Functional Study of the WRKY Transcription Factor Family PgWRKY064-04 Gene in Panax ginseng

Abstract

Ginseng (Panax ginseng) is a valuable medicinal plant whose primary active components, known as ginsenosides, play a significant role in anti-cancer, anti-inflammatory, and anti-diabetic effects. WRKY transcription factors represent a prominent class of transcription factors in higher plants, fulfilling essential functions in numerous processes such as plant growth and development, reactions to biotic and abiotic stresses, and the control of secondary metabolism. This study is based on the laboratory’s previous bioinformatics analysis of the WRKY gene family in ginseng. After in-depth analysis, the PgWRKY064-04 gene was identified, which is significantly associated with ginsenosides. The physicochemical properties and expression patterns of this gene were analyzed, indicating that its expression in ginseng is temporally and spatially specific. A subcellular localization vector for this gene was constructed, confirming that it functions in the cell nucleus. Subsequently, overexpression vectors and interference vectors for PgWRKY064-04 were constructed, and ginseng adventitious roots were transformed using Agrobacterium-mediated transformation, successfully yielding positive materials. Gene expression levels and saponin content in the positive materials were detected, preliminary findings indicate that the expression of the PgWRKY064-04 gene is negatively correlated with the biosynthesis of ginsenosides. This study complements research on the functional roles of WRKY transcription factor family genes in ginseng, paving the way for future efforts to enhance ginsenoside production using modern biotechnological approaches.

1. Introduction

Panax ginseng C. A. Meyer, commonly known as ginseng, is a perennial plant that is part of the Araliaceae family. It is a valuable medicinal plant with a history of medicinal use dating back over two thousand years [1] and has now become one of the most popular herbs in the world [2]. The primary active constituents of ginseng are ginsenosides, which are classified as triterpenoids. To date, over 150 naturally occurring ginsenosides have been isolated from various parts of the ginseng plant, including its roots, leaves, stems, fruits, and flowers [3,4]. Ginsenosides are classified into three types: tetracyclic triterpenoid dammarane-type ginsenosides, pentacyclic triterpenoid oleanolic acid-type ginsenosides, and oxytetracycline-type ginsenosides. Among these, dammarane-type ginsenosides are further subdivided into protopanaxadiol (PPD) and protopanaxatriol (PPT). Protopanaxadiol type ginsenosides include Rb1, Rb2, Rb3, Rc, Rd, Rg3, etc., protopanaxatriol type includes Re, Rg1, Rg2, etc., and oleanolic acid type ginsenosides are Ro [5]. Ginsenosides have anti-cancer, anti-inflammatory, antioxidant, cardiovascular protection, and immunomodulatory effects [6,7,8]. The demand for ginsenosides is increasing, but the content of ginsenosides in ginseng is low, and because of its complex structure, it cannot be produced on a large scale by chemical synthesis at present. Therefore, it is crucial to utilize modern biotechnological means to increase the yield of ginsenosides.

WRKY transcription factors are an important family of transcription factors in plants that play important roles in growth and development [9], biotic stress [10], abiotic stress [11], and secondary metabolism regulation [12]. This family has a highly conserved structural domain WRKYGQK sequence at the N-terminus and a zinc finger-like structure C (2) H (2) (CX4-5CX22-23HXH) or C2HC (CX7CX23-24HXC) sequence at the C-terminus [13,14]. The WRKY gene family can be categorized into three main groups (Group I, II, and III) based on the number and characteristics of structural domains [13,14,15]. Group I of WRKY genes contain two WRKY domains, while group II and III of WRKY genes carry only one WRKY domain. Group II of WRKY genes are usually divided into five subgroups named II a, b, c, d, and e based on their phylogenetic relationships [14]. WRKY transcription factors can bind to W-box-containing genes and regulate their expression, which in turn regulates the corresponding response mechanisms of the plant. The first WRKY genes were identified in sweet potatoes in 1994 [16]. Since then, WRKY genes have been identified in many other plants. For example, 74 WRKY genes have been identified in Arabidopsis [17], 174 in soybeans [18], 102 in cotton [19], 58 in eggplants [20], and 78 in garlic [21]. This family has been identified in ginseng and also found to respond to salt stress [22].

In recent years, with the increasing research on transcription factors, it has been found that WRKY transcription factors play an important role in plant metabolic processes [23]. Plants produce a large number of secondary metabolites during metabolism, including alkaloids, terpenoids, phenolics, etc., and these secondary metabolites play a key role in plant-environment interactions as well as growth and development. Terpenoids are the largest known class of secondary metabolites. GaWRKY from Asian cotton regulates sesquiterpene cyclases at pathway branch points, thereby enhancing the production of cotton phenols [24]. Artemisinin is a secondary metabolite of the medicinal plant Artemisia annua L., which is the active ingredient in anti-malarial drugs. The overexpression of the AaWRKY1 gene has been shown to result in an increase in the levels of ADS and CYP genes, which are critical enzymes in the artemisinin biosynthesis pathway. Meanwhile, the content of artemisinin in the transgenic plants was significantly higher than that in the control group. The findings demonstrated that AaWRKY1 gene enhances the artemisinin content by modulating the expression of ADS and CYP gene [25]. In ginseng transgenic cells overexpressing PgWRKY4X, the squalene epoxygenase (PgSE) gene was found to be up-regulated in expression, and ginsenoside accumulation was increased; electrophoretic mobility shift analysis revealed that PgWRKY4X binds to the W-box of the PgSE promoter, and the study indicated that PgWRKY4X could positively regulate ginsenoside synthesis [26].

This study builds upon previously published data on the WRKY transcription factor family [22] to analyze the correlation between the WRKY family and ginsenosides, as well as the key enzyme genes involved in ginsenoside synthesis. The analysis identified one gene, PgWRKY064-04, that is most closely associated with ginsenoside synthesis. The protein sequence characteristics, physicochemical properties, and expression patterns of this gene in ginseng were systematically analyzed. The gene was successfully cloned, and a subcellular localization vector was constructed. Through the transient transformation of tobacco leaves, the gene was located in the cell nucleus. Overexpression vectors and interference vectors were also constructed. Through the application of Agrobacterium-mediated genetic transformation on ginseng adventitious roots, successful ginseng hairy root clones were generated. Subsequently, the gene expression levels and saponin contents of these clones were assessed. This study preliminarily validated the functional role of the PgWRKY064-04 gene in regulating ginsenoside biosynthesis. It provides further theoretical foundations and technical support for the study of the ginseng WRKY gene family and offers new directions for utilizing modern biotechnological methods to regulate ginsenoside biosynthesis.

2. Results

2.1. Correlation Analysis Between WRKY Gene Family and Ginsenosides

In the pre-laboratory analysis work [22], a total of 118 WRKY gene family sequences were identified. Using SPSS 23.0 version for correlation analysis, we found that 84 transcripts derived from 45 genes exhibited significant (p ≤ 0.05) or highly significant (p ≤ 0.01) correlations with at least one monosaccharide glycoside. Moreover, the majority of these transcripts showed significant (p ≤ 0.05) or highly significant (p ≤ 0.01) correlations with multiple monosaccharide glycosides, suggesting that 84 out of the 118 WRKY transcripts are associated with ginsenoside biosynthesis. Based on these findings, these 84 transcripts were selected as candidate sequences for further investigation (Table S1).

2.2. Correlation, Expression Patterns, and Interaction Network Analysis of 84 WRKY Transcripts with Ginsenoside Synthesis Key Enzyme Genes

First, by calculating the correlation between 84 PgWRKY genes associated with ginsenoside synthesis and 16 key enzyme genes in the validated ginsenoside biosynthesis pathway, we found that 69 transcripts exhibited significant (p ≤ 0.05) or highly significant (p ≤ 0.01) correlations with at least one monoside. These 69 transcripts were provisionally designated as candidate genes I. To further investigate the specific expression patterns of the 84 PgWRKY and the 16 key enzyme genes, we plotted gene expression profiles, as shown in Figure 1A–C. The expression levels of the key enzyme genes were found to be similar across four different ages (5, 12, 18, and 25 years old) of ginseng roots, 14 distinct tissues of 4-year-old ginseng, and 42 farmer’s cultivars of 4-year-old ginseng roots, suggesting that the expression patterns of these key enzymes have certain common features. Additionally, 34 PgWRKY transcripts clustered together with the key enzyme genes, and these 34 transcripts were provisionally designated as candidate gene II. To further explore the interaction relationships between the 84 WRKY genes and the 16 key enzyme genes, we conducted a co-expression network analysis, as shown in Figure 1D. In the 14 distinct tissues of 4-year-old ginseng, when p ≤ 10⁻³, 19 PgWRKY candidate genes were grouped together with key enzyme genes in the same cluster. Figure 1E illustrates that within the 42 farmer’s cultivars of 4-year-old ginseng roots, a PgWRKY candidate gene was grouped with key enzyme genes when p ≤ 10⁻³. We provisionally designated these 19 (including one duplicate) PgWRKY genes as candidate genes III, hypothesizing that they may work together to regulate ginsenoside biosynthesis alongside key enzyme genes.

2.3. Identification of PgWRKY Genes Highly Associated with Ginsenoside Biosynthesis

Synthesizing the results of ginseng PgWRKY candidate transcript correlation analysis with key enzyme genes (Candidate gene I), expression pattern analysis with key enzyme genes (Candidate gene II), and interaction network with key enzyme genes (Candidate gene III) (Figure 2), six PgWRKY candidate genes involved in ginseng saponin biosynthesis that are tightly related were obtained (PgWRKY037, PgWRKY045-01, PgWRKY050-03, PgWRKY064-04, PgWRKY067, and PgWRKY084-20), and the PgWRKY064-04 gene was present in all the analyzed results, and it was also the only gene that formed an interactions group with 10 key enzyme genes in the interactions network analysis. It was therefore selected for in-depth study into WRKY gene function in ginseng.

2.4. Sequence Analysis of PgWRKY064-04 Gene

The PgWRKY064-04 gene, with a length of 1779 base pairs, encodes a protein comprising 226 amino acids. This protein has a molecular weight of 25,129.20 Da, an isoelectric point of 5.04, and an instability index of 52.79, indicating its instability. The gene contains multiple phosphorylation sites, as depicted in Figure 3A. The hydrophilicity of the PgWRKY064-04 protein was assessed. As illustrated in Figure 3B, the majority of hydrophobic amino acids have values greater than 0, while a minority of hydrophilic amino acids have values less than 0, suggesting that PgWRKY064-04 is predominantly hydrophobic. Figure 3C reveals that the protein structure comprises 36 α-helices (15.93%), 7 β-sheets (3.1%), 159 irregular coils (70.35%), and 24 extended chains (10.62%). Furthermore, Figure 3D presents the tertiary structure modeling, which confirms that PgWRKY064-04 consists of α-helices, β-sheets, and irregular coils.

2.5. Expression Trend Analysis of PgWRKY064-04 Gene

To examine the expression of the PgWRKY064-04 gene across four different ages, fourteen different tissues, and forty-two farmers’ cultivars, three heat maps depicting PgWRKY064-04 gene expression were generated. As illustrated in Figure 4A, the expression of the PgWRKY064-04 gene was most pronounced in 5-year-old ginseng roots and least pronounced in 12-year-old ginseng roots over the four different years; as shown in Figure 4B, among 14 tissues, PgWRKY064-04 gene expression was highest in fiber root and lowest in seed; as shown in Figure 4C, among 42 farmer cultivars, PgWRKY64-04 gene expression was highest in S37, higher in S15, S16, S31, S1, S11, S14, and S38. In summary, the expression of PgWRKY64-04 gene was temporally and spatially specific.

2.6. Subcellular Localization of the PgWRKY064-04 Gene

The recombinant expression vector for the subcellular localization of GFP-PgWRKY064-04 was successfully constructed and transfected into Agrobacterium tumefaciens GV3101. Nicotiana benthamiana leaves were infiltrated with GFP-PgWRKY064-04 or empty vector controls, respectively, and the results of laser confocal microscopy are shown in Figure 5. Compared with the results of the leaf injected with the empty bacterial solution, the leaf injected with the recombinant expression vector showed that only the nucleus was detected in the nucleus of the cell. Showed that the GFP signal of PgWRKY064-04 gene was detected only in the nucleus, indicating that PgWRKY064-04 gene functioned in the nucleus.

2.7. Analysis of Gene Expression Changes and Ginsenosides Content Changes in Overexpression-Positive Ginseng Hairy Roots

The DNA of well-cultivated ginseng hairy root asexual lines was extracted and subjected to triple PCR analysis, resulting in the identification of three overexpression-positive hairy root asexual lines (OE-01, OE-04, and OE-08). The results of target gene expression using fluorescence quantitative PCR were shown in Figure 6A. Among the three overexpressed hairy root asexual lines, the expression of PgWRKY064-04 was significantly elevated in the three individual roots compared to the control group. Soxhlet extraction was employed to isolate ginsenosides from the positive ginseng hairy roots, and the concentrations of the monomeric saponins Rg1, Rb2, and Rb3 were quantified, with the results presented in Figure 6B–D. In comparison to the control group, the levels of Rg1, Rb2, and Rb3 monomeric saponins in the three positive materials exhibited a declining trend. This observation suggests that the PgWRKY064-04 gene has the capacity to regulate ginsenoside synthesis and inhibit their production.

2.8. Analysis of Changes in Ginsenosides Content and Changes in Gene Expression of Interference-Positive Ginseng Hairy Roots

Five interference-positive ginseng hairy root asexual lines (No. 17, 59, 64, 151, 275) were identified. The expression levels of the target genes in these positive hairy roots were subsequently assessed, with the results presented in Figure 7A. In comparison to the control, the expression of PgWRKY064-04 was significantly reduced in four of the interference-positive hairy root asexual lines, with the exception of the No. 151 single-root line. Measurement of the ginsenosides content of the interfering positive hairy roots showed the results as Figure 7B–D. Compared with the control, the five positive materials showed an overall increasing trend in the content of Rg1, Rb2, and Rb3 monomeric saponins. Among them, the increasing trend of monomeric saponin Rg1 was obvious compared to the other two saponins. It indicates that PgWRKY064-04 can regulate the ginsenosides synthesis, which is consistent with the detection results of the ultra-quantitatively expressed positive materials, and the gene is mainly inhibitory to the ginsenosides synthesis.

3. Discussion

Ginseng is one of the traditional medicinal plants, and its main pharmacological activity comes from ginsenosides, which are now widely used in the fields of health care, cosmetics, and pharmaceuticals. Relevant studies have confirmed that the WRKY transcription factor family plays an important role in the secondary metabolism of medicinal plants. However, studies on the biological functions of the WRKY family genes in ginseng are still scarce. Therefore, in this study, based on the bioinformatics analysis of the WRKY transcription factor family in the previous period, we screened and identified a PgWRKY064-04 gene, which is significantly related to ginsenoside synthesis, for the subsequent functional studies.

Findings from related studies indicate that the expression of WRKY transcription factors exhibits variability across different tissues, years, and cultivars. For example, in eucommia, a large number of EuWRKY genes are expressed at high levels in leaf buds [27]; in groundnut, CtWRKY genes are expressed in roots, stems, leaves, flowers and fruits, and the CtWRKY genes are expressed at high levels in at least one tissue, and only at low levels in other tissues [28]; and in tea tree, CsWRKY7 is expressed mainly in old leaves and roots [29]. In this study, we mapped the heat maps of PgWRKY064-04 gene expression in 42 farmers’ cultivars, 14 tissues, and 4 different ages. We found the PgWRKY064-04 gene that was most highly expressed in 5-year-old ginseng. The expression of PgWRKY-64-04 gene was temporally and spatially specific in 14 tissues of ginseng, the expression is highest in the fiber root and lowest in the seed, aligning with observations in other species.

Subcellular localization can provide direction for studying the mechanism of action of genes and is an indispensable technique for studying gene function. Research indicates that WRKY transcription factors are primarily found in the nucleus. For example, in rice, the subcellular localization analysis of the OsWRKY28 fusion protein revealed that it is localized within the nucleus [30]; in maize, ZmWRKY106 was localized in the nucleus [31]; in wheat, TtWRKY256 was localized in the nucleus [32]; and in lemonade, CkWRKY33 was shown to be localized in the nucleus in tobacco epidermal cells [33]. In this study, we successfully constructed a GFP-PgWRKY064-04 recombinant vector and transferred it into tobacco epidermal cells by transient transformation, and the results showed that the PgWRKY064-04 gene was localized in the nucleus, which was in line with the characteristics of the WRKY transcription factors and the results of previous studies.

To assess the impact of this gene on ginsenosides, we developed both an overexpression vector and an interference vector. Ginseng adventitious roots were subjected to Agrobacterium-mediated transformation, resulting in the acquisition of three overexpression-positive ginseng hairy roots and five interference-positive ginseng hairy roots. The ginsenoside contents of the overexpressed positive roots were determined, and compared with the control group, the contents of Rg1, Rb2, and Rb3 saponins decreased. Interfering with the saponin content assay of the positive material, the three monomeric saponin contents showed an increasing trend. We hypothesized that the PgWRKY064-04 gene might be a negative regulator in the ginsenoside synthesis pathway by the two-way verification of gene overexpression and interference.

In the regulatory processes of secondary metabolites in medicinal plants, WRKY transcription factors have been demonstrated to exhibit bidirectional regulatory functions. Research has demonstrated that in Artemisia annua, AaWRKY1 has been observed to induce a substantial augmentation in anthocyanin content, a consequence of its ability to stimulate the expression of pivotal enzymes implicated in artemisinin synthesis, ADS, and CYP. In ginseng, PgWRKY4X gene has been found to interact with the W-box cis-element located within the promoter region of the PgSE gene, thereby exerting a positive regulatory influence on ginsenoside biosynthesis. In this study, PgWRKY064-04 from ginseng was found to exhibit a negative regulatory effect on ginsenoside biosynthesis, suggesting that members of the WRKY gene family may achieve functional differentiation through binding to promoters or interacting with transcription repressor complexes. In order to elucidate the molecular mechanism underlying its inhibition of ginsenoside biosynthesis, future studies should validate the long-term regulatory effects of PgWRKY064-04 on ginsenoside synthesis genes by establishing a stable transgenic system. Additionally, the target promoter sites to which it binds should be investigated using EMSA and ChIP-seq technologies. Furthermore, the interaction network between the PgWRKY064-04 gene and hormone signaling pathways (e.g., JA) can be investigated, and a dual-gene co-expression strategy can be developed to provide new avenues for the targeted optimization of ginsenoside synthesis.

4. Materials and Methods

4.1. Data and Materials

The databases used in this study were a ginseng transcriptome database and a ginseng genes expression database [34]. The ginseng adventitious root materials were obtained from the laboratory in the preliminary stage after healing induction. The seeds, vectors, and strains of N. benthamiana used in the experiment were kept by College of Life Science, Jilin Agricultural University and Jilin Engineering Research Center for Ginseng Gene Resource Development and Utilization.

4.2. Identification of WRKY Genes Related to Ginsenoside Biosynthesis

The laboratory identified the WRKY genes in ginseng from the previous work [22], and based on the expression of the PgWRKY gene in farmer’s cultivars of 4-year-old ginseng roots and the ginsenoside content of 42 different farmer’s cultivars, using SPSS version 23.0, the Pearson correlation coefficient (significant p ≤ 0.05, highly significant p ≤ 0.01) was determined for the expression of PgWRKY genes and the ginsenoside content to identify genes associated with ginsenoside synthesis. Pearson’s correlation coefficients were calculated between the above transcripts and the expression of 16 key enzyme genes in the ginsenoside synthesis pathway, and at the same time, using TBtools II software version 1.9 [35], the heatmap was developed to identify WRKY candidate genes associated with ginsenoside synthesis, which were clustered alongside key enzyme genes. Utilizing the expression levels of key enzyme genes and candidate genes related to ginsenoside synthesis across 42 farmer’s cultivars and 14 tissues. Pearson’s correlation coefficients were computed using the R language. Subsequently, interactions were visualized using the Bio Layout Express^3D software version 1.4 to identify candidate gene members of the WRKY gene family that exhibit strong interoperability with the key enzymes. Combining the above results, the WRKY genes highly related to ginsenoside biosynthesis were obtained as the focus of subsequent experimental studies.

4.3. Physicochemical Property Analysis of PgWRKY064-04 Gene

Use the Expasy ProtParam (https://web.expasy.org/protparam/, accessed on 7 October 2020) online software to analyze the physicochemical properties of the PgWRKY64-04 gene. Use the NetPhos (https://services.healthtech.dtu.dk/services/NetPhos-3.1/, accessed on 7 October 2020) online software to predict the phosphorylation sites of PgWRKY64-04. Use the Expasy ProtScale online software to predict the hydrophilicity/hydrophobicity of PgWRKY64-04. The secondary and tertiary structures of PgWRKY64-04 were analyzed using SOPMA (https://npsa-prabi.ibcp.fr/cgi-bin/npsa_automat.pl?page=npsa_sopma.html, accessed on 7 October 2020) and SWISS-MODEL (https://www.swissmodel.expasy.org/, accessed on 7 October 2020) software, respectively.

4.4. Gene Expression Pattern Analysis of PgWRKY064-04 Gene in Ginseng

To further investigate the gene expression pattern of the PgWRKY64-04 gene in ginseng, we examined its expression in 42 farmer’s cultivars of 4-year-old ginseng roots, 14 different tissues of 4-year-old ginseng, and in ginseng roots of 4 different ages (5, 12, 18, and 25 years old). The results were visualized using TBtools II software [35].

4.5. Cloning of PgWRKY064-04 Gene

The total RNA of ginseng was extracted and reverse-transcribed into cDNA using the SPARKscript II RT Plus kit (With gDNA Eraser) (Shandong Sparkjade Biotechnology Co., Ltd., Qingdao, China). Gene cloning primers were designed according to the basic principles of primer design, PgWRKY64-04-F primer: TCCCCCGGGATGATTAATGATATATGC; PgWRKY64-04-R primer: TCCCCCGGGTTACTGCTGAAAAATTAG. The reverse-transcribed cDNA served as a template for PCR amplification, facilitating the cloning of the PgWRKY064-04 gene. The resulting gene fragments were subsequently recovered for use in further experimental procedures.

4.6. Analysis of Subcellular Localization of PgWRKY064-04 Gene

The subcellular localization prediction of the PgWRKY064-04 gene was performed using the Plant-mPLoc (http://www.csbio.sjtu.edu.cn/bioinf/plant-multi/, accessed on 10 June 2021) online tool. The stop codon was removed, and exclusive primers for subcellularly localized cloned genes were set. The cDNA was used as a template to clone the subcellularly localized gene sequence, and the cloned sequence was inserted into the pCAMBIA3301-GFP vector (CaMV 35S constitutive promoter). The successfully ligated recombinant plasmid and pCAMBIA3301-GFP empty vector were transferred into Agrobacterium tumefaciens GV3101, and the bacterial solution was transiently transformed into tobacco leaves. Fluorescence signals were observed on tobacco leaves using a laser confocal microscope to confirm the location of PgWRKY064-04 gene expression in the cells.

4.7. Construction of PgWRKY064-04 Gene Expression Vector and Genetic Transformation

Utilizing the TIANGEN kit, the target gene was ligated with the pGM-T vector and subsequently transformed into E. coli DH5α in its competent state. Individual clone colonies were selected for amplification and dispatched to the company for sequencing, thereby confirming the successful cloning of the target gene and the effective construction of the cloning vector pGM-T-PgWRKY064-04. The cloning vector and expression vector pCAMBIA3301 (CaMV 35S constitutive promoter) were digested with Xma I restriction endonuclease, and this gene was overexpressed using the T4 ligase to construct the recombinant plasmid pCAMBIA3301-PgWRKY064-04. 200 bp or so of the sequence of the target gene PgWRKY064-04 was selected as the positive-sense fragment, and the negative complementation of the positive-sense fragment was the antisense fragment, and the positive-sense fragment was the antisense fragment, and the negative complementation was the antisense fragment. The reverse complementation represents the antisense fragment. The positive and antisense interfering fragments of the sequence were amplified and subsequently inserted into the intermediate vector pHANNIBAL. The region containing the interfering fragment was excised and inserted into the vector pART27 to generate the interfering recombinant plasmid pART27-PgWRKY064-04.

The overexpression recombinant plasmid of the PgWRKY064-04 gene was transformed into the C58C1 Agrobacterium sensory state, and the interference recombinant plasmid was transformed into the A4 Agrobacterium sensory state. At the same time, transform the empty vectors of the overexpression and interference vectors as controls, and preserve the positive bacterial cultures. The ginseng adventitious roots were excised and placed on Murashige and Skoog (MS) solid medium for a pre-culture period of two days. Subsequently, the roots were sectioned into 3–5 mm segments and immersed in a bacterial solution containing the recombinant plasmid for infestation. Upon completion of the infestation process, the sap was blotted using filter paper and transferred to 1/2 MS medium supplemented with acetosyringone for an additional two days. Following this period, the residual bacterial solution was again blotted dry with filter paper, and the material was placed on 1/2 MS medium containing cephalexin for incubation. The growth of the material was observed until the growth of hairy roots. The hairy roots were positively detected using PCR, and those identified as positive were inoculated into 1/2 MS liquid medium for expanded culture. Three biological replicates were set for each single root system for subsequent experiments.

4.8. Detection of Gene Expression and Ginsenosides Content of Positive Ginseng Hairy Roots

We extracted the RNA of positive ginseng hairy roots and design fluorescent quantitative primers for the PgWRKY064-04 gene. Utilizing the qRT-PCR kit procured from the company, three blank controls and three technical replicates were established, and ACT1 gene as the internal reference gene was normalized. All the genes expression were calculated by the formula: 2^−ΔΔCt.

The positive material was dried after 30 days of liquid expansion. All ginsenosides were extracted from the positive materials using Soxhlet extraction, and the saponin extracts were assayed for saponin content using high-performance liquid chromatography (HPLC). The chromatographic conditions were arranged as follows: Waters18 column (4.6 × 250 mm, 5 μM), mobile phases of purified water (A) and acetonitrile (B), mobile phase limiting flow rate of 1.1 mL/min, column temperature of 35 °C, injection volume of 15 μL. The correlation analysis showed that the PgWRKY064-04 was significantly correlated with the ginseng monomeric saponins contents of Rg1, Rb2, and Rb3. Therefore, only the contents of these three ginsenosides were detected in the present study.

5. Conclusions

This study analyzed the correlation between the WRKY transcription factor family and ginsenoside contents, as well as key enzyme genes in the ginsenoside synthesis pathway, based on previously published data on the WRKY transcription factor family. The PgWRKY064-04 gene was significantly correlated with ginsenoside content, and its expression in ginseng exhibited temporal and spatial specificity. Additionally, subcellular localization experiments confirmed that this gene functions in the nucleus. Subsequently, overexpression and interference expression vectors for this gene were constructed. Using Agrobacterium-mediated transformation, three overexpression-positive materials and five interference-positive materials were obtained. Analysis of ginsenoside content indicated that this gene functions as a negative regulator of ginsenoside synthesis. This study provides a theoretical foundation for investigating the role of the WRKY gene family in the regulation of ginsenoside biosynthesis in ginseng. In addition, this study provides a theoretical basis and technical support for the targeted regulation of ginsenoside biosynthesis using modern biotechnological methods.