHT4.7, and PbPHT5.3. The expression of PbPHT5.4 was significantly negatively correlated with the expressions of PbPHT1.9, PbPHT1.1, PbPHT1.64, PbPHT3.32, PbPHT3.34, and PbPHT5.3. The expression of PbPHT5.2 was significantly negatively correlated with the expressions of PbPHT3.34, PbPHT5.3, and PbPHT4.5.

4. Discussion

4.1. Identification, Gene Replication, and Gene Structure Analysis of PbPHT Genes in ‘duli’

P is a key component of nucleic acids, phospholipids, and ATP, which are involved in biological processes such as plant energy transfer and cell signaling. In plants, PHT genes mediate Pi uptake and translocation. PHT gene family members have been reported in many plants, including barley [37], wheat [38], finger millet [39], tomato [19], green algae [40], sugarcane [20], Lupinus albus [41], apple [18], sorghum [24], poplar [22], and Camelina sativa [1]. In this study, 158 PbPHTs were identified, including 70 PbPHT1s, 2 PbPHT2s, 70 PbPHT3s, 12 PbPHT4s, and 4 PbPHT5s. The number of PHTs was higher in the ‘duli’ genome than in rice, poplar, apple, and sorghum genomes, which may be related to differences in the size of the genome and the tandem duplication of genes.
Gene replication is the main driver of gene family amplification and includes tandem gene duplication and fragment gene duplication [20,39]. Gene duplication analysis identified 18 tandemly duplicated gene pairs. In this study, 18 pairs of tandemly duplicated genes were found from the genome of ‘duli’; this exceeds the number of PHTs of sorghum [24], sugarcane [20], and Brassica [25], and the increase in the number of tandem repeats may increase the number of PbPHT family members.
In the early stages of gene amplification, some genes gradually lose their introns [42]. In the case of intron selection pressure, intron-free genes may evolve rapidly [43]. Gene structure and motif composition analysis showed that most of the PbPHT genes of the same subpopulation have similar structure and motif distribution. However, there are also some PbPHT family genes that do not have introns. Therefore, it is speculated that some PbPHTs may gradually lose their introns and achieve functional evolution over time.

4.2. Expression Patterns of PbPHTs in Multiple Tissues

The expression patterns of PbPHT1s, PbPHT2s, PbPHT3s, PbPHT4s, and PbPHT5s varied among tissues. We found that PbPHT1.9, PbPHT1.11, and PbPHT1.64 were highly expressed in the roots, leaves, and flowers. The same was observed in Arabidopsis, and most AtPHT1 family members were highly expressed in the roots, but also in the leaves and flowers [44,45]. In apples, MdPHT1.12 is highly expressed in the roots, leaves, and flowers [18]. These results indicate that PHT1 family genes may play a role in Pi uptake in different species. PbPHT 2.2, PbPHT3.49, PbPHT3.66, and PbPHT4.7 were highly expressed in almost all tissues, PbPHT 5.2 was highly expressed in the leaves and flowers, PbPHT 5.3 was highly expressed in the stems, and PbPHT 5.4 was highly expressed in the fruits. The expressions of the PbPHT genes varied among tissues, suggesting that these genes may play different roles in the uptake, distribution, transport, and storage of Pi. A similar conclusion was reached in the correlation analysis. The expressions of PbPHT1.9, PbPHT1.11, PbPHT1.17, PbPHT1.64, and PbPHT4.7 were positively correlated with the uptake of P and the concentration, transport, and distribution of P in the roots, stems, and leaves. The expression of PbPHT5.4 was significantly negatively correlated with P uptake and the concentration, transport, and distribution of P in the roots, stems, and leaves. These results indicate that the expressions of PbPHT1.9, PbPHT1.11, PbPHT1.17, PbPHT1.64, PbPHT4.7, and PbPHT5.4 genes play an important role in Pi uptake, transport, and storage. However, the specific functions of PbPHT1.9, PbPHT1.11, PbPHT1.17, PbPHT1.64, PbPHT4.7, and PbPHT5.4 require further investigation.

4.3. Expression Analysis of PbPHTs in Response to P Stress

PHT1, which encodes a high-affinity Pi transporter, was mostly expressed in the roots, and its expression was induced by low P. In arabidopsis [46] and apples [18], the PHT1 gene is a high-affinity transporter. The expressions of most ATPHT1 genes were significantly upregulated under hypophosphate conditions. MdPHT1.1 and MdPHT1.7 were expressed under low Pi conditions. The qRT-PCR analysis of this study showed that the expressions of PbPHT1.9, PbPHT1.11, PbPHT1.17, and PbPHT1.64 were upregulated after low P treatment. PbPHT1 family members exhibited similar expression patterns in arabidopsis and apples. These results suggest that the protein encoded by the PbPHT1 gene may also be a high-affinity transporter. When plants are exposed to excess Pi, the expressions of PbPHT3.66, PbPHT4.11, PbPHT4.7, and PbPHT5.4 are upregulated, suggesting that they encode low-affinity transporters. However, the detailed features of PbPHTs require further research.

4.4. Expression Analysis of PbPHTs in Response to Plant Growth Regulators

Gene expression is regulated by cis-acting elements [39,46,47]. The PbPHT promoters contain multiple cis-acting elements related to responses to stress, hormones, and light. qRT-PCR analysis of PbPHT showed that different genes exhibited different expression patterns under the same treatment, which may be related to the species and the distribution of cis-acting elements in the promoter region of PbPHTs. We detected abundant ABA-responsive elements, auxin-responsive elements, and GA-responsive elements within the promoter regions of different PbPHT members. The qRT-PCR assays revealed that ABA, IAA, GA, and GR24 could induce the expressions of most PbPHT genes. The expression patterns of PbPHT1.9, PbPHT2.2, PbPHT4.7, PbPHT4.11, PbPHT5.2, and PbPHT5.4 were all responsive to exogenous GR24, GA, ABA, and IAA treatments, indicating that they might play a role in integrating the SL, GA, ABA, and IAA pathways in ‘duli’. However, the mechanism by which PbPHTs regulate the interaction between hormones requires further investigation.

4.5. Expression Analysis of PbPHTs in Response to Salt Stress

Salt stress could reduce the uptake and utilization efficiency of P in plants. The expressions of PbPHT3.32, PbPHT3.34, and PbPHT3.49 were significantly upregulated under salt treatment, and PbPHT3 was localized to the mitochondrion. The respiration rate of ‘duli’ was accelerated, and more reactive oxygen species were produced under salt stress. Increases in the expressions of PbPHT3.32, PbPHT3.34, and PbPHT3.49 promoted the transport of Pi and the conversion of ADP into ATP in ‘duli’, which provided energy to promote its resistance to salt stress. Similar conclusions were made by Takabatake et al. [11]. The PHT3 family is a mitochondrial Pi transporter (MPT). It maintains the exchange of Pi between the cytoplasm and mitochondrial matrix through Pi/H+ symport or Pi/OH antiport, catalyzing the phosphorylation reaction of ADP and Pi to form ATP [48]. PHT3 family members thus might play an important role in the resistance of ‘duli’ to salt stress. Previous studies of the PHT3 gene in arabidopsis have found that it is rapidly upregulated under salt stress and regulates levels of ATP and gibberellin in response to salt stress. Therefore, PbPHT3.32, PbPHT3.34, and PbPHT3.49 may have similar functions to the AtPHT3 gene. However, the specific functions of PbPHT3.32, PbPHT3.34, and PbPHT3.49 require further study.

4.6. Arbuscular Mycorrhizal (AM) Fungi with P Elements

Some studies have found that through the extensive hyphal network of arbuscular mycorrhizal fungi (AMF), host plants can obtain water and nutrients from the soil, especially soil phosphorus elements [49]. In this study, it was found that, under GR24 treatment, the expression levels of the PbPHT1 family genes were significantly upregulated, and the expressions of PbPHT1.9, PbPHT1.11, PbPHT1.17, and PbPHT1.64 were significantly positively correlated with the absorption of phosphorus elements. It is possible that strigolactones promote the symbiotic relationship between Pyrus betulaefolia and arbuscular mycorrhizal fungi and promote the branching of hyphae and that arbuscular mycorrhizal fungi induce the expression of the PbPHT1 gene, thereby facilitating the absorption of phosphorus elements by Pyrus betulaefolia. The research by Hélène Javot et al. [50] also proved this point. The AM symbiotic relationship can affect the transcriptional level of PHT1 transporters and influence the absorption of phosphorus elements by plants.

5. Conclusions

We identified 158 PbPHT genes, including 70 PbPHT1s, 2 PbPHT2s, 70 PbPHT3s, 12 PbPHT4s, and 4 PbPHT5s in ‘duli’, and characterized their physiological and biochemical properties, gene replication, chromosomal position, evolutionary relationships, structures, and conserved motifs. Gene expression analysis revealed differential expression patterns of PbPHTs in different tissues, and in response to 5 μM KH2PO4, 5 mM KH2PO4, 0.5 mM KH2PO4, NaCl, GA3, IAA, GR24, and ABA. Furthermore, we found that 5 mM KH2PO4, GR24, GA3, and IAA treatments significantly increased the concentration, absorption, transport, accumulation, and distribution of P elements; the opposite effects were observed in the 5 μM KH2PO4, ABA, and NaCl treatments. Correlation analysis showed that PbPHT1.9, PbPHT1.11, PbPHT1.17, PbPHT1.64, PbPHT4.7, and PbPHT5.4 were involved in the concentration, transport, and distribution of P. Our findings lay the foundation for future research on the function of the ‘duli’ PHT genes and in-depth identification of ‘duli’ abiotic-stress-resistant breeding candidate genes.

Supplementary Materials

The following supporting information can be downloaded at: https://www.mdpi.com/article/10.3390/agriculture15020199/s1, Table S1: Physicochemical properties, protein secondary structure, and subcellular localization prediction analysis of ‘duli’ PHT proteins.

Author Contributions

Y.Z. designed the experiments; S.Y. and W.Z. performed the experiments. S.Y. analyzed the data and wrote the manuscript. Y.Z. and W.Z. revised the manuscript. Y.Z. provided financing, materials, and laboratory apparatus. All authors have read and agreed to the published version of the manuscript.

Funding

This research was funded by the Pear Industrial Technology Engineering Research Center of the Ministry of Education.

Institutional Review Board Statement

Not applicable.

Data Availability Statement

Data are contained within this article.

Conflicts of Interest

The authors declare that there are no conflicts of interest.

References

  1. Lhamo, D.; Shao, Q.L.; Tang, R.J.; Luan, S. Genome-wide analysis of the five phosphate transporter families in Camelina sativa and their expressions in response to low-P. Int. J. Mol. Sci. 2020, 21, 8365. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  2. Ghodszad, L.; Reyhanitabar, A.; Oustan, S.; Alidokht, L. Phosphorus sorption and desorption characteristics of soils as affected by biochar. Soil Till. Res. 2022, 216, 105251. [Google Scholar] [CrossRef] [Scilit]
  3. Stewart, A.J.; Chapman, W.; Jenkins, G.I.; Graham, I.; Martin, T.; Crozier, A. The effect of nitrogen and phosphorus deficiency on flavonol accumulation in plant tissues. Plant Cell Environ. 2001, 24, 1189–1197. [Google Scholar] [CrossRef] [Scilit]
  4. Gu, M.; Chen, A.Q.; Sun, S.B.; Xu, G.H. Complex regulation of plant phosphate transporters and the gap between molecular mechanisms and practical application: What is missing? Mol.Plant 2016, 9, 396–416. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  5. Wang, D.L.Y.; Lv, S.L.; Jiang, P.; Li, Y.X. Roles, regulation, and agricultural application of plant phosphate transporters. Front. Plant Sci. 2017, 8, 817. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  6. Zhang, Y.; Hu, L.Z.; Yu, D.S.; Xu, K.D.; Zhang, J.; Li, X.L.; Wang, P.F.; Chen, G.; Liu, Z.H.; Peng, C.F.; et al. Integrative analysis of the wheat PHT1 gene family reveals a novel member involved in arbuscular mycorrhizal phosphate pransport and pmmunity. Cells 2019, 8, 490. [Google Scholar] [CrossRef] [Scilit]
  7. Misson, J.; Thibaud, M.C.; Bechtold, N.; Raghothama, K.; Nussaume, L. Transcriptional regulation and functional properties of Arabidopsis Pht1;4, a high affinity transporter contributing greatly to phosphate uptake in phosphate deprived plants. Plant Mol. Biol. 2004, 55, 727–741. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  8. Shin, H.; Shin, H.S.; Dewbre, G.R.; Harrison, M.J. Phosphate transport in Arabidopsis Pht1;1 and Pht1;4 play a major role in phosphate acquisition from both low- and high-phosphate environments. Plant J. 2004, 39, 629–642. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  9. Nagarajan, V.K.; Jain, A.; Poling, M.D.; Lewis, A.J.; Raghothama, K.G.; Smith, A.P. Arabidopsis Pht1;5 Mobilizes Phosphate between Source and Sink Organs and Influences the Interaction between Phosphate Homeostasis and Ethylene Signaling. Plant Physiol. 2011, 156, 1149–1163. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  10. Lin, W.Y.; Huang, T.K.; Chiou, T.J. Nitrogen limitation adaptation, a Target of microRNA827, mediates degradation of plasma membrane-localized phosphate transporters to maintain phosphate homeostasis in Arabidopsis. Plant Cell 2013, 25, 4061–4074. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  11. Takabatake, R.; Hata, S.; Taniguchi, M.; Kouchi, H.; Sugiyama, T.; Izui, K. Isolation and characterization of cDNAs encoding mitochondrial phosphate transporters in soybean, maize, rice, and Arabidopsis. Plant Mol. Biol. 1999, 40, 479–486. [Google Scholar] [CrossRef] [Scilit]
  12. Wang, G.Y.; Shi, J.L.; Ng, G.; Battle, S.L.; Zhang, C.; Lu, H. Circadian clock-regulated phosphate Transporter PHT4;1 plays an important role in Arabidopsis defense. Mol. Plant 2011, 4, 516–526. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  13. Irigoyen, S.; Karlsson, P.M.; Kuruvilla, J.; Spetea, C.; Versaw, W.K. The sink-specific plastidic phosphate transporter PHT4;2 influences starch accumulation and leaf size in arabidopsis. Plant Physiol. 2011, 157, 1765–1777. [Google Scholar] [CrossRef] [Scilit]
  14. Cubero, B.; Nakagawa, Y.; Jiang, X.Y.; Miura, K.J.; Li, F.; Raghothama, K.G.; Bressan, R.A.; Hasegawa, P.M.; Pardo, J.M. The phosphate transporter PHT4;6 is a determinant of salt tTolerance that is localized to the golgi apparatus of Arabidopsis. Mol. Plant 2009, 2, 535–552. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  15. Liu, T.Y.; Huang, T.K.; Yang, S.Y.; Hong, Y.T.; Huang, S.M.; Wang, F.N.; Chiang, S.F.; Tsai, S.Y.; Lu, W.C.; Chiou, T.J. Identification of plant vacuolar transporters mediating phosphate storage. Nat. Commun. 2016, 7, 11095. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  16. Luan, M.D.; Zhao, F.G.; Han, X.B.; Sun, G.F.; Yang, Y.; Liu, J.L.; Shi, J.S.; Fu, A.G.; Lan, W.Z.; Luan, S. Vacuolar phosphate transporters contribute to systemic phosphate homeostasis vital for reproductive development in Arabidopsis. Plant Physiol. 2019, 179, 640–655. [Google Scholar] [CrossRef] [Scilit]
  17. Shane, M.W.; McCully, M.E.; Lambers, H. Tissue and cellular phosphorus storage during development of phosphorus toxicity in Hakea prostrata (Proteaceae). J. Exp. Bot. 2004, 55, 1033–1044. [Google Scholar] [CrossRef] [Scilit]
  18. Sun, T.T.; Li, M.J.; Shao, Y.; Yu, L.W.; Ma, F.W. Comprehensive genomic identification and expression analysis of the phosphate transporter (PHT) gene family in apple. Front. Plant Sci. 2017, 8, 426. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  19. Rui, W.J.; Ma, J.; Wei, N.; Zhu, X.Y.; Li, Z.F. Genome-wide analysis of the PHT gene family and its response to mycorrhizal symbiosis in tomatoes under phosphate starvation conditions. Int. J. Mol. Sci. 2023, 24, 10246. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  20. Murugan, N.; Palanisamy, V.; Channappa, M.; Ramanathan, V.; Ramaswamy, M.; Govindakurup, H.; Chinnaswamy, A. Genome-wide in silico identification, structural analysis, promoter analysis, and expression profiling of PHT gene family in sugarcane root under salinity stress. Sustainability 2022, 14, 15893. [Google Scholar] [CrossRef] [Scilit]
  21. Ahmad, I.; Rawoof, A.; Islam, K.; Momo, J.; Ramchiary, N. Identification and expression analysis of phosphate transporter genes and metabolites in response to phosphate stress in capsicum annuum. Environ. Exp. Bot. 2021, 190, 104597. [Google Scholar] [CrossRef] [Scilit]
  22. Zhang, C.X.; Meng, S.; Li, M.J.; Zhao, Z. Genomic identification and expression analysis of the phosphate transporter gene family in poplar. Front. Plant Sci. 2016, 7, 1398. [Google Scholar] [CrossRef] [Scilit]
  23. Okumura, S.; Mitsukawa, N.; Shirano, Y.; Shibata, D. Phosphate transporter gene family of Arabidopsis thaliana. DNA Res. 1998, 5, 261–269. [Google Scholar] [CrossRef] [Scilit]
  24. Wang, J.H.; Yang, Y.; Liao, L.; Xu, J.W.; Liang, X.; Liu, W. Genome-wide identification and functional characterization of the phosphate transporter gene family in Sorghum. Biomolecules 2019, 9, 670. [Google Scholar] [CrossRef] [Scilit]
  25. Wan, Y.Y.; Wang, Z.; Xia, J.H.; Shen, S.L.; Guan, M.W.; Zhu, M.C.; Qiao, C.L.; Sun, F.J.; Liang, Y.; Li, J.; et al. Genome-wide analysis of phosphorus transporter genes in brassica and their roles in heavy metal stress tolerance. Int. J. Mol. Sci. 2020, 21, 2209. [Google Scholar] [CrossRef] [Scilit]
  26. Cao, D.; Liu, Y.L.; Ma, L.L.; Liu, Z.H.; Li, J.; Wen, B.B.; Zhang, X.N.; Yin, P.; Jin, X.F.; Huang, J.N. Genome-wide identification and characterization of phosphate transporter gene family members in tea plants (Camellia sinensis L. O. kuntze) under different selenite levels. Plant Physiol. Biochem. 2021, 166, 668–676. [Google Scholar] [CrossRef] [Scilit]
  27. Luo, S.C.; Xu, P.X.; Cheng, A.; Wang, X.; Xu, J.F.; Ma, H.; Zhang, Y.X.; Zhang, H.X. Comprehensive analysis of the bZIP gene family in ‘Duli’ pear (Pyrus betulifolia Bunge): Insights for research on abiotic stress, especially drought, in pear. Sci. Hortic. 2024, 334, 113302. [Google Scholar] [CrossRef] [Scilit]
  28. Chen, G.D.; Li, Y.; Jin, C.; Wang, J.Z.; Wang, L.; Wu, J.Y. Physiological and morphological responses of hydroponically grown pear rootstock under phosphorus treatment. Front. Plant Sci. 2021, 12, 696045. [Google Scholar] [CrossRef] [Scilit]
  29. Song, K.; Qin, Q.; Yang, Y.F.; Sun, L.J.; Sun, Y.F.; Zheng, X.Q.; Lu, W.G.; Xue, Y. Drip fertigation and plant hedgerows significantly reduce nitrogen and phosphorus losses and maintain high fruit yields in intensive orchards. J. Integr. Agr. 2023, 22, 598–610. [Google Scholar] [CrossRef] [Scilit]
  30. Zhang, W.L.; Yuan, S.; Liu, N.; Zhang, H.X.; Zhang, Y.X. Glutamine synthetase and glutamate synthase family perform diverse physiological functions in exogenous hormones and abiotic stress responses in Pyrus betulifolia Bunge (P.be). Plants 2024, 13, 2759. [Google Scholar] [CrossRef] [Scilit]
  31. Zhang, W.L.; Cheng, X.H.; Jing, Z.T.; Cao, Y.; Yuan, S.; Zhang, H.X.; Zhang, Y.X. Exogenous GA3 enhances nitrogen uptake and metabolism under low nitrate conditions in ‘Duli’ (Pyrus betulifolia Bunge) seedlings. Int. J. Mol. Sci. 2024, 25, 7967. [Google Scholar] [CrossRef] [Scilit]
  32. Yuan, S.; Zhang, W.L.; Zhang, Y.X. Characterization of SUPPRESSOR OF MAX2 1-LIKE (SMXL) Genes in ‘duli’ (Pyrus betulifolia L.) and Expression Analysis of PbSMXLs in Response to Plant Growth Regulators and Salt Stress. Agronomy 2024, 14, 2778. [Google Scholar] [CrossRef] [Scilit]
  33. Liang, B.W.; Ma, C.Q.; Zhang, Z.J.; Wei, Z.W.; Gao, T.T.; Zhao, Q.; Ma, F.W.; Li, C. Long-term exogenous application of melatonin improves nutrient uptake fluxes in apple plants under moderate drought stress. Environ. Exp Bot. 2018, 155, 650–661. [Google Scholar] [CrossRef] [Scilit]
  34. Liang, B.W.; Gao, T.T.; Zhao, Q.; Ma, C.Q.; Chen, Q.; Wei, Z.W.; Li, C.Y.; Li, C.; Ma, F.W. Effects of exogenous dopamine on the uptake, transport, and resorption of apple ionome under moderate drought. Plant Sci. 2018, 9, 755. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  35. Ji, J.H.; He, X.L.; Liu, H.T.; Li, Z.Y.; Zhou, S.S.; Zhang, X.Y.; Xu, J.Z.; Liang, B.W. Influence of dwarfing interstock on the tolerance and nutrient utilization efficiency of apple trees under drought stress. Sci. Hortic. 2023, 315, 111984. [Google Scholar] [CrossRef] [Scilit]
  36. Sun, Y.M.; Jia, X.Y.; Yang, Z.R.; Fu, Q.J.; Yang, H.H.; Xu, X.Y. Genome-wide identification of PEBP gene family in Solanum lycopersicum. Int. J. Mol. Sci. 2023, 24, 9185. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  37. Rae, A.L.; Cybinski, D.H.; Jarmey, J.M.; Smith, F.W. Characterization of two phosphate transporters from barley; evidence for diverse function and kinetic properties among members of the Pht1 family. Plant Mol. Biol. 2003, 53, 27–36. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  38. Teng, W.; Zhao, Y.Y.; Zhao, X.Q.; He, X.; Ma, W.Y.; Deng, Y.; Chen, X.P.; Tong, Y.P. Genome-wide identification, characterization, and expression analysis of PHT1 phosphate transporters in wheat. Front. Plant Sci. 2017, 8, 543. [Google Scholar] [CrossRef] [Scilit]
  39. Pudake, R.N.; Mehta, C.M.; Mohanta, T.K.; Sharma, S.; Varma, A.; Sharma, A.K. Expression of four phosphate transporter genes from finger millet (Eleusine coracana L.) in response to mycorrhizal colonization and Pi stress. 3 Biotech 2017, 7, 17. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  40. Wang, L.; Xiao, L.; Yang, H.Y.; Chen, G.L.; Zeng, H.Q.; Zhao, H.Y.; Zhu, Y.Y. Genome-wide identification, eexpression profiling, and evolution of phosphate transporter gene family in green algae. Front. Genet. 2020, 11, 590947. [Google Scholar] [CrossRef] [Scilit]
  41. Aslam, M.M.; Waseem, M.; Xu, W.; ul Qamar, M.T. Identification and expression analysis of phosphate transporter (PHT) gene family in Lupinus albus cluster root under phosphorus stress. Int. J. Biol. Macromol. 2022, 205, 772–781. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  42. Roy, S.W.; Gilbert, W. The evolution of spliceosomal introns: Patterns, puzzles and progress. Nat. Rev. Genet. 2006, 7, 211–221. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  43. Roy, S.W.; Penny, D. A very high fraction of unique intron positions in the intron-rich diatom Thalassiosira pseudonana indicates widespread intron gain. Mol. Biol. Evol. 2007, 24, 1447–1457. [Google Scholar] [CrossRef] [Scilit]
  44. Mudge, S.R.; Rae, A.L.; Diatloff, E.; Smith, F.W. Expression analysis suggests novel roles for members of the Pht1 family of phosphate transporters in Arabidopsis. Plant J. 2002, 31, 341–353. [Google Scholar] [CrossRef] [Scilit]
  45. Schünmann, P.H.D.; Richardson, A.E.; Smith, F.W.; Delhaize, E. Characterization of promoter expression patterns derived from the Pht1 phosphate transporter genes of barley (Hordeum vulgare L.). J. Exp. Bot. 2004, 55, 855–865. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  46. Hu, A.Q.; Zhao, Q.Q.; Chen, L.; Zhao, J.P.; Wang, Y.H.; Feng, K.L.; Wu, L.; Xie, M.; Zhou, X.M.; Xiao, L.T.; et al. Identification of Conserved and Divergent Strigolactone Receptors in Sugarcane Reveals a Key Residue Crucial for Plant Branching Control. Front. Plant Sci. 2021, 12, 747160. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  47. Chu, M.Y.; Wang, T.Y.; Li, W.T.; Liu, Y.S.; Bian, Z.Y.; Mao, J.; Chen, B.H. Genome-wide identification and analysis of the genes encoding Q-Type C2H2 zinc finger proteins in grapevine. Int. J. Mol. Sci. 2023, 24, 15180. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  48. Zhu, W.; Miao, Q.; Sun, D.; Yang, G.; Wu, C.; Huang, J.; Zheng, C. The mitochondrial phosphate transporters modulate plant responses to salt stress via affecting ATP and gibberellin metabolism in Arabidopsis thaliana. PLoS ONE 2012, 7, e43530. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  49. Nagy, R.; Karandashov, V.; Chague, V.; Kalinkevich, K.; Tamasloukht, M.; Xu, G.; Jakobsen, I.; Levy, A.A.; Amrhein, N.; Bucher, M. The characterization of novel mycorrhiza-specific phosphate transporters from Lycopersicon esculentum and Solanum tuberosum uncovers functional redundancy in symbiotic phosphate transport in solanaceous species. Plant J. 2005, 42, 236–250. [Google Scholar] [CrossRef] [Scilit]
  50. Javot, H.; Pumplin, N.; Harrison, M.J. Phosphate in the arbuscular mycorrhizal symbiosis: Transport properties and regulatory roles. Plant Cell Environ. 2007, 30, 310–322. [Google Scholar] [CrossRef] [Scilit] [PubMed]
Figure 1. Phylogenetic analysis of PHT proteins. Light blue indicates the PHT1 family. Light red indicates the PHT2 family. Pink indicates the PHT3 family. Light yellow indicates the PHT4 family. Light green indicates the PHT5 family. Grey circles indicate Pyrus betulifolia Bunge (Pb), and black pentagrams indicate Arabidopsis thaliana (At).
Figure 1. Phylogenetic analysis of PHT proteins. Light blue indicates the PHT1 family. Light red indicates the PHT2 family. Pink indicates the PHT3 family. Light yellow indicates the PHT4 family. Light green indicates the PHT5 family. Grey circles indicate Pyrus betulifolia Bunge (Pb), and black pentagrams indicate Arabidopsis thaliana (At).
Agriculture 15 00199 g001
Figure 2. Gene replication and chromosome localization analysis of PbPHTs. (A) Collinearity analysis of PbPHTs. The outermost rectangular block represents the chromosomal skeleton, and the other three rectangular blocks represent the gene density of each chromosome. (B) The location of PbPHTs on chromosomes (Chr 01–Chr 08). (C) The location of PbPHTs on chromosomes (Chr 09–Chr 17).
Figure 2. Gene replication and chromosome localization analysis of PbPHTs. (A) Collinearity analysis of PbPHTs. The outermost rectangular block represents the chromosomal skeleton, and the other three rectangular blocks represent the gene density of each chromosome. (B) The location of PbPHTs on chromosomes (Chr 01–Chr 08). (C) The location of PbPHTs on chromosomes (Chr 09–Chr 17).
Agriculture 15 00199 g002
Figure 3. Conserved motifs and gene structure of PbPHTs. (A) Conserved motif and gene structure of PbPHTs. Yellow rectangles indicate UTR, and green rectangles indicate CDS. (B) Protein motifs (Motif 1–20).
Figure 3. Conserved motifs and gene structure of PbPHTs. (A) Conserved motif and gene structure of PbPHTs. Yellow rectangles indicate UTR, and green rectangles indicate CDS. (B) Protein motifs (Motif 1–20).
Agriculture 15 00199 g003
Figure 4. Cis-acting element analysis of PbPHTs. (A) The number of cis-acting elements in PbPHTs. The numbers inside the table cells indicate the numbers of cis-acting elements of the PbPHTs. The shade of red indicates the number of cis-acting elements in the PbPHT genes. (B) The distribution of cis-acting elements of PbPHTs. Rectangles of different colors represent different cis-acting elements.
Figure 4. Cis-acting element analysis of PbPHTs. (A) The number of cis-acting elements in PbPHTs. The numbers inside the table cells indicate the numbers of cis-acting elements of the PbPHTs. The shade of red indicates the number of cis-acting elements in the PbPHT genes. (B) The distribution of cis-acting elements of PbPHTs. Rectangles of different colors represent different cis-acting elements.
Agriculture 15 00199 g004
Figure 5. Expression patterns of PbPHTs in multiple tissues. The different lowercase letters indicate distinctiveness between the roots and other tissues. Different letters indicate significant differences, and the same letters indicate no significant differences at p < 0.05.
Figure 5. Expression patterns of PbPHTs in multiple tissues. The different lowercase letters indicate distinctiveness between the roots and other tissues. Different letters indicate significant differences, and the same letters indicate no significant differences at p < 0.05.
Agriculture 15 00199 g005
Figure 6. Expression analysis of PbPHT genes in response to hormone, salt, and phosphorus stress: (A) 0.5 mM KH2PO4 treatment, (B) 5 mM KH2PO4 treatment, (C) 5 μM KH2PO4 treatment, (D) NaCl treatment, (E) GR24 treatment, (F) GA3 treatment, (G) IAA treatment, (H) ABA treatment. Different lowercase letters indicate distinctiveness between CK (0 h) and others (24 h, 48 h, and 168 h). Different letters indicate significant differences, and the same letters indicate no significant differences at p < 0.05.
Figure 6. Expression analysis of PbPHT genes in response to hormone, salt, and phosphorus stress: (A) 0.5 mM KH2PO4 treatment, (B) 5 mM KH2PO4 treatment, (C) 5 μM KH2PO4 treatment, (D) NaCl treatment, (E) GR24 treatment, (F) GA3 treatment, (G) IAA treatment, (H) ABA treatment. Different lowercase letters indicate distinctiveness between CK (0 h) and others (24 h, 48 h, and 168 h). Different letters indicate significant differences, and the same letters indicate no significant differences at p < 0.05.
Agriculture 15 00199 g006
Figure 7. The content, absorption, transfer, and distribution of P elements in ‘duli’. (A) The concentration of P elements (roots, leaves, and stems) in ‘duli’ plants. Different lowercase letters indicate distinctiveness between the roots and other tissues. (B) The absorption of P elements in ‘duli’ plants. Different colored columns indicate different stress treatments. (C) The transport (leaves and stems) and accumulation (roots) of P elements in ‘duli’ plants. (D) The distribution of P elements in ‘duli’ plants. Different letters indicate significant differences, and the same letters indicate no significant differences at p < 0.05.
Figure 7. The content, absorption, transfer, and distribution of P elements in ‘duli’. (A) The concentration of P elements (roots, leaves, and stems) in ‘duli’ plants. Different lowercase letters indicate distinctiveness between the roots and other tissues. (B) The absorption of P elements in ‘duli’ plants. Different colored columns indicate different stress treatments. (C) The transport (leaves and stems) and accumulation (roots) of P elements in ‘duli’ plants. (D) The distribution of P elements in ‘duli’ plants. Different letters indicate significant differences, and the same letters indicate no significant differences at p < 0.05.
Agriculture 15 00199 g007
Figure 8. Correlation analysis between the expression levels of 15 PbPHTs and 10 physiological indexes. The numbers inside the table cells represent the correlation coefficients.
Figure 8. Correlation analysis between the expression levels of 15 PbPHTs and 10 physiological indexes. The numbers inside the table cells represent the correlation coefficients.
Agriculture 15 00199 g008
Table 1. ‘Duli’ PHT family members and qRT−PCR primer design.
Table 1. ‘Duli’ PHT family members and qRT−PCR primer design.
Gene NameForward Primer 5′-3′Reverse Primer 5′-3′
PbPHT1.9CGTTTGTTGTGCCAGTGGAGGCCTTAGCCGGGTCTTGATT
PbPHT1.11CGTAGCCGTTGGAGTTGTCAGTAAGACCCACACCGAGCAA
PbPHT1.17ATGTTCGGCCGATTTGTTGCCGAGCCGTCCACCAACG
PbPHT1.64TGGTGCATCGGTGATGGATAAGATGCCTTGTGTGCCAAGT
PbPHT2.2CATTTGCTCATGGCGGGAATTCGGAATAACAATCTCCGGACC
PbPHT3.32CACAGCACATGATCTGGAGAGAAGGAGTGTCTTCGCCGTTTT
PbPHT3.34ATGATCAGAGAGAGCGCGGATCGCGGATAAAAATGCGGC
PbPHT3.49CTGTGAAGAACATTGGCCTTGTCCACTAGATGGCAGTCCACA
PbPHT3.66CCACGCCGTTGTTTTTGTCTTCATAGCACGCGATCCCTTC
PbPHT4.5TGCTGTTTCGTTCGCGTTTCGACTCCGCTTCCAAATGCTT
PbPHT4.7ACCACGTTGACCTCAGACAAAGTAAGCCAAGCAGATGCGA
PbPHT4.11AGGAAATCGTAAAAGGACCTATGCGTACAATCACCCAGCGCCTA
PbPHT5.2TGCCTTTGGGAAAAAGCTGAATTCCAACAGGAAAAGGACGATAA
PbPHT5.3TTCGGGAAGAAGTTGCGAGAAGAGGCTTTCCCGTGGAACAT
PbPHT5.4TTCGGGAAGAAGTTGCGAGAAGCTTGCTAGCACTCCTTGTT
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Yuan, S.; Zhang, W.; Zhang, Y. Characterization of PHT Genes in ‘duli’ (Pyrus betulifolia Bunge) and Expression Analysis of PbPHTs in Response to Plant Growth Regulators, P, and Salt Stress. Agriculture 2025, 15, 199. https://doi.org/10.3390/agriculture15020199

AMA Style

Yuan S, Zhang W, Zhang Y. Characterization of PHT Genes in ‘duli’ (Pyrus betulifolia Bunge) and Expression Analysis of PbPHTs in Response to Plant Growth Regulators, P, and Salt Stress. Agriculture. 2025; 15(2):199. https://doi.org/10.3390/agriculture15020199

Chicago/Turabian Style

Yuan, Shuai, Weilong Zhang, and Yuxing Zhang. 2025. "Characterization of PHT Genes in ‘duli’ (Pyrus betulifolia Bunge) and Expression Analysis of PbPHTs in Response to Plant Growth Regulators, P, and Salt Stress" Agriculture 15, no. 2: 199. https://doi.org/10.3390/agriculture15020199

APA Style

Yuan, S., Zhang, W., & Zhang, Y. (2025). Characterization of PHT Genes in ‘duli’ (Pyrus betulifolia Bunge) and Expression Analysis of PbPHTs in Response to Plant Growth Regulators, P, and Salt Stress. Agriculture, 15(2), 199. https://doi.org/10.3390/agriculture15020199

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop