Next Article in Journal
Neural Network-Guided Smart Trap for Selective Monitoring of Nocturnal Pest Insects in Agriculture
Previous Article in Journal
Predicting Winter Ammonia and Methane Emissions from a Naturally Ventilated Dairy Barn in a Cold Region Using an Adaptive Neural Fuzzy Inference System
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Cloning and Functional Validation of the Candidate Gene LuWRKY39 Conferring Resistance to Septoria linicola (Speg.) Garassini from Flax

1
Institute of Industrial Crops, Heilongjiang Academy of Agricultural Sciences, Harbin 150086, China
2
Institute of Pratacultural Science, Heilongjiang Academy of Agricultural Sciences, Harbin 150086, China
3
Institute of Plant Protection, Liaoning Academy of Agricultural Sciences, Shenyang 110161, China
*
Author to whom correspondence should be addressed.
Agriculture 2025, 15(14), 1561; https://doi.org/10.3390/agriculture15141561
Submission received: 13 June 2025 / Revised: 16 July 2025 / Accepted: 17 July 2025 / Published: 21 July 2025
(This article belongs to the Section Crop Genetics, Genomics and Breeding)

Abstract

WRKY transcription factors play key roles in plant immune responses, including resistance to fungal pathogens. In the present study, we identified a flax resistance-related gene Lus10021999, named LuWRKY39. Here, to identify the role of WRKY transcription factor in resistance of flax against Septoria linicola, we cloned and analyzed the gene LuWRKY39 via homologous cloning using bioinformatics methods and localized the encoded protein. Quantitative real-time PCR (qRT-PCR) was used to explore the response of this gene to S. linicola. The results showed that the gene that is 948 bp long exhibited the closest genetic relationship to WRKY in castor (Ricinus communis), as revealed by phylogenetic analysis, and the encoded protein was localized in the nucleus. The LuWRKY39 gene showed higher expression levels in resistant flax materials than in susceptible ones, and higher in roots and stems than in leaves. Furthermore, gene expression showed an upward trend following treatment with salicylic acid (SA) and methyl jasmonate (MeJA), indicating that LuWRKY39 is involved in the regulation of SA and JA signals. By silencing LuWRKY39 in flax using virus-induced gene silencing (VIGS), the processed plants were more sensitive to S. linicola than untreated plants. Gene expression analysis and disease index statistics confirmed that the silenced plants were more susceptible, highlighting the crucial role of LuWRKY39 in flax disease resistance. This study provides a foundation for functional investigations of WRKY genes in flax and the identification of disease resistance genes.

1. Introduction

Flax (Linum usitatissimum L.) is an annual herbaceous dicotyledon of the genus Linum in the family Linaceae and is one of the earliest natural plant fibers utilized by humans. Because of its high tensile strength, moisture absorption, and excellent breathability [1], flax is widely used as a raw material in various industries. However, compared to developed countries such as France, the Netherlands, and Belgium, flax stem yields in China remain relatively low. In addition to factors such as germplasm, soil, and climate, diseases significantly contribute to reduced yields, causing up to 50% losses in severe cases in stem production [2]. Pasmo is a common fungal disease caused by Septoria linicola (Speg.) Garassini and primarily spread through seeds, which has become increasingly prevalent. Recent surveys in regions including Heilongjiang and Yunnan have reported disease incidence rates of 10–30%, with severe outbreaks affecting over 80% of plants in certain areas during harvest, resulting in notable production losses [3]. Despite this, research on effective and environment-friendly control methods for pasmo remains scarce, and progress in genetic breeding for disease resistance in flax is slow. To address this, creating disease-resistant germplasm resources through hybridization or other methods to cultivate resistant varieties is essential. With advancements in molecular biology and genomics, numerous disease resistance genes have been cloned, and genetic engineering has emerged as a promising strategy for enhancing crop resistance to diseases.
The application of genetic engineering in flax disease resistance research remains limited, with relatively few reports on the cloning of resistance genes. This highlights the urgent need for the further exploration and identification of novel resistance genes. For instance, molecular marker technology has been used to locate the gene conferring flax resistance to powdery mildew, leading to the discovery of the resistance gene Pm-Linum [4]. Additionally, NBS-class disease resistance genes have been identified across the flax genome and analyzed using bioinformatics tools [5]. Research on enhancing flax resistance to Fusarium oxysporum has also been conducted, revealing that the compounds HPA and M4 can induce oxidative stress, alter the expression patterns of defense-related genes, and promote callus deposition [6]. Studies on the expression patterns of flax resistance-related genes revealed differential expression of Lus10003106, Lus10022077, and Lus10021999, suggesting their potential roles as key resistance genes against pasmo disease [7]. To date, most genes cloned in flax have been related to lignin or cellulose synthesis, seed development, and dormancy. For example, genes such as 4CL, LuBRI1, and LuBES1 have been identified in these pathways [8,9]. Additionally, the genome and CDS sequences of transcription factor ABI3 were successfully cloned from oil flax, with functional analyses revealing three transcripts. Among these, LuABI3-W1 and LuABI3-W2 have been implicated in the ABA signaling pathway [10]. Three additional flax genes, LuDWF4 (involved in brassinosteroid (BR) biosynthesis), LuBRI1 (a BR signal transduction receptor), and LuBES1 (a BR signaling transcription factor), were also cloned and functionally validated [11].
WRKY transcription factors (TFs) affecting plant disease resistance have been extensively studied. These TFs are crucial regulators of plant responses to biotic and abiotic stresses, as well as aging, growth, and development [12]. Studies have indicated that WRKY TFs can modulate plant resistance by positively or negatively regulating the expression of defense-related genes [13]. For instance, AtWRKY4 overexpression in Arabidopsis significantly promotes resistance to Pseudomonas syringae [14], whereas VaWRKY33 in adzuki beans plays a positive role in early resistance to Uromyces vignae infection [15]. Additionally, disease resistance-related genes in plants are expressed under the regulation of WRKY transcription factors, which are integral to disease resistance response pathways, including the JA and SA signaling pathways [16]. For example, the exogenous application of SA and MeJA to bananas upregulates MaWRKY1 and MaWRKY2, which can positively regulate numerous defense-related genes and enhance resistance to Colletotrichum musae [17]. In cotton, GhWRKY40 mediates resistance through the SA and JA pathways, although it may exhibit a negative regulatory effect on resistance to Ralstonia solanacearum [18]. Research on Paeonia lactiflora suggests that infection with Alternaria tenuissima decreases salicylic acid (SA) and increases endogenous jasmonic acid (JA) levels. Silencing PlWRKY13 and PlWRKY65 can cause corresponding changes in these hormones, demonstrating their roles as disease-related transcriptional activators in regulating SA and JA signaling pathways [19,20].
VIGS serves as an effective technique for silencing endogenous genes in plants using recombinant viruses [21]. In 1995, Kumagai first used TMV to silence the PDS gene in tobacco, and in 2002, Holzberg silenced the PDS gene in barley using BSMV, later extending its application to wheat [22]. In recent years, VIGS has been widely used in gene function research of fruit trees, peppers, tomatoes and other plants [23,24,25,26]. VIGS technology has also been used to improve starch quality, as shown by Huang et al. [27].
At present, no studies have explored the response of flax WRKY to pathogen stress. In our previous studies, a flax resistance-related gene, Lus10021999, was observed, which shared a high sequence similarity with AtWRKY39 and was provisionally named LuWRKY39. In this study, a cDNA fragment of LuWRKY39 was obtained through homologous cloning, and its structural and sequence characteristics were analyzed. Gene expression analysis was performed using qRT-PCR. Furthermore, its role in flax resistance to pasmo was verified using VIGS technology. This study contributes to breeding efforts aimed at improving flax disease resistance.

2. Materials and Methods

2.1. Materials, Inoculation, and Treatments

The flax resistant material ‘y62-9’ and the susceptible material ‘y64-5’ were preserved and propagated by the Industrial Crops Institute of the Heilongjiang Academy of Agricultural Sciences. These materials were subsequently used for the total RNA extraction.
Flax plants affected by pasmo under natural conditions were collected from Minzhu Park, Heilongjiang Academy of Agricultural Sciences, China. Pathogen spores from diseased tissues were gently scraped using a surgical knife, and suspended in sterile water to prepare spore suspension. The suspension was applied to a water agar plate (water + agar + 100 μg/mL streptomycin) using an inoculation ring and observed under a microscope. Individual spores were picked up using a needle and inoculated into PDA medium containing 100 μg/mL streptomycin. The pathogen was incubated at 26 °C in a constant-temperature incubator (with a light/dark period of 16 h/8 h) for 10–15 d, and spore germination was monitored during this period. A single-spore strain was transferred to a cryovial, mixed with 20% glycerol, and stored at 4 °C until further use. For pathogen infection, the spore suspension spraying method was employed, with the spore suspension concentration adjusted to 1 × 107 cells/mL using a blood cell counting plate. When the flax plants reached the 3–6 pairs of true leaf stage, the spore suspension was evenly sprayed onto flattened leaves using a precision spray bottle. Plants were incubated at 22 °C incubation under alternating light and dark conditions. Three replicates were used for all treatments, with 10 leaves per replicate. Leaves were collected at 0, 6, 12, 24, 48, and 72 h after infection for analysis.
Flax seedlings of y62-9 and y64-5 at similar growth stages were sprayed with 0.1 mmol/L methyl jasmonate (MeJA) and 5 mmol/L salicylic acid (SA) until runoff, MeJA and SA were first dissolved in 10% ethanol and then diluted with sterile water. Sterile water containing anhydrous ethanol was used as control. Leaves were obtained at 0, 6, 12, 24, and 48 h after treatment, with three replicates for each treatment.
Following the method of Aihaiti et al. [28], the roots, stems, leaves, and other tissues of both resistant and susceptible materials inoculated with S. linicola were collected 40 h after inoculation and preserved at an ultra-low temperature for future use.

2.2. Total RNA Extraction and cDNA Synthesis

Total RNA was extracted from the samples following the protocol of the RNAplant Plus Reagent (Tiangen Biotech, Beijing, China). First-strand cDNA synthesis was then conducted using the Maxima H Minus First Strand cDNA Synthesis Kit (Thermo Fisher Scientific, Waltham, MA, USA).

2.3. Cloning and Sequence Analysis of the LuWRKY39 Gene

A pair of primers was designed based on the LuWRKY39 sequence, spanning from the start codon to stop codon, with pGADT7 splice sequences added at both the ends. The cleavage sites used were EcoRI and BamHI, with the primer sequences presented in Table 1. PCR amplification was conducted under the conditions: an initial 2 min denaturation at 94 °C, followed by 35 30 s cycles at 94 °C, 30 s at 60 °C, and 62 s at 72 °C, and a final 5 min extension at 72 °C. Electrophoresis was performed to isolate PCR products on a 1% agarose gel. A Gel Extraction Kit (Takara, Dalian, China) was used to purify the obtained samples according to the manufacturer’s protocol. Purified products were cloned into the pGADT7 vector (Takara, Mountain View, CA, USA) and sequenced by Shangon (Shanghai, China).
ProtParam (http://web.expasy.org/protparam/ (accessed on 3 March 2023)) was utilized to predict the physicochemical properties of the identified proteins, while the NetPhos 3.1 Server (https://services.healthtech.dtu.dk/service.php?NetPhos-3.1 (accessed on 5 March 2023)) was adopted to identify the phosphorylation sites. The TMHMM program (https://services.healthtech.dtu.dk/service.php?TMHMM-2.0 (accessed on 8 March 2023)) was used to analyze the protein transmembrane regions. SignalP 5.0 (https://services.healthtech.dtu.dk/service.php?SignalP-5.0 (accessed on 12 March 2023)) was utilized to predict the signal peptide predictions. SOPMA (https://npsa-prabi.ibcp.fr/cgi-bin/npsa_automat.pl?page=npsa_sopma.html (accessed on 15 March 2023)) was adopted to predict the protein secondary structure. PSORT (https://psort.hgc.jp/ (accessed on 19 March 2023)) was used for subcellular localization analysis. SwissModel (https://swissmodel.expasy.org/ (accessed on 22 March 2023)) was utilized to conduct the tertiary structure modeling. The MSA program (http://www.ebi.ac.uk/clustalw/ (accessed on 26 March 2023)) was utilized for multiple sequence alignments. MEGA 5.0 software was applied to generate an evolutionary tree for homology analysis.

2.4. Expression Analysis of LuWRKY39 Gene

To explore its role in disease resistance, qRT-PCR was employed to analyze the expression of LuWRKY39 at various time points, under different hormone treatments, and in different plant tissues following inoculation with S. linicola in both resistant and susceptible materials.

2.5. Real-Time Quantitative PCR (qRT-PCR) Analysis

The qRT-PCR-specific primers were designed based on the cDNA sequence of the cloned LuWRKY39 gene using Primer 5.0 software (Table 1), with the flax GAPDH gene serving as the internal standard. qRT-PCR was conducted using the SYBR Green qPCR Mix Kit (Biosharp, Hefei, China). The tenfold dilution was performed on the cDNA product, which was used as template. Each reaction encompassed 1.0 μL of the diluted cDNA template, 0.4 μL of reverse primer (10 μM), 0.4 μL of forward primer (10 μM), and 10 μL of ChamQ SYBR qPCR Master Mix (without Rox). PCR amplification was performed using a QuantStudio real-time fluorescent quantitative PCR instrument under 5 min pre-denaturation at 95 °C, followed by 40 10 s cycles at 95 °C and 30 s at 60 °C. The 2−∆∆Ct method was utilized to analyze the relative gene expression levels [29]. Three biological and technical replicates were used for all experiments.

2.6. Virus-Induced Gene Silencing (VIGS)

To silence the LuWRKY39 gene, amplification and cloning of the 300 bp fragment of the gene into the pTRV2 vector was performed with the verification of the recombinant vector via PCR and sequencing. The constructed pTRV2-WRKY39 vector containing pTRV1 and pTRV2 was transformed into Agrobacterium tumefaciens strain GV3101. The recombinant bacteria of GV3101-pTRV1, GV3101-pTRV2, and GV3101-pTRV2-WRKY39 were cultured in 10 mL of YEP liquid medium (including 50 µg/mL Kan and 100 µg/mL Rif) at 28 °C for 24 h at 180 r min−1. Then, 10 mL of the bacterial liquid was transferred to 300 mL of YEP liquid medium (including 50 µg/mL Kan, 100 µg/mL Rif, and 200 µM acetosyringone (AS)) followed by culture at 28 °C for 5–6 days at 200 r min−1. When the OD600 of the bacterial liquid was 1.5~1.8, the cells were centrifuged at 4 °C at 12,000 r/min for 2 min. Then the bacterial cells were resuspended to an OD600 of 1.5~1.8 using an MMA buffer (10 mM MES, 10 mM MgCl2, 100 µM acetosyringone). GV3101-pTRV2-WRKY39 and GV3101-pTRV2 were mixed with GV3101-pTRV1 at the ratio of 1:1, with the 3–5 h incubation in darkness at room temperature. Cell cultures containing the plasmids were injected into flax seedlings via leaf infiltration using a syringe. Leaf samples were inoculated using a 1 mL syringe to ensure that the spore solution entirely filled the injected leaves. A total of 30 seedlings were infected simultaneously, and both the treated and control plants underwent standard field management procedures. Once gene silencing was established, leaves from the experimental and control groups were collected to evaluate gene silencing efficiency using qRT-PCR. Additionally, a spore suspension of S. linicola was prepared and sprayed onto the leaves of VIGS-silenced and control plants to observe overall plant and leaf disease incidence following inoculation with S. linicola. The severity grading criteria were as follows: Grade 0: No disease spot on the entire plant; Grade 1: The disease spot area accounts for less than 5% of the leaf area; Grade 3: The area of disease spot accounts for the total area 6~25%; Grade 5: The disease spot area accounts for 26% to 50% of the total area; Grade 7: The area of disease spot accounts for 51% to 75% of the leaf area; Grade 9: Disease spot area accounts for 76% to 100%. The corresponding disease index was calculated as follows:
DI = [∑s × n/N × S] × 100%
DI: disease index; s: the representative value; n: number of disease-grade plants; N: plant number; S: the representative value for the most severe disease.

2.7. Statistical Analysis

ANOVA (with α-level of 0.05) and Duncan’s multiple range test were used to analyze the data, including at least three biological replicates, to assess the significant differences using SPSS 24.0.

3. Results

3.1. Cloning and Sequence Analysis of LuWRKY39

The cDNA of the flax material ‘y62-9’ was used as the template for amplification, resulting in a 948 bp sequence. NCBI comparison revealed 85.45% similarity between the obtained gene sequence and RcWRKY39 (XM_015726669.3). Domain analysis indicated the presence of a WRKY domain at positions 243−303 (Figure 1a). Accordingly, the obtained gene was designated as LuWRKY39.
ProtParam analysis of the LuWRKY39 gene sequence revealed a theoretical isoelectric point (pI) of 9.58 and a predicted protein molecular weight of 34.97 kD. The gene encodes 315 amino acids, comprising 44 positively charged residues (Lys+Arg) and 27 negatively charged residues (Glu+Asp). The protein had an aliphatic index of 64.98, half-life of 30 h, and an instability coefficient of 52.41, classifying it as unstable. Using NetPhos 3.1 Server, 43 potential phosphorylation sites were identified, including 9 Thr, 4 Tyr, and 30 Ser residues (Figure 1b). The analysis of the protein encoded by LuWRKY39 using ProtScale software revealed that tyrosine (Tyr) at position 140 exhibited the strongest hydrophilicity (−1.916), whereas serine (Ser) at position 52 displayed the strongest hydrophobicity (0.8). ProtParam software predicted the protein to be hydrophilic, with an average hydrophilicity of −0.537 (Figure 1c). The TMHMM analysis of the transmembrane region prediction showed that the LuWRKY39 protein lacked transmembrane helices and transmembrane structure. The SignalP 5.0 analysis further indicated the absence of a signal peptide sequence. Secondary structure prediction revealed that the protein was comprised of four structural components: irregular coils (57.14%), β-folds (6.03%), α-helices (24.13%), and extended chains (12.7%) (Figure 1d; Table 2).
The SWISS-MODEL three-level structural prediction model for the LuWRKY39 protein demonstrated a consistency of 53.42% (Figure 1e). Subcellular localization analysis revealed that the protein was in the cell nucleus. Homologous sequence alignments were performed across 11 species, including flax, revealing high homology of the LuWRKY39 protein with other species. Using the ESPript 3 online tool, 11 conserved sites were identified within the sequence, highlighting multiple conserved regions (Figure 1f). A phylogenetic tree constructed using MEGA software (Figure 1g) showed that the protein encoded by this gene was most closely related to that of the castor.

3.2. Subcellular Localization of the LuWRKY39 Protein

In this experiment, the LuWRKY39 gene was inserted into the XhoI and EcoRI restriction sites of the expression vector CAM-GFP and subsequently inserted downstream of the GFP coding sequence to construct the fusion expression vector CAM-GFP-LuWRKY39. The recombinant vector, along with a control vector containing only GFP, and a nuclear localization marker plasmid were then transformed into tobacco leaf epidermal cells to determine the subcellular localization of the LuWRKY39 protein. As shown in Figure 2, green fluorescence was uniformly distributed throughout the cells in the control group. In contrast, the nuclear localization marker signal was overlapped with the green fluorescence from the LuWRKY39 protein, indicating that the LuWRKY39 protein was localized in the nucleus and may function there. These findings align with predictions from bioinformatics analysis.

3.3. Expression Level Analysis of LuWRKY39 Induced by S. linicola

Following treatment with S. linicola, the relative expression levels of the resistant material y62-9 were higher than those of the control, except at 48 h post inoculation (Figure 3). The highest expression level occurred at 6 h, with an approximately a five-fold upregulation, and the relative expression level was significantly higher (p < 0.05) than that in the control. In the susceptible material y64-5, the relative expression levels exceeded the control at 0, 6, 24, and 48 h after inoculation, with the highest expression observed at 6 h. However, the upregulation remained below 1.5-fold, and there were no significant differences at most time points (p < 0.05). Across the experimental time points, except at 48 h after inoculation, the relative expression of LuWRKY39 in the resistant material y62-9 was significantly higher than that in the susceptible material y64-5, indicating that LuWRKY39 transcriptional expression was induced by S. linicola. These findings suggest that LuWRKY39 is a candidate gene for controlling flax resistance to S. linicola.

3.4. Expression Level Analysis of LuWRKY39 Induced by Exogenous Hormones

Following the treatment of the leaves of the flax disease-resistant material y62-9 with different exogenous hormones, the qRT-PCR analysis (Figure 4) revealed that the expression level of the LuWRKY39 gene did not change within the 24 h salicylic acid induction. The expression level increased sharply to a peak with 34-fold upregulation, followed by a slight decrease at 48 h. Similarly, following methyl jasmonate induction, no significant changes were observed within the first 6 h. At 12 h, the expression level increased rapidly to a peak with 244-fold upregulation, followed by a slight decrease at 24 h, and subsequently declined sharply at 48 h. These findings demonstrated that both salicylic acid and jasmonic acid significantly induced LuWRKY39 transcription, suggesting that the gene may affect flax resistance to pasmo through signaling pathways mediated by these hormones.

3.5. Expression Level Analysis of LuWRKY39 in Different Tissues

To investigate the gene expression in different tissues and flax materials with varying resistance after inoculation with S. linicola, the real-time fluorescence quantitative PCR was used. As shown in Figure 5, in the disease-resistant material y62-9, the highest expression level was identified in the roots and the lowest in the leaves, with the expression levels in roots being 2.27 and 100 times higher than those in stems and leaves, respectively. In the disease-susceptible material y64-5, the highest expression was in the stems and the lowest in the leaves, with the expression levels in stems being 1.29 and 3.31 times higher than those in the roots and leaves, respectively. These findings indicated that LuWRKY39 was expressed in the leaves, stems, and roots of flax, with expression levels varying across tissues.

3.6. LuWRKY39-Silenced Plants Exhibited Greater Sensitivity to S. linicola

Control and 15-day-silenced plants were selected for pathogen infection testing. Figure 6a illustrates that the expression of LuWRKY39 in response to S. linicola infection was significantly lower in LuWRKY39-silenced samples than in control samples. This finding suggested that the pTRV2-LuWRKY39-silencing vector effectively inhibited LuWRKY39 gene expression.
After infection with S. linicola, LuWRKY39-silenced plants presented greater sensitivity to the pathogen than the control samples. The silenced samples showed weakened growth, bent stems, easily detached leaves, and extensive disease spots on most leaves. In contrast, although some empty vector control plants displayed mild symptoms, such as small leaf lesions or slight chlorosis, most maintained good growth after inoculation (Figure 6b,c). Ten days post-infection, disease incidence statistics revealed disease indexes of 11.50 for control plants and 25.87 for LuWRKY39-silenced plants, with the latter being significantly higher (Figure 6d). These results demonstrated that LuWRKY39 contributed to flax resistance against S. linicola and regulated disease resistance by enhancing its expression.

4. Discussion

The transcriptional regulation of defense genes plays an important role in plant defense responses. Therefore, identifying the regulatory components and corresponding defense response pathways of plant defense systems is an important step to understanding the regulation of plant defense systems. WRKY transcription factors are key regulators of disease resistance signaling pathways, making the identification of plant defense components and their response mechanisms critical for understanding stress resistance. Numerous studies have revealed the crucial role of these factors in plant responses to biotic stresses [30,31,32]. For example, the Arabidopsis thaliana WRKY3, 4, 22, and 54 transcription factors are directly involved in fungal resistance [33,34,35]. However, most studies on WRKY transcription factors have focused on tobacco, A. thaliana, rice, and other plants [36,37,38,39], with limited studies on their functions in flax. In this study, LuWRKY39, identified as differentially expressed in the flax genome data, was hypothesized to regulate pasmo resistance. Strong evidence was provided for its role in disease response regulation.
It has been found that WRKY genes are not constitutively expressed in plants. Their expression is induced by various biological or abiotic factors, and the expression is rapid and transient. In order to explore the expression characteristics of LuWRKY39, we detected the expression pattern of the gene under different stress conditions using qRT-PCR. The conclusion was reached in this study, in which the expression of LuWRKY39 increased under induction by S. linicola and positively regulated the disease resistance of flax. However, the opposite conclusion was reached in the study of tomato [23]. Therefore, WRKY TFs may be positively or negatively regulated to participate in the disease resistance-related responses of plants.
Studies have shown that plant protectants such as antitoxins, scopolamine, and hyoscyamine tend to accumulate around invasion sites in plants infected by pathogens [40]. The synthesis of these protectants relies on the SA, JA, and ethylene signaling pathways [41,42,43]. As key endogenous signaling molecules that regulate plant immunity, JA and SA are closely associated with disease resistance [44,45]. MYC2 and PR1 are key genes in the JA and SA signaling pathways, respectively, which can regulate plant defense responses [46,47]. In the previous study, the expression levels of LuPR1 and LuMYC2 genes were analyzed in flax materials with varying resistance using qRT-PCR. The results showed that, after inoculation with S. linicola, the expression of LuPR1 in the resistant material y62-9 followed a fluctuating pattern of increase-decrease cycles, whereas the susceptible material y64-5 exhibited the opposite trend, although both showed an overall upregulation. At 6 h post-inoculation, LuPR1 expression in the resistant material was significantly upregulated, with an increase of 21.50 folds compared with in the susceptible material. After infection with S. linicola, LuMYC2 expression in the resistant material also followed a fluctuating trend and was significantly upregulated at 6 h, with a 52.77-fold increase, exceeding that in the susceptible material. In contrast, LuMYC2 expression in the susceptible material exhibited slight fluctuations after initial upregulation at 6 h, with no significant differences at other time points. Compared to susceptible material y64-5, resistant material y62-9 showed significantly higher upregulation of both genes, indicating stronger disease resistance. The findings suggested that infection by S. linicola upregulated the expression levels of LuPR1 and LuMYC2 in flax resistant and susceptible plants, activating the disease resistance pathway and initiating a defense response. Additionally, exogenous hormone induction experiments demonstrated that both SA and JA significantly induced gene transcription, suggesting that LuWRKY39 may contribute to flax resistance against S. linicola through SA- and JA-mediated signaling pathways. Notably, at 12 h after MeJA induction, the expression level of LuWRKY39 increased rapidly to a peak with 244-fold upregulation, indicating that LuWRKY39 is highly sensitive to JA. This suggests that JA can rapidly activate LuWRKY39 expression in flax, thereby contributing to plant resistance to pasmo.
At present, no mature genetic transformation system has been established in flax. In order to study the role of LuWRKY39 in the disease resistance of flax, VIGS technology was used to preliminarily explore gene function. VIGS technology is widely used in the study of plant gene function, mainly due to its advantages of simple operation and short test cycle. VIGS is a commonly used antisense genetic technology to study functional genes. Many viral vectors such as tobacco fragile virus (TRV), tobacco mosaic virus (TMV), potato virus X (PVX) have been applied in the study of plant gene function. VIGS also has certain limitations, mainly manifested in the following aspects: VIGS generally cannot completely inhibit the function of a gene, and unsilenced genes may produce sufficient functional proteins. The VIGS phenotype is not hereditary; it cannot be applied to the research of functional genes that are expressed during seed germination or in the early stage of seedling growth. The efficiency of gene silencing or the silencing phenotype is not very stable, and the silencing levels may vary among different plants and different experimental batches, generally. VIGS involves transient expression; the best period to observe the phenotype is 2–4 weeks after silencing, and the silencing phenotype will gradually weaken or disappear over time [21,48,49]. The application of VIGS technology is rapidly expanding. It is utilized not only to study diseases caused by specialized parasitic fungi, such as wheat powdery mildew and wheat stripe rust [50,51], but also to investigate soil-borne fungal diseases, such as cotton wilt [52]. In addition, VIGS technology has been applied in research on plant developmental metabolism, vaccine development, and various other fields [53,54]. In this study, VIGS technology was used to silence LuWRKY39 in flax. Following treatment with S. linicola, plants with gene silencing exhibited symptoms such as bending and leaf lesions, whereas the untreated plants remained significantly healthier. Gene expression analysis and disease index statistics confirmed that plants with LuWRKY39 silencing were more susceptible to the disease, indicating that LuWRKY39 plays a crucial role in pasmo resistance.
Transcription factors are important regulators of plant growth and development, and their functional domains can be used to develop polymorphic SSRs. Moreover, SSRs located within the coding regions of transcription factors often exhibit species-specific conservation and can directly affect gene expression. For example, three polymorphic EST-SSR markers were identified in genes of the flavonoid pathway related to fruit coloration of Prunus salicina [55]. Similarly, four pairs of polymorphic SSR primers were developed from MYB and bHLH transcription factors involved in the flavonoid pathway of Fragaria Lilium and Rubus species [56]. In another study, 58 polymorphic EST-SSR markers were developed in Paeonia rockii and applied to the association analysis of yield-related traits [57]. Regarding disease resistance, 14 pairs of polymorphic SSR primers were developed across seven transcription factors families related to response of Lilium fomolongs to Botrytis elliptica infection [58]. These studies demonstrate the strong potential of developing SSR markers from transcription factor-related sequences. We propose that transcription factor-associated molecular markers in flax, such as those derived from LuWRKY39, could serve as powerful tools for germplasm identification, the prediction of population structure and kinship, genetic diversity assessment, and association mapping. Furthermore, they hold promise for facilitating marker-assisted selection in flax breeding programs.

5. Conclusions

In summary, this study characterized a flax disease resistance-related gene LuWRKY39 that was localized at the nucleus in flax. The LuWRKY39 protein acts as a positive regulator of pathogen stress and different hormone treatments, such that the silencing of LuWRKY39 resulted in enhancing the resistance of flax to pasmo, which laid the foundation for flax disease resistance breeding. These findings improve our understanding of the involvement of flax WRKY transcription factors in pathogen resistance and offer a reference basis for further studies on the molecular mechanisms of flax disease resistance.

Author Contributions

Experiment conception and design, S.C.; methodology, S.C., D.L. and J.C.; software, Y.L. and W.Y.; validation, S.C. and L.C.; investigation, W.Y. and C.L.; data curation, X.Y., L.W. and J.M.; writing—original draft preparation, S.C.; writing—review and editing, H.Y. and G.W.; visualization, S.C. and L.C.; supervision, L.Z. and D.B.; project administration, L.Z. and D.B.; funding acquisition, L.Z. All authors have read and agreed to the published version of the manuscript.

Funding

This study was supported by the Heilongjiang Province Agricultural Science and Technology Innovation Span Project (CX23GG04).

Institutional Review Board Statement

Not applicable.

Informed Consent Statement

Not applicable.

Data Availability Statement

The raw data supporting the conclusions of this article will be made available by the authors on request.

Acknowledgments

We would like to thank Le Chen for the technical support during laboratory analysis, and Xue Yang for dependable assistance in sampling and sample preservation, all friends and colleagues who helped us in any way but are not included in the author list. This study was carried out on the Northeast Flax Scientific Observation Experimental Station of Ministry of Agriculture and Flax Branch of the National Bast Fiber Germplasm Improvement Center.

Conflicts of Interest

The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.

References

  1. Chen, S.; Li, Z.G.; Wu, G.W.; Yuan, H.M.; Huang, W.G.; Liu, Y.; Yao, Y.B.; Wu, G.W. Screening pasmo-resistant germplasm resources from flax varieties (lines). Crops 2019, 35, 63–67. [Google Scholar] [CrossRef] [Scilit]
  2. Pan, H.; Wu, G.W.; Song, X.X.; Huang, W.G.; Chen, H.; Zhao, D.S.; Jiang, W.D.; Kang, Q.H.; Liu, Y.; Guan, F.Z. Progress in physiological race of Fusarium oxysporum Schl.f.sp.lini. Plant Fiber Sci. China 2011, 33, 100–104. [Google Scholar]
  3. Yang, X. The study on occurrence characteristics and preventing technique of flax pasmo disease. Plant Fibers Prod. 2004, 26, 170–172. [Google Scholar] [CrossRef]
  4. Zhang, Q.; Jiang, G.; Yang, X.; Qu, Z.H.; Li, Y.; Lu, Y.; Duan, H. Analysis of genetic relationship among 17 flax varieties by using SSR markers. Chin. Agric. Sci. Bull. 2014, 30, 211–216. [Google Scholar] [CrossRef]
  5. Xie, D.W.; Lu, Y.; Zhao, D.B.; Yang, X.; Su, J.G.; Sun, J. Genome-wide analysis of NBS resistance genes in flax. Plant Fiber Sci. China 2015, 37, 113–119, 125. [Google Scholar] [CrossRef]
  6. Jaber, R.; Planchon, A.; Mathieu-Rivet, E.; Kiefer-Meyer, M.; Zahid, A.; Plasson, C. Identification of two compounds able to improve flax resistance towards Fusarium oxysporum infection. J. Plant Sci. 2020, 301, 110690. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  7. Chen, S.; Yuan, H.M.; Yang, X.; Chen, L.; Chen, J.; Liu, Y.; Wu, L.L.; Hu, Y.Y.; Huang, W.G.; Yao, Y.B.; et al. Identification and analysis of flax resistance genes to Septoria linicola (Speg.) Garassini. J. Nat. Fibers 2023, 20, 2163331. [Google Scholar] [CrossRef] [Scilit]
  8. Long, S.H.; Li, X.; Chen, X.B.; Qiao, R.Q.; Deng, X.; Qiu, C.S.; Guo, Y.; Hao, D.; Wang, Y. RACE clone and RNAi transformation of flax 4CL gene. Acta Bot. Boreal.-Occident. Sin. 2014, 34, 2405–2411. [Google Scholar] [CrossRef]
  9. Chen, X.J. Clone of the LuBR11 and LuBES1 Gene’s Core Fragements and Establishment of Regeneration System of Flax (Linum usitatissinmum L.). Master’s Thesis, Xinjiang University, Xinjiang, China, 2013. [Google Scholar]
  10. Wang, Y.Y. Cloning and Functional Analysis of Flax Transcription Factor ABI3 in Flax (Linum usitatissinmum L.). Master’s Dissertation, Huazhong Agricultural University, Wuhan, China, 2016. [Google Scholar]
  11. Jiang, H.X. Clone and Functional Analysis of BRs Related Genes in Flax (Linum usitassimum L.). Master’s Thesis, Xinjiang University, Xinjiang, China, 2017. [Google Scholar]
  12. Rushton, P.J.; Somssich, I.E.; Ringler, P.; Shen, Q.J. WRKY transcription factors. Trends Plant Sci. 2010, 15, 247–258. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  13. Jiang, J.J.; Ma, S.H.; Ye, N.H.; Jiang, M.; Cao, J.S.; Zhang, J.H. WRKY transcription factors in plant responses to stresses. J. Integr. Plant Biol. 2017, 59, 86–101. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  14. Lai, Z.B.; Vinod, K.; Zheng, Z.Y.; Fan, B.F.; Chen, Z.X. Roles of Arabidopsis WRKY3 and WRKY4 transcription factors in plant responses to pathogens. BMC Plant Biol. 2008, 8, 68. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  15. Yin, L.H.; Yang, Y.; Ke, X.W.; Cui, S.P.; Zhang, J.P.; Zuo, Y.H. Cloning of VaWRKY33 gene from adzuki bean and expression analysis in response to adzuki bean rust infection. Mol. Plant Breed. 2020, 18, 7301–7308. [Google Scholar] [CrossRef]
  16. Tao, Z.; Liu, H.B.; Qiu, D.Y.; Zhou, Y.; Wang, S. A pair of allelic WRKY genes play opposite roles in rice-bacteria interactions. Plant Physiol. 2009, 151, 936–948. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  17. Tang, Y.; Kuang, J.-F.; Wang, F.-Y.; Chen, L.; Hong, K.-Q.; Xiao, Y.-Y.; Xie, H.; Lu, W.-J.; Chen, J.-Y. Molecular characterization of PR and WRKY genes during SA- and MeJA-induced resistance against Colletotrichum musae in banana fruit. Postharvest Biol. Technol. 2013, 79, 62–68. [Google Scholar] [CrossRef] [Scilit]
  18. Wang, X.L.; Yan, Y.; Li, Y.Z.; Chu, X.Q.; Wu, C.A.; Guo, X.Q. GhWRKY40, a multiple stress-responsive cotton WRKY gene, plays an important role in the wounding response and enhances susceptibility to Ralstonia solanacearum infection in transgenic Nicotiana benthamiana. PLoS ONE 2014, 9, e93577. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  19. Wang, X.; Li, J.J.; Guo, X.F.; Ma, Y. PlWRKY13: A transcription factor involved in abiotic and biotic stress responses in Paeonia lactiflora. Int. J. Mol. Sci. 2019, 20, 5953. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  20. Wang, X.; Li, J.J.; Guo, J.; Qiao, Q.; Ma, Y. The WRKY transcription factor PlWRKY65 enhances the resistance of Paeonia lactiflora (herbaceous peony) to Alternaria tenuissima. Hortic. Res. 2020, 7, 57. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  21. Burch-Smith, T.M.; Anderson, J.C.; Martin, G.B.; Dinesh-Kumar, S.P. Applications and advantages of virus-induced gene silencing for gene function studies in plants. Plant J. 2004, 39, 734–746. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  22. Holzberg, S.; Brosio, P.; Gross, C.; Pogue, G.P. Barley stripe mosaic virus-induced gene silencing in a monocot plant. Plant J. 2002, 30, 315–327. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  23. Atamian, H.S.; Eulgem, T.; Kaloshian, I. SlWRKY70 is required for Mi-1-mediated resistance to aphids and nematodes in tomato. Planta 2012, 235, 299–309. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  24. Guo, W.L. Response to Chilling Stress in Pepper as Well as Characterization and Functional Analysis of Chilling-Related Genes. Ph.D. Dissertation, Northwest A&F University, Xianyang, China, 2013. [Google Scholar]
  25. Wang, J.E. Expression Analysis and Functional Identification of Carga1 and Capod Genes Induced by Phytophthora Capsici in Pepper. Ph.D. Dissertation, Northwest A&F Univeresity, Xianyang, China, 2013. [Google Scholar]
  26. Zhou, Y. Progresses in study of virus-based vectors of fruit trees. Sci. Agric. Sin. 2014, 47, 1119–1127. [Google Scholar] [CrossRef]
  27. Huang, B.Y.; Ji, W.Q.; Guo, A.G.; Sadequr, R.; Li, Z.Y. Post-transcriptional gene silencing (PTGS) and its application to crop genetic improvement. China Biotechnol. 2005, 25, 1–5. [Google Scholar] [CrossRef]
  28. Aihaiti, A.; Yao, Z.P.; Chen, Q.J.; Huang, Q.X.; Han, Y.H.; Rebiguli, R.; Qu, Y.Y. Cloning and functional analyses of fusarium wilt resistanse gene GbMPK16 in Gossypium barbadense L. Genom. Appl. Biol. 2019, 38, 5082–5090. [Google Scholar]
  29. Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2−ΔΔCT method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  30. Yu, D.Q.; Chen, C.H.; Chen, Z.X. Evidence for an important role of WRKY DNA binding proteins in the regulation of NPR1 gene expression. Plant Cell 2001, 13, 1527–1540. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  31. Shen, Q.H.; Saijo, Y.; Mauch, S.; Biskup, C.; Bieri, S.; Keller, B.; Seki, H.; Ulker, B.; Somssich, I.E.; Schulze-Lefert, P. Nuclear activity of MLA immune receptors links isolate-specific and basal disease-resistance responses. Science 2007, 315, 1098–1103. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  32. Zhou, Q.Q.; Qiu, H.R.; He, X.W.; Wang, X.P.; Liu, X.X.; Li, B.H.; Wu, S.J.; Chen, X.S. MdWRKY40 mediated improvement of the immune resistance of apple and Arabidopsis thaliana to Botryosphaeria dothidea. Sci. Agric. Sin. 2018, 51, 4052–4064. [Google Scholar] [CrossRef]
  33. Ulker, B.; Somssich, I.E. WRKY transcription factors: From DNA binding towards biological function. Curr. Opin. Plant Biol. 2004, 7, 491–498. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  34. Hsu, F.C.; Chou, M.Y.; Chou, S.J.; Li, Y.R.; Shih, M.C. Submergence confers immunity mediated by the WRKY22 transcription factor in Arabidopsis. Plant Cell 2013, 25, 2699–2713. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  35. Li, J.; Zhong, R.S.; Palva, E.T. WRKY70 and its homolog WRKY54 negatively modulate the cell wall-associated defenses to necrotrophic pathogens in Arabidopsis. PLoS ONE 2017, 12, e0183731. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  36. Hara, K.; Yagi, M.; Kusano, T.; Sano, H. Rapid systemic accumulation of transcripts encoding a tobacco WRKY transcription factor on wounding. Mol. Gen. Genet. 2000, 263, 30–37. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  37. Kim, C.Y.; Lee, S.H.; Park, H.C.; Bae, C.G.; Cheong, Y.H.; Choi, Y.J.; Han, C.-D.; Lee, S.Y.; Lim, C.O.; Cho, M.J. Identification of rice blast fungal elicitor-responsive genes by differential display analysis. Mol. Plant–Microbe Interact. 2000, 13, 470–474. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  38. Cormack, R.S.; Eulgem, T.; Rushton, P.J.; Petra Köchner Hahlbrock, K.; Somssich, I.E. Leucine zipper-containing WRKY proteins widen the spectrum of immediate early elicitor-induced WRKY transcription factors in parsley. Biochim. Biophys. Sci. Acta 2002, 1576, 92–100. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  39. Xu, Y.H.; Wang, J.W.; Wang, S.; Wang, J.Y.; Chen, X.Y. Characterization of GaWRKYl, a cotton transcription factorthat regulates the sesquiterpene synthase gene (+)-delta-cadinene synthase-A. Plant Physiol. 2004, 135, 507–515. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  40. Liu, Z.Y.; Su, Y.X.; Zuo, T.; Chang, J.P.; Guo, L.M.; He, W. The differential expression analysis of the SA and JA signal transduction related genes in poplar varieties susceptible and resistant to canker. Chin. Agric. Sci. Bull. 2015, 31, 156–163. [Google Scholar] [CrossRef]
  41. Sun, H.; Wang, L.; Zhang, B.; Ma, J.; Christian, H.; Cao, G.; Sun, G.; Wu, J.; Wu, J. Scopoletin is a phytoalexin against Alternaria alternata in wild tobacco dependent on jasmonate signalling. J. Exp. Bot. 2014, 15, 4305–4315. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  42. Li, J.; Wu, J.S. Scopolin, a glycoside form of the phytoalexin scopoletin, is likely involved in the resistance of Nicotiana attenuata against Alternaria alternata. J. Plant Pathol. 2016, 98, 641–644. [Google Scholar] [CrossRef] [Scilit]
  43. Sun, H.; Song, N.; Ma, L.; Li, J.; Ma, L.; Wu, J. Ethylene signalling is essential for the resistance of Nicotiana attenuata against Alternaria alternata and phytoalexin scopoletin biosynthesis. Plant Pathol. 2017, 66, 277–284. [Google Scholar] [CrossRef] [Scilit]
  44. Jiang, S.S.; Yao, J.; Ma, K.W.; Zhou, H.B.; Song, J.K.; He, S.Y.; Ma, W.B. Bacterial effector activates jasmonate signaling by directly targeting JAZ transcriptional repressors. PLoS Pathog. 2013, 9, e1003715. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  45. Gimenez-Lbanez, S.; Boter, M.; Fernández-Barbero, G.; Chini, A.; Rathjen, J.; Solano, R. The bacterial effector HopX1 targets JAZ transcriptional repressors to activate jasmonate signaling and promote infection in Arabidopsis. PLoS Biol. 2014, 12, e1001792. [Google Scholar] [CrossRef] [Scilit]
  46. Yang, D.C.; Zhang, Y.X.; Zheng, G.S. Gene cloning and expression analysis of pathogenesis-related Protein 1 of Paeonia suffruticosa. Acta Hortic. Sin. 2013, 40, 1583–1590. [Google Scholar] [CrossRef]
  47. Li, X.H.; Yang, R.; Chen, H.M. The Arabidopsis thaliana mediator subunit MED8 regulates plant immunity to Botrytis Cinerea through interacting with the basic helix-loop-helix (bHLH) transcription factor FAMA. PLoS ONE 2018, 13, e193458. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  48. Huang, C.J.; Qian, Y.J.; Li, Z.H.; Zhou, X.P. Virus-induced gene silencing and its application in plant functional genomics. Sci. China (Life Sci.) 2012, 55, 99–108. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  49. Zhang, X.L.; Zhao, J. Progress in study of plant resistance gene function using virus induced gene silence system. Chin. Potato J. 2013, 27, 181–186. [Google Scholar] [CrossRef]
  50. Zou, S.; Wang, H.; Li, Y.; Kong, Z.; Tang, D. The NB-LRR gene Pm60 confers powdery mildew resistance in wheat. New Phytol. 2017, 218, 14964. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  51. Hou, W.Q. Identification and BSMV-VIGS Analysis of Candidate Genes Resistant to Fusarium Head Blight. Ph.D. Dissertation, Shandong Agricultural University, Tai’an, China, 2014. [Google Scholar] [CrossRef]
  52. Jin, Y.; Zhang, T.; Guo, H.S. Application of host induced gene silencing in crop protection against fungal diseases. Chin. J. Biotechnol. 2017, 33, 161–169. [Google Scholar] [CrossRef]
  53. Ma, M. Development of an Effective System of Virus Induced Gene Silencing by Barley Stripe Mosaic Virus (BSMV) in Wheat Spikes. Master’s Dissertation, Northwest A&F University, Xianyang, China, 2010. [Google Scholar]
  54. Tsaballa, A.; Pasentsis, K.; Darzentas, N.; Tsaftaris, A.S. Multiple evidence for the role of an Ovate-like gene in determining fruit shape in pepper. BMC Plant Biol. 2011, 11, 46. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  55. González, M.; Salazar, E.; Castillo, J.; Morales, P.; Mura-Jornet, I.; Maldonado, J.; Silva, H.; Carrasco, B. Genetictructure based on EST–SSR: A putative tool for fruit color selection in Japanese plum (Prunus salicina L.) breeding programs. Mol. Breed. 2016, 36, 1–15. [Google Scholar] [CrossRef] [Scilit]
  56. Vadim, G.L.; Natalya, M.S.; Oleg, P.M.; Tatyana, N.L.; Konstantin, V.K.; Konstantin, A.S. Transferability and polymorphism of SSR markers located in flavonoid pathway genes in Fragaria and Rubus Species. Genes 2019, 11, 11. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  57. Liu, N.; Cheng, F. Association mapping for yield traits in Paeonia rockii based on SSR markers within transcription factors of comparative transcriptome. BMC Plant Biol. 2020, 20, 1–14. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  58. Biswas, M.K.; Nath, U.K.; Howlader, J.; Bagchi, M.; Natarajan, S.; Kayum, M.A.; Kim, H.-T.; Park, H.-T.; Kang, J.G.; Nou, I.-S. Exploration and exploitation of novel SSR markers for candidate transcription factor genes in Lilium Species. Genes 2018, 9, 97. [Google Scholar] [CrossRef] [Scilit] [PubMed]
Figure 1. Bioinformatics analysis of LuWRKY39. (a) Predicted protein structural domain. (b) Predicted phosphorylation sites in sequence. (c) Protein affinity or sparsity. (d) Secondary structure prediction of LuWRKY39 protein. (e) Tertiary structure prediction of LuWRKY39 protein. (f) Multiple sequence comparison of LuWRKY39 protein in flax with homologous proteins from 10 other species. The amino acids conserved in all the sequences are represented in red font and enclosed within a blue box, the regions with high sequence identity are indicated by stars. (g) Phylogenetic tree of flax and other 10 plants based on the amino acid sequences encoded by LuWRKY39 (Lus10021999).
Figure 1. Bioinformatics analysis of LuWRKY39. (a) Predicted protein structural domain. (b) Predicted phosphorylation sites in sequence. (c) Protein affinity or sparsity. (d) Secondary structure prediction of LuWRKY39 protein. (e) Tertiary structure prediction of LuWRKY39 protein. (f) Multiple sequence comparison of LuWRKY39 protein in flax with homologous proteins from 10 other species. The amino acids conserved in all the sequences are represented in red font and enclosed within a blue box, the regions with high sequence identity are indicated by stars. (g) Phylogenetic tree of flax and other 10 plants based on the amino acid sequences encoded by LuWRKY39 (Lus10021999).
Agriculture 15 01561 g001aAgriculture 15 01561 g001b
Figure 2. Subcellular localization of the LuWRKY39 protein in Nicotiana benthamiana. GFP: transient expression of GFP; Nucl-mcherry: mCherry fluorescence of marker protein localized in the cell nucleus; CHI: chloroplast auto-fluorescence; DIC: bright-field image; Merged: merged GFP and chloroplast image.
Figure 2. Subcellular localization of the LuWRKY39 protein in Nicotiana benthamiana. GFP: transient expression of GFP; Nucl-mcherry: mCherry fluorescence of marker protein localized in the cell nucleus; CHI: chloroplast auto-fluorescence; DIC: bright-field image; Merged: merged GFP and chloroplast image.
Agriculture 15 01561 g002
Figure 3. Expression analysis of LuWRKY39 in response to S. linicola infection in different varieties of resistance. Lowercase letters denote significant differences at the 0.05 level.
Figure 3. Expression analysis of LuWRKY39 in response to S. linicola infection in different varieties of resistance. Lowercase letters denote significant differences at the 0.05 level.
Agriculture 15 01561 g003
Figure 4. Expression analysis of LuWRKY39 in flax under SA and MeJA treatments. Lowercase letters denote significant differences at the 0.05 level.
Figure 4. Expression analysis of LuWRKY39 in flax under SA and MeJA treatments. Lowercase letters denote significant differences at the 0.05 level.
Agriculture 15 01561 g004
Figure 5. Analysis of LuWRKY39 expression in different flax tissues. Uppercase and lowercase letters denote significant differences at the 0.01 and 0.05 levels, respectively; the same below.
Figure 5. Analysis of LuWRKY39 expression in different flax tissues. Uppercase and lowercase letters denote significant differences at the 0.01 and 0.05 levels, respectively; the same below.
Agriculture 15 01561 g005
Figure 6. Phenotypic differences in LuWRKY39-silenced plants in response to S. linicola. (a) Expression of LuWRKY39 in response to S. linicola before and after gene silencing. (b) Plant phenotype under different treatments. (c) Leaf phenotype under different treatments. AB respectively represent pTRV2-LuWRKY39 and pTRV2 plants. (d) Disease index of plants treated with different treatments. Lowercase letters denote significant differences at the 0.05 level.
Figure 6. Phenotypic differences in LuWRKY39-silenced plants in response to S. linicola. (a) Expression of LuWRKY39 in response to S. linicola before and after gene silencing. (b) Plant phenotype under different treatments. (c) Leaf phenotype under different treatments. AB respectively represent pTRV2-LuWRKY39 and pTRV2 plants. (d) Disease index of plants treated with different treatments. Lowercase letters denote significant differences at the 0.05 level.
Agriculture 15 01561 g006
Table 1. Primers for the tests and their sequences.
Table 1. Primers for the tests and their sequences.
Primer NameNucleotide Sequence (5′–3′)Purpose
LuGAPDH-FAGGTTCTTCCCGCTCTCAATActin primers
LuGAPDH-RCCTCCTTGATAGCAGCCTTG
LuWRKY39FGCCATGGAGGCCAGTGAATTCATGGAAGGAGTTGAGGAAGCAAGFull-length DNA and cDNA amplification
LuWRKY39RCAGCTCGAGCTCGATGGATCCTTATGTAAGTGCAGACATTGAAGAAG
LuWRKY39qFGGGCTCATCTGTCACCCAATSpecific primer for qRT-PCR
LuWRKY39qRGAATCTGCCACGACCAACTAAG
LuWRKY39(E)FGTGAGTAAGGTTACCGAATTCCAGATTGGTTTGTATGGTATTCATVector construction for VIGS
LuWRKY39(B)RCGTGAGCTCGGTACCGGATCCCTGCTGCACTTGTAATATCC
LuWRKY39(I)FGTGTCAACAAAGATGGACATTGTTColony PCR identification
LuWRKY39(I)RTAAAACTTCAGACACGGATCTACTT
Table 2. The physicochemical properties of LuWRKY39 protein.
Table 2. The physicochemical properties of LuWRKY39 protein.
Gene NameLuWRKY39
Gene IDLus10021999.g (PAC:23160245)
Amino acids315
Protein molecular weight/kDa34.97
Isoelectric point (pI)9.58
Instability Index52.41
Aliphatic Index64.98
GRAVY−0.537
Transmembrane structure-
Signalpeptide-
SubcellularlocalizationNucleus
Secondary structure α-helix (%) 24.13%
β-angle (%)6.03%
Random coil (%) 57.14%
Extended chain (%) 12.70%
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Chen, S.; Yuan, H.; Wu, G.; Yang, X.; Liu, D.; Chen, L.; Chen, J.; Liu, Y.; Yin, W.; Li, C.; et al. Cloning and Functional Validation of the Candidate Gene LuWRKY39 Conferring Resistance to Septoria linicola (Speg.) Garassini from Flax. Agriculture 2025, 15, 1561. https://doi.org/10.3390/agriculture15141561

AMA Style

Chen S, Yuan H, Wu G, Yang X, Liu D, Chen L, Chen J, Liu Y, Yin W, Li C, et al. Cloning and Functional Validation of the Candidate Gene LuWRKY39 Conferring Resistance to Septoria linicola (Speg.) Garassini from Flax. Agriculture. 2025; 15(14):1561. https://doi.org/10.3390/agriculture15141561

Chicago/Turabian Style

Chen, Si, Hongmei Yuan, Guangwen Wu, Xue Yang, Dandan Liu, Le Chen, Jing Chen, Yan Liu, Weiping Yin, Cen Li, and et al. 2025. "Cloning and Functional Validation of the Candidate Gene LuWRKY39 Conferring Resistance to Septoria linicola (Speg.) Garassini from Flax" Agriculture 15, no. 14: 1561. https://doi.org/10.3390/agriculture15141561

APA Style

Chen, S., Yuan, H., Wu, G., Yang, X., Liu, D., Chen, L., Chen, J., Liu, Y., Yin, W., Li, C., Wu, L., Ma, J., Bian, D., & Zhang, L. (2025). Cloning and Functional Validation of the Candidate Gene LuWRKY39 Conferring Resistance to Septoria linicola (Speg.) Garassini from Flax. Agriculture, 15(14), 1561. https://doi.org/10.3390/agriculture15141561

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop