Next Article in Journal
Effects of Indoor Temperature, Relative Humidity, and Carbon Dioxide Conditions on Wean-to-Finish Swine Survivability
Previous Article in Journal
Phosphorus Dynamics in High-Legacy Soils: Acid Phosphatase Activity, Extraction Techniques and Isotherm in Florida Potato Fields
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Agriculture
Volume 15
Issue 19
10.3390/agriculture15192049
agriculture-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Sustainable Wireworm Control in Wheat via Selected Bacillus thuringiensis Strains: A Biocontrol Perspective

by
Marina Dervišević Milenković
1,
Magdalena Knežević
2,
Marina Jovković
2,
Jelena Maksimović
2,
Uroš Buzurović
2,
Jelena Pavlović
2,* and
Aneta Buntić
2
1
Institute of Pesticides and Environmental Protection, Banatska 31b, 11080 Belgrade, Serbia
2
Institute of Soil Science, Teodora Drajzera 7, 11000 Belgrade, Serbia
*
Author to whom correspondence should be addressed.
Agriculture 2025, 15(19), 2049; https://doi.org/10.3390/agriculture15192049
Submission received: 30 July 2025 / Revised: 26 September 2025 / Accepted: 28 September 2025 / Published: 29 September 2025
(This article belongs to the Section Crop Protection, Diseases, Pests and Weeds)
Browse Figures
Versions Notes

Abstract

Wireworms are often referred as a hardly manageable group of pests due to their unstable lifestyle and uneven distribution in soils. The current strategy of wireworm control involves the heavy use of chemical pesticides. To find an effective and eco-friendly biological control agent against wireworms, evaluation of bacterial properties and insecticidal effects of six Bacillus thuringiensis (Bt) strains against Agriotes lineatus was performed under laboratory conditions. The presence of cry11, cyt2 and krsA gene was detected in Bt strain BHC 2.4, while the same strain had the ability to produce siderophores, protease, amylase and cellulase. Single inoculums of Bt strains (BHC 2.4; BHC 4.5; BHC 4.7; 1.5; 4.3; 6.1) showed mortality against Agriotes lineatus larvae in the range of 6.67–72.22%. However, the compatible Bt dual cultures showed significantly higher efficiency in comparison with the single inoculums, with the highest efficiency of 79.63% recorded for Bt strain BHC 2.4 + Bt strain 1.5. The efficiency of applied Bt strains might be associated with the presence of genes coding for antibiotics and toxins. Therefore, the use of selected Bt strains applied in a form of compatible mixes could offer a sustainable solution for wireworm management in wheat.

Graphical Abstract

1. Introduction

Wireworms are a significant group of soil pests that feed on underground parts of a wide range of crops, including vegetables, cereals, ornamental and wild plant species [1]. Among wireworms, Agriotes lineatus is one of the most economically important pest species, which can lead to reduced growth of crops, while the yield losses can reach up to 70% [2]. Control of wireworms is a highly challenging process, due to their complex and variable life cycle and uneven distribution in soils [2]. Additionally, an increase in the Agriotes lineatus problem has been partly attributed to the discontinuation of previously used insecticides, such as organochlorines, carbamates and organophosphates [3,4]. In addition to the insufficient efficacy and the risk of resistance development in target pests, the excessive use of insecticides results in environmental contamination through leaching into soil and water, adverse effects on non-target organisms (including pollinators and natural enemies) and accumulation of toxic residues, which together amplify the negative ecological footprint of conventional pest management [5].
Although most farmers still use soil insecticides or insecticide-treated seeds when planting their crops, sustainable agricultural practices, such as a reduction in chemical use for wireworm control, have begun to be more commonly adopted. Some species of entomopathogenic fungi (Beauveria spp. and Metarhizium spp.) are being reported to infect both larval and adult stages of Agriotes lineatus and have been used as biocontrol agents against these pests [6,7,8]. Nematodes have also been tested against Agriotes lineatus, but their effectiveness can be limited by many factors, such as species properties, soil type and agro-ecological properties of the location [9,10]. The use of bacteria appears to be the least studied alternative in wireworm control, although they have been known to successfully control other harmful insects [11]. Danismazoglu et al. [12] indicated that some wireworm-associated bacteria, including B. thuringiensis, seemed to be good candidates as possible microbial agents against A. lineatus in potato.
Bacillus thuringiensis (Bt) has been previously known for its ability to produce a variety of proteins with insecticidal activity (Cry, Vip, Cyt) [13,14]. In general, insecticidal proteins become toxic for the insect after ingestion. Namely, Cry proteins bind to epithelial cells in the insects’ midgut, resulting in pore formation, cell lysis and ultimately the death of the larvae [15,16]. Cry toxins produced by Bt are highly specific, and are harmless to animals, humans and plants, while their property to completely degrade indicates that no toxic products are left behind. In addition, Bt strains produce numerous extracellular compounds, such as exotoxins and vegetative insecticidal proteins, which may contribute to virulence [17]. In crops such as cereals, the germinating seeds need to be protected against Agriotes lineatus, as the early stage of plant development represents the most critical phase for susceptibility to wireworm damage [18]. Among Bacillus species, Bt strains have been the most studied, and their activity is almost exclusively aimed against larval stages of different insects [11,19]. However, the use of B. thuringiensis in the biocontrol of Agriotes lineatus larvae has not been comprehensively studied yet. In addition to the insecticidal activity of Bt, certain bacterial traits associated with biocontrol potential against phytopathogenic fungi and plant growth promotion—such as the ability to solubilize inorganic phosphates, produce siderophores or synthesize other bioactive metabolites—are highly relevant when designing effective inoculants for agricultural applications [20,21]. These traits not only support plant nutrition and growth but also enhance the persistence and competitiveness of the bacteria in the complex soil environment, enabling them to better establish in the rhizosphere and maintain efficacy under natural conditions. Hence, consideration of both biocontrol potential and plant growth-promoting characteristics is essential for selecting strains that can provide dual benefits in crop protection and soil health. Therefore, the aim of this study was to evaluate the insecticidal effect of Bacillus thuringiensis strains (BHC 2.4, BHC 4.5, BHC 4.7, 1.5, 4.3 and 6.1) against agricultural pest (Agriotes lineatus larvae). The presence of genes coding for antibiotics (fenD, bmyB, ituC, srfAA, bacA, spaS and krsA) and toxins (cry11, cry1B, vip1, vip2, cyt1 and cyt2) was tested in Bt strains, together with enzyme production and other bacterial properties significant for inoculant formulation (siderophore production and phosphate solubilization). The mortality of Agriotes lineatus larvae influenced by bacterial inoculation was evaluated under laboratory conditions.

2. Materials and Methods

2.1. Insect Sampling

Agriotes lineatus larvae were collected from a commercial cereal field located in Smederevska Palanka, Serbia (42°21′17″, 20°56′55″) where an increased abundance of A. lineatus had been observed in previous years. Insect collection was conducted using a modified method described by Morales-Rodriguez et al. [22]. Traps were constructed by filling socks with 200 g of a seed mixture, consisting of wheat (Triticum aestivum L.) and barley (Hordeum vulgare L.) in a 1:1 v/v ratio. Filled socks were then soaked in water for 24 h prior to field placement to initiate seed germination (Figure S1). A total of 20 traps were randomly distributed across the plot, maintaining a distance of at least 5 m between each trap, and were buried so that the top was 5–10 cm below the soil surface. Traps were deployed in early April when soil temperatures reached approximately 10 °C and larvae were feeding near the soil surface due to adequate moisture and temperature. After 14 days, traps were recovered and transported to the laboratory, where their contents were carefully sieved to extract wireworm larvae. When sieving did not allow the complete wireworm isolation, larvae were collected by hand sorting. In addition, isolated larvae were confirmed as A. lineatus based on the identification protocol described by the literature [23]. Larvae were then placed in 3 L jars containing finely sieved soil and wheat germ to simulate natural conditions. Potato slices were also added to provide an easily accessible food source. The larvae were stored under these conditions at room temperature in a dark place, until the moment of use in bioassays.

2.2. Bioagents and Preparation of Working Cultures

The isolation of new bacterial isolates from two soil samples obtained in Smederevska Palanka, Serbia (42°21′17″, 20°56′55″) and Lazarevac, Serbia (44°22′28″, 20°15′30″) was carried out based on the serial dilution method, where the isolation was performed by inoculating 1 mL of 10−5 of soil suspension dilution to Petri dishes with nutrient agar (NA) (BioLife, Milan, Italy). To obtain the pure cultures of B. thuringiensis isolates, colonies with characteristic morphology (large, white to creamy colonies with irregular margins) were re-streaked several times on nutrient agar (NA) and maintained on inclined NA at 4 °C until further use. From a total of 129 bacterial isolates obtained from two rhizosphere soil samples, only those with Bt-like morphology were selected for this study (BHC 2.4, BHC 4.5 and BHC 4.7). In addition, three previously characterized Bt strains (1.5, 4.3 and 6.1) [24] were included, since the aim of this research was specifically focused on B. thuringiensis. For the detection of bacterial properties and compatibility tests, working cultures of bacterial strains were freshly prepared in nutrient broth (BioLife, Milan, Italy) in an orbital shaker (24 h, 130 rpm, 25 °C) (BioBase, Jinan, China) until the concentration of approximate 109 CFU mL−1 was reached, or in an incubator (BioBase, Jinan, China) (24 h, 28 °C).

2.3. Molecular Identification of Bacterial Isolates

Isolation of the total bacterial DNA was performed as described by Dimkić et al. [25]. Identification of isolates was performed based on the 16S RNA gene sequence by using P0 (5′-GAGAGTTTGATCCTGGCTCAG-3′) and P6 (5′-CTACGGCTACCTTGTTACGA-3′) primers (Metabion, Planegg, Bavaria, Germany), following a method previously described by Oro et al. [26]. After the sequence amplification, PCR products were purified and sequenced by using a commercial service (Macrogen Europe). The obtained 16S rRNA gene sequences were manually checked for quality based on the obtained chromatograms and deposited to the National Center for Biotechnology Information database (NCBI) to obtain accession numbers. The Neighbour-Joining (NJ) phylogenetic tree was constructed in the Mega V.11 program. Prior to phylogenetic tree construction, DNA sequences were aligned by the ClustalW function, and the Kimura two-parameter nucleotide substitution model was used to calculate genetic distances. The phylogenetic position of the three tested isolates from this study was determined in relation to the other Bacillus species (NR_041455.1, NR_113991.1, NR_113945.1, NR_112629.1, NR_112630.1, NR_114581.1, NR_043403.1, NR_112780.1, NR_117473.1). The tree was rooted with Methanobacterium espanolae (NR_104983.1).

2.4. Detection of Antibiotic- and Toxin-Producing Bacterial Genes

Bacterial isolates were screened for the presence of genes associated with the biosynthesis of different antibiotics, such as fenD (fengycin), bmyB (bacyllomicin), ituC (iturin), srfAA (surfactin), bacA (bacylisin), spaS (subtilin) and krsA (kurstakin), by using previously described PCR protocols [27,28]. Also, the presence of cry11 and cry1B (crystal protein) genes was tested by using the protocol described by Jain et al. [29] and Thammasittirong and Attathom [30], while the presence of vip1 and vip2 (vegetative insecticidal protein synthetase) was tested as described in Senthilkumar et al. [31]. The presence of cyt1 and cyt2 (cytolytic toxin synthetase) was evaluated based on Ibarra et al. [32].
All PCR (Eppendorf, Hamburg, Germany) amplifications were performed in a total reaction volume of 25 mL consisting of the following PCR components: 12.5 mL of PCR TaqNova-RED Master Mix (2X) (Qiagen, Hilden, Germany), 9.5 mL of PCR-grade water, 1 mL of primers (forward and reverse) and 1 mL of bacterial DNA. The obtained PCR amplicons were checked on the transilluminator (Hoefer, Holliston, MA, USA) for the presence of a band at the expected position in relation to the 100–10,000 bp DNA ladder (Thermo Fisher Scientific, Waltham, MA, USA), and the presence/absence of the band was considered a positive/negative reaction. The list of all DNA primers used in this study, as well the expected lengths of obtained PCR products, is presented in Table 1.

2.5. Detection of Bacterial Properties

2.5.1. Phosphate Solubilization and Siderophore Production

To evaluate additional traits potentially relevant for bacterial survival and efficacy in the soil, Bt isolates were tested for their ability to solubilize inorganic phosphates and produce siderophores. Although these traits are not directly linked to insecticidal activity of bacteria, they may enhance bacterial persistence and colonization in the rhizosphere, thereby supporting the long-term effectiveness of Bt strains as inoculants in agricultural soils. Phosphate solubilization capacity of bacterial strains was investigated by using the methodology described in Rokhbakhsh-Zamin et al. [33]. Strains were grown on Pikovskaya medium, and the appearance of a halo zone around the bacterial growth (7 days, 28 °C) was considered a positive result. Siderophore production was determined by growing bacterial strains on Chrome Azurol S (CAS) (Fluka, Buchs, Switzerland) Blue agar (5 days, 28 °C) [34]. A change in the color of the CAS agar from blue to yellow was considered a positive result.

2.5.2. Enzymatic Activity

The production of extracellular protease, lipase, cellulase and amylase was evaluated qualitatively. Bacterial strains were spot inoculated on skim milk agar (SMA, 3%), on NA medium amended with Tween 80 (Sigma-Aldrich, St. Louis, MO, USA) [35] and on a medium supplemented with 1 g L−1 of carboxymethyl cellulose (Thermo Fisher Scientific, Waltham, MA, USA) or starch (Lach:Ner, Brno, Czech Republic) [36] for the production of protease, lipase, cellulase and amylase activity, respectively. After an incubation period (3–5 days, 28 °C), the development of a clear zone around the bacterial growth indicates the production of protease, cellulase and amylase, while the presence of calcium complex precipitate around the inoculation site was considered as a positive result for lipolytic activity of isolates.
For the tested bacterial properties (phosphate solubilization and enzymatic activity), results (halo zone radius) were expressed by using the following designations: no production (no halo zone radius); + low production (halo zone radius up to 5 mm); ++ moderate production (halo zone radius up to 10 mm); +++ high production (halo zone radius above 10 mm).

2.6. Compatibility of Bacterial Strains

The compatibility of bacterial strains and their potential to be applied in a form of mixed cultures was evaluated by a modified well diffusion method. Sterile molds for the wells were placed on the solid NA, and 7 mL of NA soft agar inoculated with 100 µL (109 CFU mL−1) of the appropriate strain was added. Plates were kept at room temperature for 2 h in order for agar to solidify, and 20 µL of different bacterial cultures was applied in the wells. Plates were then incubated at 28 °C for 24 h. The strains were considered compatible if no halo zone (growth inhibition) appeared around the wells, and mixtures of compatible strains were selected for the following bioassay.

2.7. Bioassays

For the seed inoculation, the single bacterial cultures were applied, as well as the mixes (dual bacterial inoculum) of different strains in a proportion of 1:1. For the bioassays, bacterial cultures were grown in nutrient broth for 96 h at 28 °C, on a rotary shaker. Wheat seeds were soaked for 5 min in the prepared bacterial suspension (30 mL, 109 CFU mL−1) and then dried at room temperature. After that, 100 seeds were placed into Petri dishes including sterile soil (approximately 200 g) in order to mimic natural conditions, and they were left for 72 h to initiate germination. The A. lineatus larvae (approximately 15–20 mm in length), visually inspected and confirmed to be healthy and active, were then added. To reduce variability, larvae that were found to have fed on potato slices at the time of selection were used for the bioassays, and in order to increase their sensitivity on bacterial isolates in bioassays, the larvae were left without food for 48 h [37]. Each treatment was replicated three times, and in the control treatment, wheat seeds were soaked in sterile distilled water. The Petri dishes were stored at room temperature in a dark place, and they were checked for mortality daily until 10 days after treatment. The mortality was determined by touching the larvae with a soft brush and observing their response, such as leg movement, body contractions or convulsions. In order to confirm the presence of the bacterial isolates in the cadavers of treated A. lineatus larvae, isolation of bacteria was conducted based on the procedure previously described in the literature [12], followed by morphological identification of isolated bacteria.

2.8. Data Analysis

Mortality data were corrected according to Abbott’s formula [38]. One-way ANOVA (post hoc: Duncan) was applied to determine the significance of the differences among the average efficacy of individual treatments. Data were expressed as mean ± SD.

3. Results

3.1. Molecular Identification of Bacterial Isolates

Based on the NJ tree, three tested isolates were identified as Bacillus thuringiensis (Figure 1). The obtained sequences were deposited to the NCBI database under the following accession numbers: B. thuringiensis BHC 2.4—PV018794; B. thuringiensis BHC 4.5—PV018795; and B. thuringiensis BHC 4.7—PV018839.

3.2. Detection of Antibiotic- and Toxin-Producing Bacterial Genes

The results of PCR testing showed that Bt strains BHC 2.4, BHC 4.5 and BHC 4.7 do not have the ability to produce antibiotics such as surfactin, bacylisin, fengycin, bacillomycin and iturin C (Table S1). Out of the previously identified strains, the gene for bacylisin was detected for strain Bt 4.3 in our previous research [24]. Bacillus thuringiensis strain BHC 2.4 was the only strain positive for the presence of kurstakin. In addition, the presence of cry11 and cyt2 genes was confirmed only for the Bt strain BHC 2.4, while B. thuringiensis strains BHC 4.5, 4.7, 1.5 and 4.3 were positive for the presence of cry1B gene (Table 2). On the other hand, the presence of vip1 and vip2 genes was not detected in tested strains.

3.3. Bacterial Properties of Tested Bacillus thuringiensis Strains

The results of the qualitative and quantitative tests for the PGP and biocontrol traits of six B. thuringiensis strains are presented in Table 3. Out of the six tested strains, only two Bt strains (BHC 4.5 and BHC 4.7) were able to solubilize phosphates. Among the new Bt strains, BHC 2.4 was the highest siderophore producer, followed by Bt strains BHC 4.5 and BHC 4.7. The ability to produce amylase, cellulase and protease was confirmed for all tested strains, where Bt strain BHC 2.4 showed the highest potential for the production of extracellular enzymes. Lipase activity was confirmed only for Bt strain BHC 4.5.

3.4. Compatibility of Bacillus thuringiensis Strains

The compatibility of the six tested Bt strains for their potential application in a form of mixed culture is presented in Table 4.
According to the well diffusion test, Bt strains 1.5 and 4.3 showed compatibility with two strains. On the other hand, Bt strains BHC 2.4, BHC 4.5 and BHC 4.7 were compatible with only one strain. Bacillus thuringiensis strain 6.1 was not compatible with other tested strains. Besides single-strain inoculums, the selection of strains to be used in a form of mixture (dual bacterial inoculum) in the wireworm bioassay was determined: mix 1: BHC 2.4 + 1.5; mix 2: BHC 2.4 + 4.3; mix 3: BHC 4.7 + BHC 4.5; mix 4: BHC 4.7 + 4.3; mix 5: 1.5 + 4.3.

3.5. Biological Control of Agriotes lineatus Larvae

In bioassays, the activity of six bacterial strains against A. lineatus larvae was individually evaluated. All tested strains exhibited higher mortality rates than the control group. Based on the mortality data in the treatments with individual isolates (Figure 2), it can be concluded that the highest average efficiency of 72.22% was recorded in the treatment with the Bt BHC 2.4. It was followed by Bt strains 1.5 and 4.3, with an efficiency of 61.85% and 58.89%, respectively. The lowest average value for individual mortality was recorded for Bt strain BHC 4.5 (6.67%). The isolation of bacteria from treated A. lineatus cadavers showed that the bacterial strains with specific Bt morphology (Gram-positive cells with round, white colonies with raised elevation) were represented in all treatments.
In treatments with dual cultures (mixes), it was determined that the highest average efficiency of 79.63% was achieved with mix 1 (BHC 2.4 + 1.5). After that, mix 2 (BHC 2.4 + 4.3) showed an efficiency of 72.60% followed by mix 5 (1.5 + 4.3—65.56%), which were different from mix 3 (BHC 4.7 + BHC 4.5) and mix 4 (BHC 4.7 + 4.3—44.81%) (Figure 2).

4. Discussion

The mode of bacterial action (including plant-growth-promoting bacteria) in the process of pest suppression is complex and has not been fully clarified yet. The most common antagonistic action of bacteria against pests is related to the production of insecticidal toxins (crystal proteins, vegetative insecticidal proteins and cytolytic toxins) and specific antimicrobial compounds such as antibiotics [39,40]. The biocontrol of A. lineatus by using entomopathogenic bacteria has not been comprehensively studied [41]. However, the most widely accepted primary mode of bacterial entomopathogenic action is due to the involvement of toxins produced by bacteria in the lysis of an insect’s digestive system.
Among Bacillus species, Bt strains have been the most studied, and their activity is almost exclusively aimed against larval stages of different insects [11,19]. This bacterial species has been widely reported as an insecticidal agent due to the production of toxins such as crystal protein (Cry), vegetative insecticidal protein (Vip) and secreted insecticidal protein (Sip) [11,42,43]. The main mechanism of Cyt and Cry toxins’ activity is similar in regard to their hemolytic activity, while the action mode of Vip proteins remains partly unclear. In addition, Cry proteins target a wide range of insects, including caterpillars (Lepidoptera), beetles (Coleoptera), black flies and mosquitoes (Diptera), as well as soil nematodes such as Caenorhabditis elegans (Rhabditida: Rhabditidae) [44]. Among Bt Cry toxins, Cry1 is the most prevalent one with demonstrated activity against Coleopterans, Dipterans and Lepidopterans [42]. The presence of the cry1B gene was detected for Bt strains BHC 4.5, BHC 4.7, 1.5 and 4.3, and it might be associated with the insecticidal activity of the studied bacteria against A. lineatus larvae. On the other hand, different forms of Cry3 proteins have shown activity against some of the major Coleopteran families (Tenebrionidae, Chrysomelidae, Scarabaeidae and Curculionidae) [45]. Cyt proteins express their dipteran specificity through cytolytic (hemolytic) activity, while some of them also have toxic activity against Coleopteran pests [46]. Biocontrol activity of Bt strain BHC 2.4 against A. lineatus larvae could also be due to the Cyt2 toxin, according to the detection of the cyt2 gene. Federici et al. [47] noted a biocontrol activity of the Cyt1Aa toxin against the cottonwood leaf beetle, while Mahmoud et al. [48] linked the activity of Cyt2Ca1 toxin to the Diaprepes abbreviates.
Antibiosis is a natural process where microorganisms produce antimicrobial substances, including lipopeptides, which have the ability to disrupt critical pathogen processes, such as cell membrane synthesis or metabolic pathways [49,50]. The amphiphilic nature of the most abundant lipopeptides families, such as iturins, surfactins and fengycins, allows them to interact with the target organisms cell membranes [49]. Recently, another family (kurstakins) has been recognized as a crucial component in biocontrol strategies. The kurstakin gene cluster contains three genes (krsA, krsB and krsC), which encode three large multifunctional proteins as the parts of complete synthetase [50]. Interestingly, it has been demonstrated that the transcription of the krs locus is probably activated by the quorum sensor NprR, which is a major regulator required for the necrotrophic stage during the life cycle of Bt, suggesting that the activity of kurstakin could be regulated by environmental factors [51,52]. In addition, activation of this quorum sensor could also be linked to the activity of Cry toxins. Namely, after ingestion, Cry toxins induce cell lysis, subsequently activating the NprR regulator [53]. Additionally, an intriguing property of kurstakin is its ability to enhance the survival of Bt within insect cadavers [54]. By facilitating the spread of Bt throughout the cadaver, kurstakin may improve access to new substrates and promote environmental dissemination. As the Bt strain BHC 2.4 had both cry11 and krsA genes, its effectiveness against wireworm could be associated with the activity of these proteins, as this strain induced the highest mortality of wireworm applied both as a single culture as well as in the mix (mix 5).
Soil microorganisms most commonly infect insects through the mouth and digestive tract, where various bacterial extracellular lytic enzymes may contribute to increased insect mortality. The increased mortality occurs due to the degradation of external barriers or the peritrophic matrix, which subsequently allow the bacteria to enter the insects’ hemocoel [40,55]. As glycoprotein, proteoglycan and chitin are the constituents of the insect peritrophic membrane, protease-producing bacteria and other lytic enzyme-producing bacteria can induce severe damage to the insect membrane [43,55]. Besides their role in biocontrol of other phytopathogenes, such as fungi, several papers reported that proteases and lipase could have a synergistic function in the entomopathogenic effect of Bacillus species, including B. thuringiensis [43,55,56,57]. Knežević et al. [58] reported B. velezensis with PGP traits as effective against A. lineatus and fungal plant pathogen Fusarium poae. Rocha et al. [59] found that B. subtilis strains induced mortality of Coleoptera for up to 33%, indicating that the diversity of bacterial metabolites could contribute to their overall insecticidal potential. Similarly, Rakshiya et al. [57] suggested that the production of siderophores, along with the synthesis of toxins and HCN, could be responsible for insecticidal effects of bacteria against termites. Thus, the highest biocontrol activity against A. lineatus was demonstrated for the Bt strain BHC 2.4, the best siderophore producer. Although there is no direct evidence that the production of bacterial metabolites such as siderophores and the ability of bacteria to solubilize inorganic phosphates afford them insecticidal activity, these traits could contribute to bacterial survival in the soil environment, making these bacteria a suitable choice to be used as inoculants with insecticidal activity in contemporary agricultural practices.

5. Conclusions

This study indicates that native strains of Bacillus thuringiensis could have potential in the biocontrol of A. lineatus larvae—an important wheat pest. The highest insecticidal effect was recorded for mix 1 (BHC 2.4 + 1.5), suggesting that the activity of a single Bt strain could be enhanced in a mixture with another compatible strain. Further research is needed to evaluate the potential of single and combined Bt strains to suppress A. lineatus under field conditions. Ultimately, a properly formulated Bt-based inoculant could offer an ecologically sound solution for integrated A. lineatus management.

Supplementary Materials

The following supporting information can be downloaded at https://www.mdpi.com/article/10.3390/agriculture15192049/s1, Figure S1: Traps for wireworms; Table S1: The presence of antibiotic-producing genes in tested bacterial strains.

Author Contributions

Conceptualization, A.B. and M.K.; methodology, M.D.M., M.K. and A.B.; software, M.D.M.; validation, M.K. and A.B.; formal analysis, M.D.M., M.K., M.J., J.M., J.P., U.B. and A.B.; investigation, M.D.M., M.K., M.J., J.M. and A.B.; resources, M.D.M., M.K. and A.B.; data curation, M.D.M., M.K. and A.B.; writing—original draft preparation, M.D.M.; writing—review and editing, M.K., U.B. and A.B.; visualization, M.J., U.B. and J.P.; supervision, M.K. and A.B.; project administration, A.B.; funding acquisition, M.K. and A.B. All authors have read and agreed to the published version of the manuscript.

Funding

This research was funded by the Ministry of Science, Technological Development and Innovations of the Republic of Serbia, contract Nos. 451-03-136/2025-03/200011, 451-03-136/2025-03/200214, and by the Science Fund of the Republic of Serbia, Grant No. 10815, The necessity of healthy crops: Development of a multifunctional bacterial inoculant for the biological protection of cereals—BioHealCrop.

Institutional Review Board Statement

Not applicable.

Data Availability Statement

Sequence data have been deposited in the NCBI under the following accession numbers: B. thuringiensis BHC 2.4—PV018794, B. thuringiensis BHC 4.5—PV018795 and B. thuringiensis BHC 4.7—PV018839.

Conflicts of Interest

The authors declare no competing interests.

Abbreviations

The following abbreviations are used in this manuscript:
BtBacillus thuringiensis
bacABacylisin
bmyBBacyllomicin
CASChrome Azurol S
CryCrystal protein
CYTCytolytic toxin
fenDFengycin
ituCIturin
krsAKurstakin
NANutrient agar
NCBINational Center for Biotechnology Information
NJNeighbor-Joining phylogenetic tree
PGPPlant growth promotion
SipSecreted insecticidal protein
SMASkim milk agar
spaSSubtilin
srfAASurfactin
VipVegetative insecticidal protein

References

  1. Hokkanen, H.M.T.; Menzler-Hokkanen, I. Implications for management of wireworms: Insect pest suppressiveness of soils with plant functional diversity. Arthropod-Plant Interact. 2023, 17, 441–453. [Google Scholar] [CrossRef]
  2. Parker, W.E.; Howard, J.J. The biology and management of wireworms (Agriotes spp.) on potato with particular reference to the U.K. Agric. For. Entomol. 2001, 3, 85–98. [Google Scholar] [CrossRef]
  3. Vernon, B.; Lagasa, E.; Philip, H. Geographic and temporal distribution of Agriotes obscurus and A. lineatus (Coleoptera: Elateridae) in British Columbia and Washington as determined by pheromone trap surveys. J. Entomol. Soc. Brit. Columbia 2001, 98, 257–266. [Google Scholar]
  4. Horton, D.; Landolt, P. Orientation response of Pacific coast wireworm (Coleoptera: Elateridae) to food baits in laboratory and effectiveness of baits in field. Can. Entomol. 2002, 134, 357–367. [Google Scholar] [CrossRef]
  5. Furlan, L. An IPM approach targeted against wireworms: What has been done and what still has to be done. IOBC/WPRS Bull. 2005, 28, 91–100. [Google Scholar]
  6. Kleespies, R.G.; Ritter, C.; Zimmermann, G.; Burghause, F.; Feiertag, S.; Leclerque, A. A survey of microbial antagonists of Agriotes wireworms from Germany and Italy. J. Pest Sci. 2013, 86, 99–106. [Google Scholar] [CrossRef]
  7. Kabaluk, T. Targeting the click beetle Agriotes obscurus with entomopathogens as a concept for wireworm biocontrol. BioControl 2014, 59, 607–616. [Google Scholar] [CrossRef]
  8. Brandl, M.A.; Schumann, M.; Przyklenk, M.; Patel, A.; Vidal, S. Wireworm damage reduction in potatoes with an attract-and-kill strategy using Metarhizium brunneum. J. Pest. Sci. 2017, 90, 479–493. [Google Scholar] [CrossRef]
  9. Ansari, M.A.; Evans, M.; Butt, T.M. Identification of pathogenic strains of entomopathogenic nematodes and fungi for wireworm control. Crop. Prot. 2009, 28, 269–272. [Google Scholar] [CrossRef]
  10. Campos-Herrera, R.; Gutiérrez, C. Screening Spanish isolates of steinernematid nematodes for use as biological control agents through laboratory and greenhouse microcosm studies. J. Invertebr. Pathol. 2009, 100, 100–105. [Google Scholar] [CrossRef] [PubMed]
  11. Kumar, P.; Kamle, M.; Borah, R.; Mahato, D.K.; Sharma, B. Bacillus thuringiensis as microbial biopesticide: Uses and application for sustainable agriculture. Egypt. J. Biol. Pest Control 2021, 31, 95. [Google Scholar] [CrossRef]
  12. Danismazoglu, M.; Demir, İ.; Sevim, A.; Demirbag, Z.; Nalcacioglu, R. An investigation on the bacterial flora of Agrioteslineatus (Coleoptera: Elateridae) and pathogenicity of the flora members. Crop Prot. 2012, 40, 1–7. [Google Scholar] [CrossRef]
  13. Palma, L.; Muñoz, D.; Berry, C.; Murillo, J.; Caballero, P. Bacillus thuringiensis toxins: An overview of their biocidal activity. Toxins 2014, 6, 3296–3325. [Google Scholar] [CrossRef]
  14. Noran, E.M.; Amin, M.K.; Abdelsalam, A.; Elashtokhy, M.M. Isolation and characterization of halophilic Bacillus thuringiensis from local Egyptian sites and their potential against Spodoptera frugiperda (J.E. Smith) (Lepidoptera: Noctuidae). Egypt. J. Biol. Pest Control 2024, 34, 62. [Google Scholar] [CrossRef]
  15. Bravo, A.; Gill, S.S.; Soberón, M. Mode of action of Bacillus thuringiensis Cry and Cyt toxins and their potential for insect control. Toxicon 2007, 49, 423–435. [Google Scholar] [CrossRef]
  16. Vachon, V.; Laprade, R.; Schwartz, J.-L. Current models of the mode of action of Bacillus thuringiensis insecticidal crystal proteins: A critical review. J. Invertebr. Pathol. 2012, 111, 1–12. [Google Scholar] [CrossRef]
  17. Schnepf, E.; Crickmore, N.; Van Rie, J.; Lereclus, D.; Baum, J.; Feitelson, J.; Zeigler, D.R.; Dean, D.H. Bacillus thuringiensis and its pesticidal crystal proteins. Microbiol. Mol. Biol. Rev. 1998, 62, 775–806. [Google Scholar] [CrossRef]
  18. van Herk, W.G.; Vernon, R.S.; Roitberg, B.D. Repellency of a wireworm, Agriotes obscurus (Coleoptera: Elateridae), on exposure to synthetic insecticides in a soil-less bioassay. Environ. Entomol. 2008, 37, 534–545. [Google Scholar] [CrossRef]
  19. Mampallil, L.J.; Faizal, M.H.; Anith, K.N. Bacterial bioagents for insect pest management. J. Entomol. Zool. Stud. 2017, 5, 2237–2244. [Google Scholar]
  20. Wang, M.; Geng, L.; Sun, X.; Shu, C.; Song, F.; Zhang, J. Screening of Bacillus thuringiensis strains to identify new potential biocontrol agents against Sclerotinia sclerotiorum and Plutellaxylostella in Brassica campestris L. Biol. Control 2020, 145, 104262. [Google Scholar] [CrossRef]
  21. Gupta, R.; Keppanan, R.; Leibman-Markus, M.; Elbaz, M.; Bar, M.; Ment, D.; Yedidia, I. Bacillus thuringiensis promotes systemic immunity in tomato, controlling pests and pathogens and promoting yield. Food Sec. 2024, 16, 675–690. [Google Scholar] [CrossRef]
  22. Morales-Rodriguez, A.; Ospina, A.; Wanner, K.W. Evaluation of four bait traps for sampling wireworm (Coleoptera: Elateridae) infesting cereal crops in Montana. Int. J. Insect Sci. 2017, 9, 1179543317709275. [Google Scholar] [CrossRef] [PubMed]
  23. Furlan, L.; Benvegnù, I.; Bilò, M.F.; Lehmhus, J.; Ruzzier, E. Species Identification of Wireworms (Agriotes spp.; Coleoptera: Elateridae) of Agricultural Importance in Europe: A New “Horizontal Identification Table”. Insects 2021, 12, 534. [Google Scholar] [CrossRef] [PubMed]
  24. Knežević, M.; Berić, T.; Buntić, A.; Delić, D.; Nikolić, I.; Stanković, S.; Stajković-Srbinović, O. Potential of root nodule nonrhizobial endophytic bacteria for growth promotion of Lotus corniculatus L. and Dactylis glomerata L. J. Appl. Microbiol. 2021, 131, 2929–2940. [Google Scholar] [CrossRef]
  25. Dimkić, I.; Živković, S.; Berić, T.; Ivanović, Ž.; Gavrilović, V.; Stanković, S.; Fira, D. Characterization and evaluation of two Bacillus strains, SS-12.6 and SS-13.1, as potential agents for the control of phytopathogenic bacteria and fungi. Biol. Control 2013, 65, 312–321. [Google Scholar] [CrossRef]
  26. Oro, V.; Knežević, M.; Dinić, Z.; Delić, D. Bacterial microbiota isolated from cysts of Globodera rostochiensis (Nematoda: Heteroderidae). Plants 2020, 9, 1146. [Google Scholar] [CrossRef]
  27. Mora, I.M.R.; Cabrefiga, J.; Montesinos, E. Antimicrobial peptide genes in Bacillus strains from plant environments. Int. Microbiol. 2011, 14, 213–223. [Google Scholar] [CrossRef]
  28. Jelušić, A.; Popović, T.; Dimkić, I.; Mitrović, P.; Peeters, K.; Miklavčič Višnjevec, A.; Tavzes, Č.; Stanković, S.; Berić, T. Changes in the winter oilseed rape microbiome affected by Xanthomonas campestris pv. campestris and biocontrol potential of the indigenous Bacillus and Pseudomonas isolates. Biol. Control 2021, 160, 104695. [Google Scholar] [CrossRef]
  29. Jain, D.; Sunda, S.D.; Sanadhya, S.; Nath, D.J.; Khandelwal, S.K. Molecular characterization and PCR-based screening of cry genes from Bacillus thuringiensis strains. 3 Biotech 2017, 7, 4. [Google Scholar] [CrossRef] [PubMed]
  30. Thammasittirong, A.; Attathom, T. PCR-based method for the detection of cry genes in local isolates of Bacillus thuringiensis from Thailand. J. Invertebr. Pathol. 2008, 98, 121–126. [Google Scholar] [CrossRef] [PubMed]
  31. Senthilkumar, M.; Amaresan, N.; Sankaranarayanan, A. Plant-Microbe Interactions; Springer Protocols Handbooks; Springer: Berlin/Heidelberg, Germany, 2021; pp. 249–251. [Google Scholar]
  32. Ibarra, J.E.; Rincon, M.C.; Orduz, S. Diversity of Bacillus thuringiensis strains from Latin America. Appl. Environ. Microbiol. 2003, 69, 5269–5274. [Google Scholar] [CrossRef] [PubMed]
  33. Rokhbakhsh-Zamin, F.; Sachdev, D.; Kazemi-Pour, N.; Engineer, A.; Pardesi, K.R.; Zinjarde, S.; Dhakephalkar, P.K.; Chopade, B.A. Characterization of plant-growth-promoting traits of Acinetobacter species isolated from rhizosphere of Pennisetum glaucum. J. Microbiol. Biotechnol. 2011, 21, 556–566. [Google Scholar] [CrossRef]
  34. Milagres, A.M.; Machuca, A.; Napoleão, D. Detection of siderophore production from several fungi and bacteria by a modification of chrome azurol S (CAS) agar plate assay. J. Microbiol. Methods 1999, 37, 1–6. [Google Scholar] [CrossRef] [PubMed]
  35. Figueira, C.; Ferreira, M.J.; Silva, H.; Cunha, A. Improved germination efficiency of Salicornia ramosissima seeds inoculated with Bacillus aryabhattai SP101620. Ann. Appl. Biol. 2019, 174, 319–328. [Google Scholar] [CrossRef]
  36. Mihajlovski, K.R.; Radovanović, N.R.; Miljković, M.G.; Šiler-Marinković, S.; Rajilić-Stojanović, M.D.; Dimitrijević-Branković, S.I. β-Amylase production from packaging-industry wastewater using a novel strain Paenibacillus chitinolyticus CKS 1. RSC Adv. 2015, 5, 90895–90903. [Google Scholar] [CrossRef]
  37. Vernon, R.S.; Van Herk, W.; Tolman, J.; Ortiz Saavedra, H.; Clodius, M.; Gage, B. Transitional sublethal and lethal effects of insecticides after dermal exposures to five economic species of wireworms (Coleoptera: Elateridae). J. Econ. Entomol. 2008, 101, 365–374. [Google Scholar] [CrossRef]
  38. Abbott, W.S. A method of computing the effectiveness of an insecticide. J. Econ. Entomol. 1925, 18, 265–267. [Google Scholar] [CrossRef]
  39. Bajsa, N.; Fabiano, E.; Rivas-Franco, F. Biological control of phytopathogens and insect pests in agriculture: An overview of 25 years of research in Uruguay. Environ. Sustain. 2023, 6, 121–133. [Google Scholar] [CrossRef]
  40. Sindhu, S.S.; Sehrawat, A.; Sharma, R.; Khandelwal, A. Biological control of insect pests for sustainable agriculture. In Advances in Soil Microbiology: Recent Trends and Future Prospects; Adhya, T., Mishra, B., Annapurna, K., Verma, D., Kumar, U., Eds.; Microorganisms for Sustainability; Springer: Singapore, 2017; Volume 4, pp. 189–218. [Google Scholar] [CrossRef]
  41. Poggi, S.; Le Cointe, R.; Lehmhus, J.; Plantegenest, M.; Furlan, L. Alternative strategies for controlling wireworms in field crops: A review. Agriculture 2021, 11, 436. [Google Scholar] [CrossRef]
  42. Khan, A.R.; Mustafa, A.; Hyder, S.; Valipour, M.; Rizvi, Z.F.; Gondal, A.S.; Yousuf, Z.; Iqbal, R.; Daraz, U. Bacillus spp. as bioagents: Uses and application for sustainable agriculture. Biology 2022, 11, 1763. [Google Scholar] [CrossRef] [PubMed]
  43. Ajuna, H.B.; Lim, H.I.; Moon, J.H.; Won, S.J.; Choub, V.; Choi, S.I.; Yun, J.Y.; Ahn, Y.S. The prospect of hydrolytic enzymes from Bacillus species in the biological control of pests and diseases in forest and fruit tree production. Int. J. Mol. Sci. 2023, 24, 16889. [Google Scholar] [CrossRef]
  44. Wei, J.Z.; Hale, K.; Carta, L.; Platzer, E.; Wong, C.; Fang, S.C.; Aroian, R.V. Bacillus thuringiensis crystal proteins that target nematodes. Proc. Natl. Acad. Sci. USA 2003, 100, 2760–2765. [Google Scholar] [CrossRef] [PubMed]
  45. Domínguez-Arrizabalaga, M.; Villanueva, M.; Escriche, B.; Ancín-Azpilicueta, C.; Caballero, P. Insecticidal activity of Bacillus thuringiensis proteins against Coleopteran pests. Toxins 2020, 12, 430. [Google Scholar] [CrossRef] [PubMed]
  46. de Maagd, R.A.; Bravo, A.; Berry, C.; Crickmore, N.; Schnepf, H.E. Structure, diversity, and evolution of protein toxins from spore-forming entomopathogenic bacteria. Annu. Rev. Genet. 2003, 37, 409–433. [Google Scholar] [CrossRef] [PubMed]
  47. Federici, B.A.; Bauer, L.S. Cyt1Aa protein of Bacillus thuringiensis is toxic to the cottonwood leaf beetle, Chrysomela scripta, and suppresses high levels of resistance to Cry3Aa. Appl. Environ. Microbiol. 1998, 64, 4368–4371. [Google Scholar] [CrossRef]
  48. Mahmoud, S.B.; Ramos, J.E.; Shatters, R.G.; Hall, D.G.; Lapointe, S.L.; Niedz, R.P.; Rougé, P.; Cave, D.; Borovsky, D. Expression of Bacillus thuringiensis cytolytic toxin (Cyt2Ca1) in citrus roots to control Diaprepesabbreviatus larvae. Pestic. Biochem. Physiol. 2017, 136, 1–11. [Google Scholar] [CrossRef]
  49. Fira, D.; Dimkić, I.; Berić, T.; Lozo, J.; Stanković, S. Biological control of plant pathogens by Bacillus species. J. Biotechnol. 2018, 285, 44–55. [Google Scholar] [CrossRef]
  50. Nihorimbere, G.; Korangi-Alleluya, V.; Nimbeshaho, F.; Nihorimbere, V.; Legrève, A.; Ongena, M. Bacillus-based biocontrol beyond chemical control in Central Africa: The challenge of turning myth into reality. Front. Plant Sci. 2024, 15, 1349357. [Google Scholar] [CrossRef]
  51. Béchet, M.; Caradec, T.; Hussein, W.; Abderrahmani, A.; Chollet, M.; Leclère, V.; Dubois, T.; Lereclus, D.; Pupin, M.; Jacques, P. Structure, biosynthesis, and properties of kurstakins, nonribosomal lipopeptides from Bacillus spp. Appl. Microbiol. Biot. 2012, 95, 593–600. [Google Scholar] [CrossRef]
  52. Gélis-Jeanvoine, S.; Canette, A.; Gohar, M.; Caradec, T.; Lemy, C.; Gominet, M.; Jacques, P.; Lereclus, D.; Slamti, L. Genetic and functional analyses of krs, a locus encoding Kurstakin, a lipopeptide produced by Bacillus thuringiensis. Res. Microbiol. 2017, 168, 356–368. [Google Scholar] [CrossRef] [PubMed]
  53. Raymond, B.; Johnston, P.R.; Nielsen-LeRoux, C.; Lereclus, D.; Crickmore, N. Bacillus thuringiensis: An impotent pathogen? Trends Microbiol. 2010, 18, 189–194. [Google Scholar] [CrossRef] [PubMed]
  54. Dubois, T.; Faegri, K.; Perchat, S.; Lemy, C.; Buisson, C.; Nielsen-LeRoux, C.; Gohar, M.; Jacques, P.; Ramarao, N.; Kolsto, A.B.; et al. Necrotrophism is a quorum-sensing-regulated lifestyle in Bacillus thuringiensis. PLoS Pathog. 2012, 8, e1002629. [Google Scholar] [CrossRef]
  55. Raddadi, N.; Cherif, A.; Ouzari, H.; Marzorati, M.; Brusetti, L.; Boudabous, A.; Daffonchio, D. Bacillus thuringiensis beyond insect biocontrol: Plant growth promotion and biosafety of polyvalent strains. Ann. Microbiol. 2007, 57, 481–494. [Google Scholar] [CrossRef]
  56. Ruiu, L. Plant-growth-promoting bacteria (PGPB) against insects and other agricultural pests. Agronomy 2020, 10, 861. [Google Scholar] [CrossRef]
  57. Rakshiya, Y.S.; Verma, M.K.; Sindhu, S.S. Efficacy of antagonistic soil bacteria in management of subterranean termites (Isoptera). Res. Environ. Life Sci. 2016, 9, 949–955. [Google Scholar]
  58. Knežević, M.; Dervišević, M.; Jovković, M.; Jevđenović, G.; Maksimović, J.; Buntić, A. Versatile role of Bacillus velezensis: Biocontrol of Fusarium poae and wireworms and barley plant growth promotion. Biol. Control 2025, 145, 105789. [Google Scholar] [CrossRef]
  59. Rocha, G.T.; Queiroz, P.R.M.; Grynberg, P.; Togawa, R.C.; de Lima Ferreira, A.D.C.; Do Nascimento, I.N.; Gomes, A.C.M.M.; Monnerat, R. Biocontrol potential of bacteria belonging to the Bacillus subtilis group against pests and diseases of agricultural interest through genome exploration. Antonie Leeuwenhoek 2023, 116, 599–614. [Google Scholar] [CrossRef] [PubMed]
Agriculture 15 02049 g001
Figure 1. Neighbor-Joining phylogenetic tree based on 16S rRNA sequences. Three Bacillus spp. isolates (BHC 2.4; BHC 4.5 and BHC 4.7) characterized in this study are marked with a blue triangle.
Figure 1. Neighbor-Joining phylogenetic tree based on 16S rRNA sequences. Three Bacillus spp. isolates (BHC 2.4; BHC 4.5 and BHC 4.7) characterized in this study are marked with a blue triangle.
Agriculture 15 02049 g001
Agriculture 15 02049 g002
Figure 2. Mortality (%) of Agriotes lineatus larvae induced by B. thiringiensis strains. a–e: Means followed by the same superscript letters are not significantly different according to Duncan’s multiple range test (p ≤ 0.05). Bars above means represent standard deviation. Mix 1: BHC 2.4 + 1.5; mix 2: BHC 2.4 + 4.3; mix 3: BHC 4.7 + BHC 4.5; mix 4: BHC 4.7 + 4.3; mix 5: 1.5 + 4.3.
Figure 2. Mortality (%) of Agriotes lineatus larvae induced by B. thiringiensis strains. a–e: Means followed by the same superscript letters are not significantly different according to Duncan’s multiple range test (p ≤ 0.05). Bars above means represent standard deviation. Mix 1: BHC 2.4 + 1.5; mix 2: BHC 2.4 + 4.3; mix 3: BHC 4.7 + BHC 4.5; mix 4: BHC 4.7 + 4.3; mix 5: 1.5 + 4.3.
Agriculture 15 02049 g002
Table 1. DNA primers used for the screening of bacterial antibiotic- and toxin-producing genes.
Table 1. DNA primers used for the screening of bacterial antibiotic- and toxin-producing genes.
GenePrimerSequence (5′ → 3′)Product Size (bp)Reference
fenDFEND-FGGCCCGTTCTCTAAATCCAT269[25]
FEND-RGTCATGCTGACGAGAGCAAA
bmyBBMYB-FGAATCCCGTTGTTCTCCAAA370
BMYB-RGCGGGTATTGAATGCTTGTT
ituCITUC-FGGCTGCTGCAGATGCTTTAT423
ITUC-RTCGCAGATAATCGCAGTGAG
srfAASRFA-FTCGGGACAGGAAGACATCAT201
SRFA-RCCACTCAAACGGATAATCCTGA
bacABAC-FCAGCTCATGGGAATGCTTTT498
BAC-RCTCGGTCCTGAAGGGACAAG
spaSSPAS-FGGTTTGTTGGATGGAGCTGT375
SPAS-RGCAAGGAGTCAGAGCAAGGT
krsAAKS-FTCHACWGGRAATCCAAAGGG1125, 1152, 1161, 1167, 1173[26]
TKS-RCCACCDKTCAAAKAARKWATC
cry11Un11-FTTCCAACCCAACTTTCAAGC305[27]
Un11-RAGCTATGGCCTAAGGGGAAA
cry1Bc1B-FCAGAAACAACAGAACGACC921[28]
c1B-RCACTTCCCCACCATCCAT
vip1Vip1-sc.fwTATTAGATAAACAACAACAAGAATATCAATCTATTMGNTGGATHGG585[29]
Vip1-sc.revGATCTATATCTCTAGCTGCTTTTTCATAATCTSARTANGGRTC
vip2Vip2-sc.fwGATAAAGAAAAAGCAAAAGAATGGGRNAARRA845
Vip2-sc.revCCACACCATCTATATACAGTAATATTTTCTGGDATNGG
cyt1cyt1gral-FCCTCAATCAACAGCAGGGTTATT477–480[30]
cyt1gral-RTGCAAACAGGACATTGTATGTGTAATT
cyt2cyt2gral-FATTACAAATTGCAAATGGTATTCC355–356
cyt2gral-RTTTCAACATCCACAGTAATTTCAAATGC
Table 2. The presence of toxin-producing genes in 6 tested bacterial strains.
Table 2. The presence of toxin-producing genes in 6 tested bacterial strains.
Toxin-Producing GeneBacterial Strain
B. thuringiensis BHC 2.4B. thuringiensis BHC 4.5B. thuringiensis BHC 4.7B. thuringiensis 1.5B. thuringiensis 4.3B. thuringiensis 6.1
cry11+–––––
cry1B–++++–
vip1––––––
vip2––––––
cyt1––––––
cyt2+–––––
Table 3. Bacterial properties of the tested bacterial strains.
Table 3. Bacterial properties of the tested bacterial strains.
Bacterial StrainsAmylaseCMCaseProteaseLipasePhosphate SolubilizationSiderophore (mm)
B. thuringiensis BHC 2.4++++++++––17 ± 0.58
B. thuringiensis BHC 4.5++++++++9 ± 0.29
B. thuringiensis BHC 4.7++++++–+7 ± 0.50
B. thuringiensis 1.5++++ *+ *–– *1.83 ± 0.58 *
B. thuringiensis 4.3+++++ *++ *–– *– *
B. thuringiensis 6.1+++ *++ *–– *– *
– no production (no halo zone); + low production (halo zone radius up to 5 mm); ++ moderate production (halo zone radius up to 10 mm); +++ high production (halo zone radius above 10 mm); * previously published in [24].
Table 4. Compatibility of Bacillus thuringiensis strains.
Table 4. Compatibility of Bacillus thuringiensis strains.
Bacterial StrainBHC 2.4BHC 4.5BHC 4.71.54.36.1
B. thuringiensis BHC 2.4 ––++–
B. thuringiensis BHC 4.5– +–––
B. thuringiensis BHC 4.7–+ –+–
B. thuringiensis 1.5+–– +–
B. thuringiensis 4.3+–++ –
B. thuringiensis 6.1–––––
+ compatible strains; – incompatible strains.
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Dervišević Milenković, M.; Knežević, M.; Jovković, M.; Maksimović, J.; Buzurović, U.; Pavlović, J.; Buntić, A. Sustainable Wireworm Control in Wheat via Selected Bacillus thuringiensis Strains: A Biocontrol Perspective. Agriculture 2025, 15, 2049. https://doi.org/10.3390/agriculture15192049

AMA Style

Dervišević Milenković M, Knežević M, Jovković M, Maksimović J, Buzurović U, Pavlović J, Buntić A. Sustainable Wireworm Control in Wheat via Selected Bacillus thuringiensis Strains: A Biocontrol Perspective. Agriculture. 2025; 15(19):2049. https://doi.org/10.3390/agriculture15192049

Chicago/Turabian Style

Dervišević Milenković, Marina, Magdalena Knežević, Marina Jovković, Jelena Maksimović, Uroš Buzurović, Jelena Pavlović, and Aneta Buntić. 2025. "Sustainable Wireworm Control in Wheat via Selected Bacillus thuringiensis Strains: A Biocontrol Perspective" Agriculture 15, no. 19: 2049. https://doi.org/10.3390/agriculture15192049

APA Style

Dervišević Milenković, M., Knežević, M., Jovković, M., Maksimović, J., Buzurović, U., Pavlović, J., & Buntić, A. (2025). Sustainable Wireworm Control in Wheat via Selected Bacillus thuringiensis Strains: A Biocontrol Perspective. Agriculture, 15(19), 2049. https://doi.org/10.3390/agriculture15192049

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop