Next Article in Journal
Enhancing Agroecological Resilience in Arid Regions: A Review of Shelterbelt Structure and Function
Previous Article in Journal
Impact of Monoculture and Various Ratios of Intercropped Oats and Daikon Radish Cover Crops on Soil Properties, Weed Suppression, and Spinach Yield
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Agriculture
Volume 15
Issue 19
10.3390/agriculture15192003
agriculture-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

The Infection of Yellow Lupin (Lupinus luteus L.) with Bean Yellow Mosaic Virus (BYMV) and Cucumber Mosaic Virus (CMV) in Organic Farming in Eastern Poland

by
Anna Czubacka
1,*,
Diana Czarnecka
1 and
Jerzy Księżak
2
1
Department of Biotechnology and Plant Breeding, Institute of Soil Science and Plant Cultivation—State Research Institute, Czartoryskich 8, 24-100 Puławy, Poland
2
Department of Crops and Yield Quality, Institute of Soil Science and Plant Cultivation—State Research Institute, Czartoryskich 8, 24-100 Puławy, Poland
*
Author to whom correspondence should be addressed.
Agriculture 2025, 15(19), 2003; https://doi.org/10.3390/agriculture15192003
Submission received: 13 August 2025 / Revised: 10 September 2025 / Accepted: 23 September 2025 / Published: 25 September 2025
(This article belongs to the Section Crop Protection, Diseases, Pests and Weeds)
Browse Figures
Versions Notes

Abstract

Yellow lupin seeds are a rich source of protein, which is why they are grown for animal feed and human consumption. At the same time, there is growing interest in organic farming. However, this type of cultivation is more susceptible to diseases, including viral ones. Yellow lupin is most commonly affected by the bean yellow mosaic virus (BYMV) and cucumber mosaic virus (CMV). We have therefore determined the occurrence of these two pathogens in six new Polish yellow lupin cultivars (Goldeneye, Salut, Diament, Puma, Mister and Bursztyn) grown in accordance with organic farming rules. Field experiments were conducted over three years, from 2022 to 2024, in three locations in eastern Poland. The Goldeneye cultivar was the most susceptible to BYMV, with an average infection rate of 59.17% of plants. In contrast, the Puma cultivar was the least susceptible to BYMV infection, with an average infection rate of 23.34%. However, even within this cultivar, most plants were infected under conditions of strong pathogen pressure (up to 90% in one of the locations in 2024). CMV infections were less frequent, with no statistical differences being found between cultivars in terms of the number of infected plants.

1. Introduction

Lupin is cultivated for its seeds, which are used for feeding humans and animals. The main species cultivated are narrow-leafed lupin (Lupinus angustifolius L.), white lupin (L. albus L.), yellow lupin (L. luteus L.) and pearl lupin (L. mutabilis Sweet). The cultivation of pearl and white lupins can be traced back over 2500 years. In contrast, narrow-leafed and yellow lupins were only recently domesticated in northern Europe, particularly in the Baltic countries and Germany [1].
It is worth noting that the lupins are a group of legume crops that produce large seeds containing up to 40% protein. Consequently, they can be regarded as a potential soybean alternative [2]. Yellow lupine seeds are used as livestock and poultry feed, though it is also harvested for green fodder. It could also be utilised for land reclamation. This is because lupin enriches the soil with nitrogen, which acts as a fertiliser, accumulating approximately 330 kg N ha−1 [3]. Furthermore, lupin alkaloids have a phytosanitary effect due to their antibacterial and antifungal properties, which facilitates the cleansing of pathogens from the soil [4].
Recently, there has been growing interest in organic farming. A recent study indicated an increase in the farmland devoted to this type of farming. In 2016, organic farms were reported in 172 countries. By 2025, this number had risen to 187 countries, indicating a global expansion of organic farming initiatives [5]. Between 2012 and 2022, the area dedicated to organic farming increased considerably across all continents, with the most significant growth occurring in Oceania and Europe. In Europe, the area dedicated to organic farming increased from 11.2 million hectares in 2012 to 18.5 million hectares in 2022. In Poland, 456.5 thousand hectares were cultivated using organic methods in 2023 [6].
However, the likelihood of diseases, including viral ones, in organic lupins is quite high due to the lack of chemical protection. Many viral diseases are transmitted by pest insects. Lupins are usually infected by two viruses—cucumber mosaic virus (CMV) and bean yellow mosaic virus (BYMV), which can occur in either single or mixed infections.
CMV is one of the most important viruses in economic terms because it infects over 1000 plant species in 85 families [7,8]. It has been reported in lupins in Poland, the United Kingdom, Australia, Russia, Belarus, Ukraine and Lithuania [9]. In a temperate climate, CMV can survive from year to year in weeds or in crops [8]. It is transmitted in a non-persistent way by over 80 species of aphid, by plant sap or tissue wounded by tools during fieldwork. It is also transmitted with seeds of some crops, including lupin, and wild species [10,11,12,13,14]. It is assigned to the family Bromoviridae, genus Cucumovirus, species Cucumovirus CMV. The symptoms, which it causes, include mosaic, chlorosis, leaf curling as well as stunted growth [14,15]. CMV is molecularly represented by two subgroups I and II. The first of these is further divided into IA and IB. In Poland, subgroup II is the most common [16]. CMV is primarily spread by Acyrthosiphon pisum Harris, Aphis craccivora Koch. and Myzus persicae Sulz. [4,11].
BYMV is assigned taxonomically to the family Potyviridae, genus Potyvirus, species Potyvirus phaseoluteum. It is transmitted in a non-persistent way by over 20 aphid species, including Acyrthosiphon pisum Harris, Aphis fabae Scop., Aphis gossypii Glover, Aulacorthum solani Kaltenbach, Aphis brassicae L., M. persicae Sulz. and Rhopalosiphum maidis F. [8,11,17]. It can overwinter in the rest of the cultivated plants or in wild perennial hosts and be spread to crops during the vegetative period. It can also be transmitted with the seeds of legumes, such as lupin, as well as mechanically [8]. Plants infected with this virus may exhibit symptoms such as mottling, chlorosis, narrowing and the malformation of leaves and pods, and infected plants may be bunchy and stunted [7,18], remaining green while healthy plants dry up [19]. BYMV infection in lupins was detected in Poland, the United Kingdom, Hungary, the USA, Ukraine and Australia. Two strains of the virus are known: the necrotic strain (BYMV-N) and the non-necrotic strain (BYMV-NN) [9]. Two molecular subgroups I and II were detected in faba bean in Poland [20]. In lupin subgroup II was detected in Australia and subgroup III in the USA [21]. BYMV often causes latent infection in peas, which acts as a source of virus inoculum for aphid transmission [11].
Yellow lupin shows resistance to herbivorous insects, including aphids, thanks to the alkaloids which it produces. Alkaloids are synthesised in the leaves and transported to the other parts of the plant, primarily to the flowers, pods and seeds [22]. Sujak et al. [23] reported that the alkaloid content in popular yellow lupin cultivars in Poland was between 0.49 and 2.38 g per kg of dry weight. However, it is recommended that the seeds contain no more than 0.02% of alkaloids due to their consumption by animals [24]. Lupin quinolizidine alkaloids (QA) make the plants taste bitter and are toxic to domestic animals and humans [25]. The main QAs in yellow lupin are lupinine, sparteine, feruloyllupinine and p-coumaryllupinine [22]. The breeding of new cultivars aims to decrease the content of these compounds. This reduces the plants’ defence against pests that transmit viruses [4]. Therefore, it is recommended to select cultivars that are resistant or at least tolerant to viruses. New cultivars are bred to increase yield and improve plant quality, with disease resistance being of secondary importance. Currently, there are no data available on the resistance or susceptibility of cultivated Polish lupin cultivars. Therefore, we compared a few new Polish yellow lupin cultivars under field conditions to determine their suitability for organic farming in terms of the occurrence of CMV and BYMV infections.

2. Materials and Methods

2.1. Plant Material and Field Experiment

The research material was plants of yellow lupin (Lupinus luteus) belonging to six Polish cultivars: Goldeneye, Salut, Diament, Puma, Mister and Bursztyn (Table 1). They were grown in three years, 2022–2024, in three locations in eastern Poland: 1. Osiny—Lubelskie Voivodeship, Osiny Experimental Station of the Institute of Soil Science and Plant Cultivation—State Research Institute in Puławy (51.47° N, 22.05° E), 2. Grabów—Mazovian Voivodeship, Grabów Experimental Station of the Institute of Soil Science and Plant Cultivation—State Research Institute in Puławy (51.35° N, 21.65° E) and 3. Szepietowo—Podlaskie Voivodeship, Podlaski Agricultural Advisory Centre in Szepietowo (52.84° N, 22.53° E). The content of assimilable forms of macronutrients (mg/100 g of soil) was found to be within the following range: in Szepietowo: P—25.9–36; K—19.8–23.1; Mg—7.2–8.4.4; in Grabów: P—12.4–12.9; K—22.8–23.0; Mg—6.3–6.5; in Osiny: P—12.0–16.2; K—18.0–23.5; Mg—6.1–7.0. The pH of the soil was determined in 1N KCL according to the method PN-EN ISO 10390:2022-09 [26]. The results showed a range of values between 5.8 and 6.4 in Szepietowo, between 6.1 and 6.5 in Grabów and between 6.1 and 6.3 in Osiny. Depending on the location and the equipment available for sowing and harvesting, the size of the plot ranged from 14.2 to 26.0 m2 and each cultivar was grown in four replications. Nitrogen fertilisation was not utilised in this study. The preceding crop was identified as either spring cereals, including spring barley and oats, or winter cereals, encompassing winter triticale and winter wheat. The experiment involved sowing 110 seeds/m2, with a spacing of 20 to 24 cm between each seed. The seeds were sown in the turn of March and April at a depth of 3 to 4 cm. To facilitate the process of weeding the crop, four harrowing operations were carried out (two before emergence, after the development of two leaves and when the plants were approximately 10 cm high) if agrotechnical conditions permitted.

2.2. The Detection of Viruses

The samples for the detection of the presence of viruses BYMV and CMV were leaves collected randomly from 40 plants (10 plants from the repeat) within each cultivar every year at the end of June or early July, while the plants were at the phases from BBCH 69 (end of the flowering) to BBCH 71 (set of the first pod).

2.2.1. Serological Tests

Leaf samples were frozen and lyophilised. Serological tests were performed applying the DAS-ELISA method [27] with the use of antibodies against bean yellow mosaic virus (Cat. No. 07007S, Loewe, Biochemica GmbH, Sauerlach, Germany) and against cucumber mosaic virus (Cat. No. 07108S, Loewe, Biochemica GmbH, Sauerlach, Germany). To ensure the validity of the results, both viruses were analysed using negative and positive controls which were manufactured by the same producer. A microplate was coated with anti-BYMV-IgG or anti-CMV-IgG antibodies. The plant samples were homogenised with the extraction buffer and then applied to the antibody-coated plate. The virus-IgG complexes were detected using a complementary IgG labelled with alkaline phosphatase, as this forms a yellow-coloured product when p-nitrophenylphosphate is used as the substrate. Absorbance measurements at a wavelength of 405 nm were performed using the Tecan Sunrise microplate reader (Tecan Austria GmbH, Grödig, Austria) after incubating the substrate for 60 min. The test result was considered positive if the absorbance value was at least twice higher than that of the negative control. Plants without disease symptoms, in which no virus was detected in the tissues, were considered to be healthy.

2.2.2. Molecular Tests

To confirm the results of the serological tests, the leaves of the DAS-ELISA-positive plants were ground in a mortar using liquid nitrogen. RNA was extracted from 100 mg of tissue by applying the RNeasy Plant Mini Kit (Qiagen, Hilden, Germany) following the manufacturer’s recommended procedure. After extraction, the RNA concentration was measured using a NanoDrop 2000 spectrophotometer (Thermo Fisher Scientific, Wilmington, DE, USA). Reverse transcription was prepared in 0.2 mL tubes. The mixture contained 1 μg of RNA, 1 μL of reverse primer BYMV PII or CMV 3′CP (Table 2), and 1 μL of 10 mM dNTP mix (10 mM each of dATP, dGTP, dCTP and dTTP at neutral pH; Invitrogen, Carlsbad, CA, USA) and was filled up to 13 μL with nuclease-free water (Thermo Fisher Scientific Baltics UAB, Vilnius, Lithuania) and heated to 65 °C for 5 min, and then incubated on ice for 1 min. Then, 4 μL of 5 × first-strand buffer, 1 μL of 0.1 M DTT (Invitrogen, Carlsbad, CA, USA), 1 μL of RNaseOUT™ Recombinant RNase Inhibitor (40 units/μL; Invitrogen, Carlsbad, CA, USA) and 1 μL of SuperScript™III RT (200 units/μL; Invitrogen, Carlsbad, CA, USA) were added. The mixture was incubated at 50 °C for 60 min and then inactivated at 70 °C for 15 min. The resulting cDNA was used for the PCR reaction. The PCR mixture in a volume of 20 μL contained: 1 × PCR buffer (75 mM Tris-HCl (pH = 8.8), 20 mM (NH4)2SO4, 0.01% (v/v) Tween 20; Thermo Fisher Scientific Baltic UAB, Vilnius, Lithuania), 2.5 mM MgCl2 (Thermo Fisher Scientific Baltic UAB, Vilnius, Lithuania), 0.2 mM of each nucleotide (Thermo Fisher Scientific Baltic UAB, Vilnius, Lithuania), 0.5 U Taq polymerase (Thermo Fisher Scientific Baltic UAB, Vilnius, Lithuania), 0.5 mM of primers (PI and PII for BYMV detection or 5′CP and 3′CP for CMV detection; Eurofins Genomics, Ebersberg, Germany; Table 2) and approximately 50 ng cDNA. The PCR reaction was carried out using a C1000 thermocycler (Bio-Rad, Hercules, CA, USA).
The amplification products were separated electrophoretically on a 2% agarose gel in 1 × TBE buffer with DNA staining dye Midori Green Advance (Nippon Genetics Europe GmbH, Düren, Germany). The presence and length of the PCR products were observed under UV light and by comparing them with size standards: GeneRuler 100 bp DNA Ladder and GeneRuler 1 kb DNA Ladder (Thermo Fisher Scientific Baltic UAB, Vilnius, Lithuania).

2.3. Statistical Analysis

A statistical analysis was performed using Statistica version 13.3 (Tibco Software, Palo Alto, CA, USA). Statistically significant differences in the number of infected plants were calculated using ANOVA (analysis of variance) and the HSD (Honestly Significant Difference) Tukey test. Analysis of variance was performed at a significance level of p ≤ 0.05. The numerical data were then transformed into a percentage of infected plants, and thus the results were presented in tables and graphs, while the number of infected plants is presented in the Supplementary Materials.

3. Results

Throughout the study, the number of infected plants depended on the lupin cultivar and on the location of the experimental field. Disparities were observed in infection rates between the two viruses. In general, the BYMV infections were more prevalent than the CMV infections. Plants were tentatively considered as virus-infected when the DAS-ELISA test yielded a positive result and the presence of BYMV or CMV was confirmed by the RT-PCR reaction with the specific primers.

3.1. The Occurrence of BYMV

In 2022, the virus was detected in 67.5% and 72.5% of plants in two locations, Grabów and Osiny, respectively (Figure 1). This result was not statistically different from that observed for the Salut cultivar grown in Grabów, where BYMV was found in 45% of plants. The other cultivars were infected to a much lesser extent than Goldeneye, with Puma deserving special attention because, within this cultivar, only three out of 40 plants (7.5%) were infected in Szepietowo, five out of 40 (12.5%) in Osiny and none in Grabów (Figure 1 and Table S1).
A year later, the differences between the cultivars became more apparent. Goldeneye remained the most affected cultivar in Grabów and Osiny, but statistically it did not differ from Diament, Mister or Bursztyn (Figure 1). In 2024, an increased infection rate was observed. The BYMV was found in the tissues of most plants in Grabów, ranging from 82.5% in cv. Salut to 97.5% in the Diament and Bursztyn cultivars. Also, Puma experienced severe damage in Grabów, with 90% of the plants affected. Many plants in Szepietowo were also infected that year. Puma was the least affected by the disease, with only 17 out of 40 (42.5%) plants infected, distinguishing it from the other cultivars at this location, except Salut, where 18 plants (45%) were found to be infected (Figure 1 and Table S1). At the third location, in Osiny, it was found that only 5% of plants belonging to the Puma cultivar were infected with the virus. It should be noted that in Osiny, BYMV infection was generally not high during this particular season compared to other locations.
In the DAS-ELISA test, healthy lupin plants showed an absorbance range of 0.08–0.156, whereas diseased plants were found to have the absorbance range of 0.371–3.075. The molecular analyses confirmed the presence of BYMV in the tissues of infected plants by the RT-PCR detection of the viral C-terminal region of the coat protein gene. The amplicon size was 733 bp (Figure S1).

3.2. The Occurrence of CMV

In 2022, the virus was found in three cultivars in Grabów: Diament, Bursztyn and Goldeneye. In Goldeneye, the virus was also detected in a single plant in Szepietowo (2.5%) (Figure 2 and Table S2).
In the next year, numerous infections occurred in Szepietowo and Grabów (Figure 2). In Szepietowo, all grown cultivars were affected by the infection, ranging from 5% of plants within the cv. Mister up to 62.5% of plants within the cv. Salut. In Grabów, two cultivars, Mister and Bursztyn, remained healthy. The presence of CMV was detected in the plants of other cultivars, with the highest incidence being in Puma, where 55% of plants were infected. Only a few cases of the virus were reported in Osiny. However, a year later, many plants in this location were infected, particularly those belonging to cultivars Mister, Bursztyn and Goldeneye.
The presence of the virus in plant tissue was detected using the DAS-ELISA method revealed an absorbance value ranging from 0.024 to 0.176 for healthy plants and from 0.201 to 0.381 for infected plants. The presence of the virus in serologically positive plants was subsequently confirmed by RT-PCR detection of the coat protein gene of CMV. The amplicon was 760 bp in size (Figure S2).

3.3. The Occurrence of Viruses Depending on Cultivars, Locations and Years

A significant interaction was observed between cultivar and location, between cultivar and year, as well as between location and year. The effect of location on the rate of infected plants was not consistent across all cultivars. Of the six cultivars, Goldeneye was the one most frequently affected by BYMV (Table 3), especially in Osiny (Figure 1 and Figure S3). Plants belonging to cultivars Goldeneye (in Szepietowo and Osiny) and Salut (in all locations) were less infested in 2023, compared to the previous year, whereas the number of affected plants increased in cultivars such as Diament, Puma, Mister and Bursztyn (due to more numerous infections in Grabów and Osiny). In 2024, the number of cases of BYMV infection significantly increased in Grabów and Szepietowo, while it slightly decreased in Osiny (Figure 1 and Figure S3). However, across all three years of research conducted in three locations, it can be observed that Puma proved to be the cultivar least susceptible to BYMV (Table 3). Although it does not differ statistically in this respect from Salut, it stands out from the other cultivars.
CMV infection was less common than BYMV. In 2022, only 2.64% of all tested plants (within all cultivars in three locations) were infected with this pathogen (Table 3). The percentage of infected plants significantly increased in 2023, reaching 15.56% mainly due to numerous cases of the disease in Grabów and Szepietowo (Figure 2 and Figure S4). In turn, in 2024, the highest number of infected plants was reported in Osiny. However, considering all three years of the study, the highest rate of infected plants was observed in Grabów (Table 3). In 2024, Mister and Bursztyn were infected with CMV more frequently than in previous years (Figure S4). Furthermore, these cultivars were most commonly infected in Osiny, while Salut, Diament and Puma were rarely infected with the virus in this location.
Although the prevalence of the virus varied between the years and locations, no cultivar was distinguished from the others in terms of susceptibility to CMV under field conditions (Table 3).

4. Discussion

To date, no new Polish cultivars of yellow lupin have been tested for resistance to viral diseases. However, the increasing area under cultivation of this species, in conjunction with changing climatic conditions, is resulting in the dissemination of pathogens that attack lupins. In the context of organic farming, the potential for managing aphids that act as vectors for viral transmission is limited. This elevates the risk of viral infections in comparison to integrated crop production systems. Consequently, the susceptibility/resistance of cultivars becomes a pivotal factor influencing crop health [30,31].
BYMV and CMV are usually transmitted by aphids, which not only act as vectors for viruses, but also cause damage to crops by feeding on the plant. Therefore, breeders are making efforts to develop cultivars that are resilient to these insects [24]. A. pisum spreads more than 30 plant viruses, including BYMV and CMV. In addition, it prefers to feed on yellow lupins [4]. Wild lupin populations are protected from pests thanks to the presence of alkaloids in plant tissues, whereas the alkaloid content of cultivated lupin seeds has been reduced to below 0.02% for the safety of consumers and livestock [24].
Therefore, protecting lupins from viral infections using breeding methods can be achieved by obtaining new cultivars that are resistant to viruses or aphids. The susceptibility of a cultivar to aphid feeding depends on its alkaloid content, which is lethal to these pests and disrupts their fecundity, as well as its sugar content, which aphids prefer [4]. Our research showed that out of the six cultivars tested, Goldeneye is the most susceptible, since most of the infected plants belonged to this cultivar. On the other hand, the Puma cultivar had the fewest infected plants. Cv. Salut was also less susceptible to infection than others, although this difference was not statistically significant. Both Puma and Salut are relatively late and may have been colonised by aphids later. Adjusting the earliness of cultivars to the timing of pest emergence is one of the recommended strategies for disease control [8,30]. However, since our studies were conducted in the field under natural infection conditions, it is difficult to ascertain whether the response of plants was due to the resistance of this cultivar to the virus or to aphid feeding. To clarify the basis of the plants’ response, two independent experiments should be conducted under controlled conditions: plants should be artificially inoculated with the virus, and research should be conducted to determine the preference of aphids for feeding on individual cultivars.
Kordan et al. [4] demonstrated that the fecundity of aphids varied among three yellow lupin cultivars, and they supposed it could be connected with the chemical composition of plant tissue, especially regarding alkaloids and sugars. The number of nymphs on plants of the cv. Markiz was significantly higher than in the case of Juno and Taper. In yellow lupin, they detected two alkaloids—sparteine and lupanine. The highest content of lupanine was in the cultivars Juno and Markiz. These cultivars also accumulated the highest amounts of cyclitols. Although our observations did not include counting the pest population, it is worth noting that in the first year of the study, a small number of aphids were observed in the experimental fields. Then the number of these pests increased, especially in Grabów. Therefore, this may explain the high incidence of virus-infected plants in 2024. It should be noted that at that time, the Puma cultivar, which had yielded satisfactory results in other locations and in previous years, was also severely affected at this location. It can be assumed that this was due to the strong pressure of the pathogen.
The percentage of plants in which CMV was detected was much lower than that of plants infected with BYMV. However, it should be noted that many plants were co-infected with both viruses. Jones and Burcheli [32] explain that in the case of BYMV, the delay between the initial infection of the plant and the movement of the virus within the plant, resulting in the appearance of symptoms, is short, whereas CMV requires more time to manifest the disease symptoms. This may mean that in our studies, the pressure of CMV was not lower than that of BYMV, but the faster transmission of the latter virus in the plant limited the development of CMV infection.
Cultivating resistant cultivars is one method of avoiding viral infections, but it is not the only one. In organic farming, measures to reduce the occurrence of vectors are also important. Among others, the following phytosanitary methods are recommended: crop rotation, removal of plant debris, and keeping a distance from potential hosts of pathogens. Furthermore, it is advisable to use natural substances that have insecticidal properties or the natural predators of pests in organic systems [8,30]. Growing cereal crops near lupins is recommended, as cereals act as a barrier to virus transmission by aphids [11]. Jones [33] demonstrated that growing narrow-leaf lupin in the vicinity of barley reduced the spread of CMV and BYMV from neighbouring infected clover.
One of the most important precautions is to use healthy, pathogen-free seeds from certified sources [8,30]. This is crucial because seeds can be the primary source of infection at the place where plants are grown. However, it also hinders the international exchange of seed material [11].
For economic reasons and due to the limited number of organically grown cultivars, the availability of certified seeds from organic farms is low. However, it is permissible to use seeds produced by other methods [30]. Every year in our study, we used the certified seed material originating from seed companies. It should therefore be ruled out that the year-on-year increase in the number of viral infections was the result of pathogens being transferred to seeds from the experimental field in the previous season.

5. Conclusions

Plants were infected with BYMV more often than CMV. This may be because this pathogen exerts stronger natural pressure or spreads faster in plants. No statistically significant differences were found between cultivars regarding the number of plants infected with CMV. The highest number of BYMV infections was found in the Goldeneye cultivar, meaning that, in terms of viral diseases, this cultivar is not suitable for organic cultivation. Conversely, Puma was the cultivar least susceptible to BYMV infection under natural conditions. It is difficult to determine whether this is due to the genetic resistance of this cultivar to the virus or its resistance to aphid feeding, as these insects are the vector. However, this cultivar was also severely infested under conditions of high aphid abundance and, presumably, strong pathogen pressure. Nevertheless, among the tested cultivars, Puma seems to be the most suitable for organic cultivation.

Supplementary Materials

The following supporting information can be downloaded at: https://www.mdpi.com/article/10.3390/agriculture15192003/s1, Figure S1: Detection of BYMV in yellow lupin plants. Analyses of RT-PCR products obtained with the use of primers PI/PII specific to C-terminal region of viral coat protein gene (amplicon size—733 bp); Figure S2: Detection of CMV in yellow lupin plants. Analyses of RT-PCR products obtained with the use of primers 5′CP/3′CP specific to viral coat protein gene (amplicon size—760 bp); Figure S3: The interaction plots for the occurrence of BYMV in yellow lupin plants; Figure S4: The interaction plots for the occurrence of CMV in yellow lupin plants; Table S1: The number of BYMV infected plants of yellow lupin in the years 2022–2024 in three locations; Table S2: The number of CMV infected plants of yellow lupin in the years 2022–2024 in three locations.

Author Contributions

Conceptualization, A.C. and D.C.; methodology, A.C. and D.C.; software, A.C.; validation, A.C., D.C. and J.K.; formal analysis, A.C.; investigation, A.C. and D.C.; resources, A.C. and J.K.; data curation, A.C.; writing—original draft preparation, A.C.; writing—review and editing, A.C. and D.C.; visualisation, A.C. and D.C.; supervision, A.C.; project administration, A.C.; funding acquisition, J.K. All authors have read and agreed to the published version of the manuscript.

Funding

This research was funded as part of the scientific-research sub-programme 1, task 1.06 implemented in 2022–2025, within the statutory activity of the Institute of Soil Science and Plant Cultivation-State Research Institute, Puławy, Poland, financed by the Polish Ministry of Science and Higher Education.

Institutional Review Board Statement

Not applicable.

Data Availability Statement

The data presented in this study are available on request from the corresponding author.

Conflicts of Interest

The authors declare no conflicts of interest.

Abbreviations

The following abbreviations are used in this manuscript:
BYMVbean yellow mosaic virus
CMVcucumber mosaic virus

References

  1. Jones, R.A.C. Host Resistance to Virus Diseases Provides a Key Enabler towards Fast Tracking Gains in Grain Lupin Breeding. Plants 2023, 12, 2521. [Google Scholar] [CrossRef] [PubMed]
  2. Cebulska, A.; Jankowiak, H.; Weisbauerova, E.; Nevrkla, P. Influence of an increased content of pea and yellow lupin protein in the diet of pigs on meat quality. Porc. Health Manag. 2021, 7, 63. [Google Scholar] [CrossRef]
  3. Batista, A.; Kesy, J.; Sadowska, K.; Karolewski, Z.; Bocianowski, J.; Wozniak, A.; Morkunas, I. The role of silver nanoparticles in yellow lupine (Lupinus luteus L.) defense response to Fusarium oxysporum f.sp. lupini. Sci. Rep. 2025, 15, 16136. [Google Scholar] [CrossRef]
  4. Kordan, B.; Gabryś, B.; Dancewicz, K.; Lahuta, L.B.; Piotrowicz-Cieślak, A.; Rowińska, E. European yellow lupine, Lupinus luteus, and narrow-leaf lupine, Lupinus angustifolius, as hosts for the pea aphid, Acyrthosiphon pisum. Entomol. Exp. Et Appl. 2008, 128, 139–146. [Google Scholar] [CrossRef]
  5. Gołębiewska, B.; Pajewski, T. Changes in the Development Trends of Organic Farming in the World. Ann. Pol. Assoc. Agric. Agribus. Econ. 2025, XXVII, 83–95. [Google Scholar] [CrossRef]
  6. Statistics Poland. Statistical Yearbook of Agriculture; Statistics Poland: Warszawa, Poland, 2024; p. 92.
  7. Rybicki, E.P.; Foster, G.D. Chapter 17—Plant diseases caused by viruses. In Agrios’ Plant Pathology, 6th ed.; Academic Press: Cambridge, MA, USA, 2024; pp. 547–606. [Google Scholar] [CrossRef]
  8. Dell’Olmo, E.; Tiberini, A.; Sigillo, L. Leguminous Seedborne Pathogens: Seed Health and Sustainable Crop Management. Plants 2023, 12, 2040. [Google Scholar] [CrossRef]
  9. Sastry, K.S.; Mandal, B.; Hammond, J.; Scott, S.W.; Briddon, R.W. Lupinus spp. (Lupin). In Encyclopedia of Plant Viruses and Viroids, 1st ed.; Springer: Berlin/Heidelberg, Germany, 2019; pp. 1414–1421. [Google Scholar]
  10. Hasiów-Jaroszewska, B.; Budzyńska, D.; Rymelska, N.; Korpys, P.; Borodynko-Filas, N. Phylogenetic evidence of natural reassortants in the Cucumber mosaic virus population in Poland. Can. J. Plant Pathol. 2018, 40, 587–593. [Google Scholar] [CrossRef]
  11. Meena, B.R.; Biswas, K.K. Status of the major aphid-transmitted viruses of pulse crops in India. Indian Phytopathol. 2024, 77, 561–572. [Google Scholar] [CrossRef]
  12. Rhee, S.J.; Watt, L.G.; Bravo, A.C.; Murphy, A.M.; Carr, J.P. Effects of the cucumber mosaic virus 2a protein on aphid-plant interactions in Arabidopsis thaliana. Mol. Plant Pathol. 2020, 21, 1248–1254. [Google Scholar] [CrossRef] [PubMed]
  13. Tian, Z.; Liu, W.; Luo, C.; Li, Y.; Liu, T. Transmission Comparisons of Cucumber Mosaic Virus Subgroup I and II Isolates by Different Aphid Species. J. Phytopathol. 2012, 160, 299–303. [Google Scholar] [CrossRef]
  14. Jones, R.A.C.; Congdon, B.S. Seed-Borne Virus Research: 1. Alfalfa and Cucumber Mosaic Viruses and Less Important Viruses. Viruses 2024, 16, 144. [Google Scholar] [CrossRef] [PubMed]
  15. Mochizuki, T.; Ohki, S.T. Cucumber mosaic virus: Viral genes as virulence determinants. Mol. Plant Pathol. 2012, 13, 217–225. [Google Scholar] [CrossRef]
  16. Hasiów-Jaroszewska, B.; Kasprowicz, M.; Borodynko-Filas, N. Rapid detection of Cucumber mosaic virus isolates representing distinct phylogenetic subgroups by reverse transcription, loop-mediated isothermal amplification. J. Plant Dis. Prot. 2017, 125, 227–230. [Google Scholar] [CrossRef]
  17. Mrkvová, M.; Kemenczeiová, J.; Achs, A.; Alaxin, P.; Predajna, L.; Šoltys, K.; Šubr, Z.; Glasa, M. Molecular Characteristics and Biological Properties of Bean Yellow Mosaic Virus Isolates from Slovakia. Genes 2024, 10, 262. [Google Scholar] [CrossRef]
  18. Jones, R.A.C.; Coutts, B.A.; Cheng, Y. Yield limiting potential of necrotic and non-necrotic strains of Bean yellow mosaic virus in narrow-leafed lupin (Lupinus angustifolius). Aust. J. Agric. Res. 2003, 54, 849–859. [Google Scholar] [CrossRef]
  19. Carpenter, D.; Luckett, D. Cucumber mosaic virus in lupins. Puls Point 2003, 18, 1–2. [Google Scholar]
  20. Hasiów-Jaroszewska, B.; Komorowska, B. Diversity of the Polish isolates of bean yellow mosaic virus (BYMV) isolated from broad bean. Prog. Plant Prot. 2022, 62, 44–50. [Google Scholar] [CrossRef]
  21. Minicka, J.; Zarzynska-Nowak, A.; Budzynska, D.; Borodynko-Filas, N.; Hasiow-Jaroszewska, B. High-Throughput Sequencing Facilitates Discovery of New Plant Viruses in Poland. Plants 2020, 9, 820. [Google Scholar] [CrossRef]
  22. Boschin, G.; Resta, D. Alkaloids Derived from Lysine: Quinolizidine (a Focus on Lupin Alkaloids). In Natural Products; Ramawat, K., Mérillon, J.M., Eds.; Springer: Berlin/Heidelberg, Germany, 2013. [Google Scholar]
  23. Sujak, A.; Kotlarz, A.; Strobel, W. Compositional and nutritional evaluation of several lupin seeds. Food Chem. 2006, 98, 711–719. [Google Scholar] [CrossRef]
  24. Adhikari, K.N.; Edwards, O.R.; Wang, S.; Ridsdill-Smith, T.J.; Buirchell, B. The role of alkaloids in conferring aphid resistance in yellow lupin (Lupinus luteus L.). Crop. Pasture Sci. 2012, 63, 444. [Google Scholar] [CrossRef]
  25. Estivi, L.; Brandolini, A.; Gasparini, A.; Hidalgo, A. Lupin as a Source of Bioactive Antioxidant Compounds for Food Products. Molecules 2023, 28, 7529. [Google Scholar] [CrossRef]
  26. PN-EN ISO 10390:2022-09; Soil, Treated Biowaste and Sludge–Determination of pH. Polish Committee for Standardizations: Warsaw, Poland, 2022.
  27. Clark, M.F.; Adams, A.N. Characteristics of the Microplate Method of Enzyme-Linked Immunosorbent Assay for the Detection of Plant Viruses. J. Gen. Virol. 1977, 34, 475–483. [Google Scholar] [CrossRef]
  28. Katoch, M.; Ram, R.; Zaidi, A.A.; Garg, I.D. Status of bean yellow mosaic virus on Gladiolus. Crop. Prot. 2002, 21, 861–865. [Google Scholar] [CrossRef]
  29. Zhang, D.; Tan, X.; Willingmann, P.; Adam, G.; Heinze, C. Problems Encountered with the Selection of Cucumber Mosaic Virus (CMV) Isolates for Resistance Breeding Programs. J. Phytopathol. 2011, 159, 621–629. [Google Scholar] [CrossRef]
  30. van Bruggen, A.H.; Gamliel, A.; Finckh, M.R. Plant disease management in organic farming systems. Pest Manag. Sci. 2016, 72, 30–44. [Google Scholar] [CrossRef] [PubMed]
  31. Biswas, S.; Das, R. Organic farming to mitigate biotic stresses under climate change scenario. Bull. Natl. Res. Cent. 2024, 48, 71. [Google Scholar] [CrossRef]
  32. Jones, R.A.C.; Burchell, G.M. Resistance to Cucumber mosaic virus in Lupinus mutabilis (Pearl lupin). Australas. Plant Pathol. 2004, 33, 591–593. [Google Scholar] [CrossRef]
  33. Jones, R.A.C. Patterns of spread of two non-persistently aphid-borne viruses in lupin stands under four different infection scenarios. Ann. Appl. Biol. 2005, 146, 337–350. [Google Scholar] [CrossRef]
Agriculture 15 02003 g001
Figure 1. The occurrence of BYMV in six cultivars of yellow lupin (Goldeneye, Salut, Diament, Puma, Mister, Bursztyn) in the years 2022–2024 in three locations (Szepietowo, Grabów, Osiny); a difference in letters displays significant differences according to the Tukey test at p ≤ 0.05. The data were collected from four repetitions; bars indicate ± SD.
Figure 1. The occurrence of BYMV in six cultivars of yellow lupin (Goldeneye, Salut, Diament, Puma, Mister, Bursztyn) in the years 2022–2024 in three locations (Szepietowo, Grabów, Osiny); a difference in letters displays significant differences according to the Tukey test at p ≤ 0.05. The data were collected from four repetitions; bars indicate ± SD.
Agriculture 15 02003 g001
Agriculture 15 02003 g002aAgriculture 15 02003 g002b
Figure 2. The occurrence of CMV in six cultivars of yellow lupin (Goldeneye, Salut, Diament, Puma, Mister, Bursztyn) in the years 2022–2024 in three locations (Szepietowo, Grabów, Osiny); a difference in letters displays significant differences according to the Tukey test at p ≤ 0.05. The data were collected from four repetitions; bars indicate ± SD.
Figure 2. The occurrence of CMV in six cultivars of yellow lupin (Goldeneye, Salut, Diament, Puma, Mister, Bursztyn) in the years 2022–2024 in three locations (Szepietowo, Grabów, Osiny); a difference in letters displays significant differences according to the Tukey test at p ≤ 0.05. The data were collected from four repetitions; bars indicate ± SD.
Agriculture 15 02003 g002aAgriculture 15 02003 g002b
Table 1. The characteristics of yellow lupin cultivars.
Table 1. The characteristics of yellow lupin cultivars.
CultivarFloweringMaturationTypeBreederYear of Entry
in the Polish Register
GoldeneyeearlymediumindeterminatePHR2019
SalutlatemediumindeterminateHR Smolice2020
DiamentearlymediumindeterminatePHR2019
PumalatelateindeterminateHR Smolice2017
MistermediummediumindeterminatePHR2003
BursztynearlyearlyindeterminatePHR2014
Polish breeding and seed companies: HR Smolice—Hodowla Roślin Smolice Sp. z o.o. Grupa IHAR, Kobylin, Poland; PHR—Poznańska Hodowla Roślin Sp. z o.o., Tulce, Poland
Table 2. Primers used for RT-PCR and PCR conditions for detection of viruses.
Table 2. Primers used for RT-PCR and PCR conditions for detection of viruses.
VirusPrimer NamePrimer SequencePCR ConditionsAmplicon Size [bp]Reference
BYMVPITTGAATCTGAACTGAAGTATT94 °C 5 min; 30 × (94 °C 60 s, 55 °C 90 s, 72 °C 60 s) 72 °C 5 min733[28]
PIICTCCTTTCTACAAAATGGACA
CMV5′CPATGGACAAATCTGRATCWMCC40 × (92 °C 30 s, 60 °C 45 s, 72 °C 60 s) 72 °C 5 min760[29]
3′CPCTGGATGGACAACCCGTTC
Table 3. Percentage of plants infected with BYMV and/or CMV within six cultivars of yellow lupin in years 2022–2024 in three locations (Szepietowo, Grabów and Osiny).
Table 3. Percentage of plants infected with BYMV and/or CMV within six cultivars of yellow lupin in years 2022–2024 in three locations (Szepietowo, Grabów and Osiny).
Percentage of Plants Infected with:
BYMVCMV
Cultivar
Goldeneye59.17 e11.11 a
Salut30.28 ab12.50 a
Diament34.17 bc16.11 a
Puma23.34 a10.28 a
Mister43.89 d11.10 a
Bursztyn40.3 cd12.20 a
Location
Szepietowo32.08 A12.22 AB
Grabów55.42 B14.17 B
Osiny28.05 A8.89 A
Year
202224.58 †2.64 †
202328.89 †15.56 *
202461.94 *17.08 *
A difference in lowercase letters, capital letters and symbols (*,†) in columns displays significant statistical differences according to the Tukey test at p ≤ 0.05 between cultivars, locations and years, respectively.
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Czubacka, A.; Czarnecka, D.; Księżak, J. The Infection of Yellow Lupin (Lupinus luteus L.) with Bean Yellow Mosaic Virus (BYMV) and Cucumber Mosaic Virus (CMV) in Organic Farming in Eastern Poland. Agriculture 2025, 15, 2003. https://doi.org/10.3390/agriculture15192003

AMA Style

Czubacka A, Czarnecka D, Księżak J. The Infection of Yellow Lupin (Lupinus luteus L.) with Bean Yellow Mosaic Virus (BYMV) and Cucumber Mosaic Virus (CMV) in Organic Farming in Eastern Poland. Agriculture. 2025; 15(19):2003. https://doi.org/10.3390/agriculture15192003

Chicago/Turabian Style

Czubacka, Anna, Diana Czarnecka, and Jerzy Księżak. 2025. "The Infection of Yellow Lupin (Lupinus luteus L.) with Bean Yellow Mosaic Virus (BYMV) and Cucumber Mosaic Virus (CMV) in Organic Farming in Eastern Poland" Agriculture 15, no. 19: 2003. https://doi.org/10.3390/agriculture15192003

APA Style

Czubacka, A., Czarnecka, D., & Księżak, J. (2025). The Infection of Yellow Lupin (Lupinus luteus L.) with Bean Yellow Mosaic Virus (BYMV) and Cucumber Mosaic Virus (CMV) in Organic Farming in Eastern Poland. Agriculture, 15(19), 2003. https://doi.org/10.3390/agriculture15192003

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop