Skip to Content
AgricultureAgriculture
  • Editor’s Choice
  • Article
  • Open Access

17 July 2025

19 Pages

Harnessing Microbial Agents to Improve Soil Health and Rice Yield Under Straw Return in Rice–Wheat Agroecosystems

,
,
,
,
,
,
,
,
Crop Ecophysiology and Cultivation Key Laboratory of Sichuan Province, Sichuan Agricultural University, Chengdu 611130, China
*
Authors to whom correspondence should be addressed.
This article belongs to the Section Agricultural Soils

Abstract

We clarified the effect of wheat straw return combined with microbial agents on rice yield and soil properties. A field experiment was conducted using hybrid indica rice ‘Chuankangyou 2115’ and five treatments: no wheat straw return (T1), wheat straw return alone (T2), T2+ microbial agent application (Bacillus subtilis/Trichoderma harzianum = 1:1) (T3); T2+ microbial agent application (Bacillus subtilis/Trichoderma harzianum = 3:1) (T4); T2+ microbial agent application (Bacillus subtilis/Trichoderma harzianum = 1:3) (T5). T2–T5 significantly increased dry matter accumulation, soil total N, ammonium N, nitrate N, and organic matter, improving yield by 3.81–26.63%. T3 exhibited the highest yield increases in two consecutive years. At the jointing and heading stages, Penicillium and Saitozyma dominated under T3 and positively correlated with dry matter, yield, and nitrogen levels. Straw return combined with Bacillus subtilis and Trichoderma harzianum (20 g m−2 each) enhanced soil nitrogen availability and dry matter accumulation and translocation. Our findings guide efficient straw utilization, soil microbial regulation, and sustainable high-yield rice production.

1. Introduction

The rice–wheat rotation system is one of the largest agricultural production systems in the world and is primarily distributed in the Yangtze River Basin in China, where it accounts for 72% of the total food production [1]. However, this high-yield farming system generates a large amount of straw residue, producing approximately 4500 kg hm−2 of wheat straw and approximately 9000 kg hm−2 of rice straw annually [2]. The main chemical components of wheat straw are cellulose, hemicellulose, lignin, and a small amount of inorganic substances. Wheat straw return can reasonably utilize resources, improve soil structure, and increase soil organic matter, providing nutrients such as nitrogen (N), phosphorus (P), potassium (K), and trace elements to the soil, significantly enhancing land productivity and improving soil structure [3]. However, direct straw return is associated with issues such as a long decomposition period and slow nutrient release [4]; after 124 days of incubation, wheat straw achieved a carbon (C) release rate of only 66.58%, a nitrogen (N) release rate of 49.26%, and a phosphorus (P) release rate of 59.93%. Additionally, incomplete straw decomposition can lead to the proliferation of pathogens and pests, increasing the risk of soil-borne diseases, and consequently reducing crop yields [5]. Therefore, reducing the adverse effects of straw decomposition, while ensuring straw return, remains a focal point in current agricultural production.
Previous studies have shown that soil microorganisms play a crucial role in the decomposition of straw. Soil microorganisms break down complex organic substances in straw, such as cellulose, hemicellulose and lignin, into simpler compounds by secreting enzymes and other bioactive substances. During the process of straw decomposition, bacteria have an advantage in breaking down simple organic compounds, while fungi play a significant role in decomposing more complex lignin and cellulose [6]. This process not only accelerates the release of nutrients but also increases the content of soil organic matter, thereby significantly enhancing soil fertility. Microbial agents, including enzymes, microbial cells, and their metabolic products, have been widely used in agricultural production to support the modern agricultural push for “green” and “ecological” practices. Enzymes such as ligninolytic enzymes (e.g., lignin peroxidase, manganese peroxidase, and laccase) play a crucial role in degrading complex organic compounds in agricultural residues, making nutrients more available to plants and improving soil structure [7]. Microbial cells, particularly plant growth-promoting rhizobacteria (PGPR) and mycorrhizal fungi, enhance soil fertility and plant health by improving nutrient uptake, producing plant growth hormones, and suppressing soil-borne pathogens [8]. Additionally, metabolic products from microorganisms, such as bioactive compounds and organic acids, can further improve soil health and promote beneficial microbial interactions [9]. Various microbial agents, including bacteria and fungi, have been used to improve agricultural practices. Bacillus subtilis and Trichoderma harzianum are commonly used in agricultural applications. Bacillus subtilis is a common rhizosphere bacterium in soil that plays a key role in providing plants with resistance to biotic and abiotic stresses through mechanisms such as induction of systemic resistance (ISR), biofilm formation, and lipopeptide production. Moreover, Bacillus spp. can purify metal-contaminated soil [10], and Bacillus subtilis inoculation significantly reduces the bioavailability of soil Pb through bioadsorption, bioaccumulation, and conversion into more stable forms [11]. Bacillus subtilis also promotes nutrient cycling by increasing nitrogen fixation, phosphorus solubilization, and potassium dissolution, thereby improving fertilizer utilization efficiency [12]. de Lima et al. [13] demonstrated that under water-limited conditions, inoculation of Bacillus subtilis in maize and soybean increased leaf water content and reduced leaf antioxidant activity to cope with water stress. Inoculation with Trichoderma harzianum significantly increases seed germination and seedling growth rates in wheat, carrot, and potato, and enhances plant dry weight [14]; however, excessive concentrations can lead to inhibitory effects [15]. Oliveira et al. [16] found that Trichoderma harzianum increased root length, surface area, and total root dry weight by 17.0%, and improved P content (34.0%) and total dry matter (22.0%) in plants fertilized with soluble phosphate. Al-Zuhairi et al. [17] showed that a well-developed root system can enhance nutrient absorption, thereby regulating plant growth and development. Recent studies have suggested that Trichoderma harzianum enhances plant resistance to abiotic stress via plant interactions [18]. Cocoa seedlings treated with Trichoderma harzianum show rapid growth and strong drought tolerance under unfavorable conditions. Additionally, Trichoderma harzianum is a beneficial fungus that regulates plant growth and development by combating soil-borne pathogens that infect plant roots [19]. Previous studies have extensively reported the functional mechanisms of single inoculant treatments with Bacillus subtilis and Trichoderma harzianum. However, there is limited research on the combination of these two microbial agents for wheat straw decomposition, especially concerning their effects on the paddy soil environment. We hypothesize that the combined application of Bacillus subtilis and Trichoderma harzianum will synergistically promote straw decomposition, improve soil nitrogen availability, and enhance rice yield under straw-return conditions.
Therefore, this study aimed to investigate the effects of the combined application of Bacillus subtilis and Trichoderma harzianum on the decomposition of wheat straw in paddy soil (the texture of paddy soil is mostly loam, containing clay, silt, and sand particles. This type of soil combines the advantages of both clay and sandy soils, exhibiting strong cohesiveness and water retention capacity [20]) and subsequent rice yield. We also elucidate the intrinsic synergistic interactions between microbes and the paddy soil environment. These findings may guide efficient straw utilization, environmental pollution reduction, and rice yield enhancement in rice–wheat rotation systems.

2. Materials and Methods

2.1. Experimental Site and Materials

This study was conducted in 2022 and 2023 at the Wenjiang Experimental Station of Sichuan Agricultural University (Longitude: 103.873794; Latitude: 30.716057). The rice variety tested was Chuankangyou 2115, a three-line indica hybrid rice developed by Sichuan Agricultural University, the Crop Research Institute of Sichuan Academy of Agricultural Sciences, and Sichuan Lüdan Zhicheng Seed Industry Co., Ltd. (Chengdu, China), with a total growth duration of 151.8 days. The microbial agents Bacillus subtilis and Trichoderma harzianum were provided by Sichuan Green Microbial Technology Co., Ltd. (Chengdu, China), at a concentration of 21010 CFU g−1. After the preceding wheat crop was harvested, the wheat straw was chopped into pieces of 5–10 cm and returned to the field at a rate of 4710 kg·hm−2 (with a moisture content of 10%). The plowed layer of the experimental field consisted of sandy loam soil, classified according to the World Reference Base for Soil Resources.
The baseline soil fertility in 2022 was as follows: total N 1.96 g kg−1, organic matter 18.05 g kg−1, alkali-hydrolyzed N 106.23 mg kg−1, available P 25.11 mg kg−1, and available K 85.23 mg kg−1. In 2023, the baseline fertility was as follows: total N 2.26 g kg−1, organic matter 20.45 g kg−1, alkali-hydrolyzed N 115.82 mg kg−1, available P 28.19 mg kg−1, and available K 87.88 mg kg−1.

2.2. Model of the Experiment

In both years, a single-factor completely randomized design was adopted. The microbial agent ratios and application rates were determined with reference to the method described by Lu et al. [21]. The treatments were as follows (Table 1): ① No straw return (T1); ② Straw return (T2); ③ Straw return + (Bacillus subtilis: Trichoderma harzianum = 1:1) (T3); ④ Straw return + (Bacillus subtilis: Trichoderma harzianum = 3:1) (T4); ⑤ Straw return + (Bacillus subtilis: Trichoderma harzianum = 1:3) (T5). A compound fertilizer (N-P-K, 20-8-12) was applied to supply a total of 150 kg hm−2 of nitrogen, distributed at a ratio of 3:3:4 across the basal, tillering, and panicle stages, respectively. Each treatment was replicated three times, and the area of each plot was 4 × 5 m = 20 m2. In both years, rice seedlings were sown on 15 April, wheat straw was incorporated into the soil on 15 May, the seed transplantation sites were chosen randomly within each experimental plot to ensure uniformity, manual transplanting was performed on 15 May, and harvesting was performed on 10 September. Plant spacing was 33.3 cm × 16.7 cm, with a single seedling transplanted per hill.
Table 1. Experimental design variants and descriptions.
Microbial agents were applied two times, i.e., 1 day and 30 days after transplantation (16 May and 16 June), using a dilution of 1 g of agents per 10 cm3 of distilled water, and sprayed evenly. Each application used 40 g m−2 of the agents. Dikes (40 cm wide) were constructed between the plots and covered with plastic film to enable precise water and fertilizer management. In addition, we applied bisultap and pretilachlor at the recommended dose 7 days before or after the microbial agent treatment to manage the diseases, pests and weeds of rice while avoiding direct interaction or antagonism with Bacillus subtilis and Trichoderma harzianum.

2.3. Parameters and Measurement Techniques

2.3.1. Soil Nutrients

Soil samples (0–20 cm depth) were collected at the rice tillering, jointing, heading, and maturity stages using a five-point sampling method. Specifically, five sampling points were randomly selected within each experimental plot to ensure representativeness. After air drying under natural conditions, the samples were ground and sieved through a 120-mesh screen. Soil total nitrogen (TN) was determined using the Kjeldahl method. Organic matter (OM), nitrate nitrogen (NN) and ammonium nitrogen (AN) were determined according to Bao [22]. Briefly, organic matter was measured using potassium dichromate oxidation—soil samples were treated with a mixture of potassium dichromate and sulfuric acid, followed by heating and titration with ferrous ammonium sulfate to determine the organic carbon content, which was then converted to organic matter content; nitrate N was measured using UV spectrophotometry—soil extracts were prepared with 2 M KCl, and nitrate concentration was determined at a wavelength of 210 nm; ammonium N was measured using the indophenol blue colorimetric method—soil extracts were prepared with 2 M KCl, and the ammonium concentration was determined by reacting with salicylate and hypochlorite, followed by colorimetric analysis at 625 nm.

2.3.2. Soil Fungal Community Structure

At the rice jointing and heading stages, 5.0 g of fresh soil surrounding the rice roots was collected and placed in sterile EP tubes. Samples were immediately frozen in liquid nitrogen and stored at −80 °C. Soil DNA was extracted using a Soil DNA Kit (Omega Bio-tek, Inc., Norcross, GA, USA). Fungal ITS_V1 regions were amplified and sequenced by Shanghai Personal Biotechnology Co., Ltd. (Shanghai, China) using the following primers: forward primer F: GGAAGTAAAAGTCGTAACAAG and reverse primer R: GCTGCGTTCTTCATCGATG. The resulting fungal sequences were aligned to the UNITE database for taxonomic identification.

2.3.3. Dry Matter Accumulation and Yield Determination

At rice jointing, heading, and maturity stages, five rice plants per plot were sampled based on the average number of tillers. The subsequent processing of the samples was carried out in accordance with the method of Wang et al. [23]. Plants were separated into culms, sheaths, leaves, and spikes. The samples were first heated at 105 °C for 30 min to inactivate the enzymes, and then dried at 80 °C to a constant weight. At harvest, the border rows of each plot were excluded, and grain yield was measured based on the number of harvested plants and adjusted to a standard moisture content of 13.5%.

2.4. Calculation of Physiological Indices

Leaf Matter Transport Rate (MTL, %):
MTL = Dry   weight   ( D W )   of   leaves   at   headin DW   of   leaves   at   maturity DW   of   leaves   at   heading × 100 %  
Matter Contribution Rate of Leaf (MCL, %):
MCL = DW   of   leaves   at   heading DW   of   leaves   at   maturity DW   of   grains × 100 %
Matter Transport Rate of Stem Sheath (MTSS, %):
MTSS = DW   of   leaves   at   heading DW   of   leaves   at   maturity DW   of   stem   sheath   at   heading × 100 %  
Matter Contribution Rate of Stem Sheath (MCSS, %):
MCSS = DW   of   stem   sheath   at   heading DW   of   stem   sheath   at   maturity DW   of   grains × 100 %  
Dry Matter Accumulation at Each Growth Stage (ADM, kg hm−2):
ADM = W 2 W 1
Growth Rate of Population at Each Growth Stage (GRP, g m−2d−1):
GRP = W 2 W 1 t 2 t 1
where W1 and W2 represent the dry matter accumulation at two successive measurements and t1 and t2 are the time intervals between the two measurements.

2.5. Statistical Analysis of Results

The data were organized using Microsoft Excel 2019, and graphs were prepared using Origin 2023. Statistical analyses were performed using SPSS version 24.0. Differences between treatment means were evaluated using the Least Significant Difference (LSD) test at a significance level of α = 0.05.

3. Result

3.1. Rice Yield and Dry Matter Accumulation

All treatments affected rice yield and dry matter accumulation during critical growth stages (LSD test, α = 0.05), with consistent trends across both experimental years (Treatment × Year interaction p > 0.05) (Table 2). Compared to T1, grain yields increased by the following amounts: T2: 3.81% and 9.14%; T3: 17.15% and 21.02%; T4: 10.63% and 12.19%; T5: 10.38% and 10.86%, with the T3 treatment consistently showing significantly higher yields than the other treatments. The F values from the analysis of variance further underscore the significance of these differences. For instance, the F values for grain yield in 2022 and 2023 were 18.16 and 60.88, respectively, indicating highly significant differences among the treatments. At the heading stage, the T3 treatment showed the highest stem sheath and leaf dry weights (stem sheath: 1.2–17.1% higher than T1/T2/T4/T5 (minimum: 2023 T3 vs. T4; maximum: 2022 T3 vs. T1); leaf: 9.2–47.8% higher than T1/T2/T4/T5 (minimum: 2023 T3 vs. T4; maximum: 2023 T3 vs. T1)). The leaf and spike dry weights under T3 were significantly higher than those under other treatments at the maturity stage (leaf dry weight: 8.61–35.89% higher than T1/T2/T4/T5 (minimum: 2023 T3 vs. T4 [+8.61%]; maximum: 2023 T3 vs. T1 [+35.89%]); spike dry weight: 2.80–22.65% higher (minimum: 2023 T3 vs. T4 [+2.80%]; maximum: 2022 T3 vs. T1 [+22.65%])). T3 exhibited strong advantages in stem sheath and leaf dry matter accumulation at the heading stage, and in spike dry weight at maturity, with particularly more significant increases compared to the other treatments in 2022.
Table 2. Effects of straw return and combined microbial agents application on selected indices of rice yield.

3.2. Dry Matter Transport and Crop Growth During Grain Filling

Different treatments influenced the material transport characteristics and population growth rate of rice, showing consistent trends throughout the two-year experiment (Table 3). Compared with T1, the T2–T5 treatments significantly increased the material transport rate of leaves (MTL) by 7.74–30.78%; for material transport rate of stems and sheaths (MTSS), compared with T1, microbial agent treatment (T3–T5) significantly increased MTSS by 4.51–23.86% (p < 0.05). However, T2 showed mixed effects: a non-significant increase in 2022 but a slight decrease in 2023. This highlights the critical role of microbial agents in consistently enhancing stem sheath transport efficiency. T3 demonstrated a marked advantage in all transport-related parameters. Specifically, MTL and MCL (material contribution rate of leaves) under T3 increased by 17.54–30.78% and 30.60–57.75%, respectively, relative to T1, while MTSS rose by 14.88–23.86%. Compared with the uninoculated treatment (T1–T2), the combined application of microbial agents (T3–T5) increased dry matter accumulation (ADM) to varying degrees, with T3 performing the best over two years. Although there were annual variations (for example, T2 was greater than T5 in 2022), the enhancing effect of microbial agents was relatively strong in both years. The population growth rate (GRP) at various growth stages exhibited a trend similar to that of ADM, and T3 showed the highest performance in both years, increasing by 34.04% and 23.17%, respectively, compared to T1. As shown in Table 3, the material contribution rate of stems and sheaths (MCSS) in 2022 was significantly higher under T3 and T5 treatments, with increases of 6.59–6.96% over T1. In 2023, peak MCSS values were observed under T3 and T4, increasing by 15.64–15.82% relative to T1. Notably, the T3 treatment stood out in terms of synergistically improving both material transport efficiency and population growth. In 2023, the MTL and GRP under T3 were significantly higher, increasing by 17.53–30.78% and 23.17–34.04%, respectively, compared to those under the other treatments. These findings suggest that the T3 treatment significantly enhanced the translocation of dry matter to the spikes by improving MTSS and MTL, ultimately contributing to the formation of a high-yield population structure.
Table 3. Effects of straw return and combined application of microbial agents on selected indices of material transport and rice population growth during the grain filling stage.
In addition, as shown in Table 3, during the two years, the F values of indicators such as MTL, MTSS, ADM and GRP all reached significant (p < 0.05) or extremely significant (p < 0.01) levels, indicating that the differences among treatments were statistically significant. It further supports the positive effect of microbial agents combined with straw returning to the field on improving the efficiency of material transport and the growth rate of the population.

3.3. Chemical Characteristics of Soil

During the critical rice growth stages, different treatments significantly influenced the soil total N, ammonium N, nitrate N, and organic matter content (p < 0.05). T3 and T5 exhibited the strongest effects, though their impact was highlighted by different indicators (Figure 1). T3 treatment consistently maintained high levels of total soil N and ammonium N (Figure 1A,B). At both the tillering and jointing stages, T3 significantly increased total soil nitrogen content compared to T1 and T2, demonstrating its stability in promoting early-stage nitrogen accumulation. Nitrate N content exhibited a dynamic pattern of ‘increasing at the tillering stage but decreasing at the jointing stage’ during the growth period (Figure 1C). Although T3 consistently maintained the highest nitrate levels in 2022, T5 showed a slight advantage in 2023.
Figure 1. Effects of wheat straw return and combined microbial agent application on selected chemical parameters of soil. (A): Soil Total N; (B): nitrate N; (C): ammonium N; (D): organic matter. Note: The meanings of the letters marked in this figure are the same as those in Table 1. TS: Tillering stage; JS: Jointing stage; HS: Heading stage; MS: Maturity stage.
Regarding soil organic matter content, the T5 treatment was superior to other treatments, and the soil organic matter content at the jointing stage was significantly higher than that of T1–T4 (Figure 1D). Except for the jointing stage in 2023, T5 maintained a high level of soil organic matter during other key growth periods, demonstrating a sustained ability to accumulate organic matter.

3.4. Fungal Microbial Composition

3.4.1. Rarefaction Curves

After the application of microbial agents, the analysis of soil fungal rarefaction curves demonstrated that the curves of all treatments gradually plateaued with increasing sequencing depth, indicating that the sequencing effort sufficiently captured the majority of species present in the samples, confirming that the sequencing quantity met the requirements of analysis (Figure 2).
Figure 2. Dilution curves of soil fungi at harvest time with microbial inoculant treatment. Note: OTUs: Operational Taxonomic Units.

3.4.2. Soil Microbial Diversity Analysis

All treatments significantly influenced the diversity of the soil fungal communities. Over the two-year experiment, the Chao1 index and Shannon index exhibited consistent temporal patterns (Table 4). All the samples achieved sequencing coverage indices exceeding 90%, validating the reliability of the detection results. Significant F-values (p < 0.01) for Chao1 and Shannon indices across treatments confirm that microbial inoculants substantially altered fungal community diversity. Compared to other treatments, the T3 treatment significantly enhanced fungal diversity during the critical growth stages. In 2022, at the jointing stage, T3 recorded the highest Chao1 and Shannon indices, which were 25.03% and 2.95% higher than those of T1, respectively. By the heading stage, the Chao1 index advantage of T3 increased to 46.15% over T1. During the 2023 heading period, the Chao1 and Shannon indices of the T3 treatment were the highest, with Chao1 being 49.32% higher than that of the worst-performing T5 treatment. The Shannon index was 15.76% higher than that of the worst-performing T2 treatment. Notably, although T5 achieved the annual peak Shannon index at the jointing stage, its Chao1 index plummeted by 42.24% at the heading stage. Across the two years, T3 consistently exhibited significantly higher Chao1 indices at the heading stage than the other treatments (p < 0.01). Furthermore, from the jointing to heading stages in 2022, T3 demonstrated a 21.70% increase in the Chao1 index, which significantly exceeded those of T4 and T5. The T2 treatment reached the peak Chao1 index at the jointing stage in 2023 but declined by 29.49% at the heading stage, indicating the limited efficacy of single straw return. In contrast, the T3 treatment likely promoted soil nutrient cycling efficiency by maintaining higher Shannon and Chao1 indices, thereby contributing to enhanced rice yields.
Table 4. Soil fungal community diversity indices with microbial inoculant treatment.

3.4.3. Soil Fungal Community Composition

Over the two-year experiment, the combined relative abundances of Ascomycota and Basidiomycota across all treatments exceeded 75% from the jointing to heading stages (Figure 3). In 2022, the fungal communities across treatments exhibited similar phylum-level relative abundance patterns at the jointing stage. However, at the heading stage, the relative abundance of Basidiomycota in T3 and T5 increased further and was significantly higher than that in T1, T2, and T4. Additionally, a decline in the relative abundance of Mortierellomycota was observed from the jointing to heading stages across all treatments. The treatment effects observed in the 2023 experiment mirrored those observed in the 2022 experiment. However, notable shifts included the complete disappearance of Glomeromycota at heading stage in 2023 across all treatments, contrasting with its presence in 2022; the T5 treatment exhibited a notably higher relative abundance of Rozellomycota at the jointing stage than the other treatments.
Figure 3. Changes in fungal species composition at the phylum level in soil. Note: (A): 2022 Jointing; (B): 2022 Heading; (C): 2023 Jointing; (D): 2023 Heading.
Different treatments significantly influenced the fungal community structure, with the relative abundances of key functional taxa, such as Penicillium, Saitozyma, and Marquandomyces exhibiting treatment-specific differences (Figure 4). The T3 treatment consistently exhibited significant enrichment of Penicillium at the jointing stage across both years, with a markedly higher relative abundance than that in the other treatments. Furthermore, the relative abundance of Saitozyma in T3 increased from the jointing to the heading stages during both years and remained significantly higher compared with the other treatments. During the jointing stage in 2023, Penicillium, Marquandomyces, and Westerdyleiia exhibited relatively higher abundances under the T3 treatment, significantly surpassing those of the other treatments, whereas the T1 and T2 treatments displayed lower relative abundances. Compared to T1, the T2 treatment exhibited a significantly higher relative abundance of the fungal genus Coniochaeta. In summary, the T3 treatment consistently maintained a higher relative abundance of Penicillium during the jointing stage and Saitozyma during the heading stage across both years. This suggests that T3 enhances straw decomposition efficiency and nutrient turnover rates by continuously regulating the synergistic proliferation of Penicillium and Saitozyma.
Figure 4. Relative abundance of fungi at the genus level in soil. Note: The meanings of notes (AD) in the figures are the same as those in Figure 3. Color scale indicates relative abundance (%) ranging from 0 to maximum observed value per panel.

3.5. Correlations Between Soil Fungi and Rice/Soil Parameters

The two-year experimental results demonstrated significant correlations between soil fungal communities and rice dry matter accumulation, translocation, and soil nutrient content at different growth stages, exhibiting stage-specific dynamics and genus-specific variations (Figure 5). Overall, Penicillium and Saitozyma exhibited notable positive synergistic effects during the jointing and heading stages, respectively, whereas genera such as Extremopsis and Microscypha were negatively correlated with the measured parameters. During the jointing stages (Figure 5A,C), Penicillium showed highly significant positive correlations with leaf dry weight and soil total nitrogen content. Penicillium showed particularly strong associations with MTL, MCL, MTSS, ADM, GRP, total soil N, and ammonium N. These findings indicate a stable and positive regulatory role in yield formation during the early growth stages. Additionally, the genera Fusarium and Saitozyma exhibited positive correlations with most parameters, except MCSS and soil organic matter content, during the jointing stages of both years. Although the correlation strength for Saitozyma was slightly weaker, the trends remained consistent. In contrast, Extremopsis and Microscypha showed predominantly negative correlations with rice and soil indicators, suggesting their potential inhibitory effects.
Figure 5. Correlation between soil fungi at genus level and rice indexes and soil indexes. Note: The meanings of notes (AD) in the figures are the same as those in Figure 3. *, ** indicate significance at the 0.05 and 0.01 levels, respectively. StDW: Stem Dry Weight; LDW: Leaf Dry Weight; SpDW: Spike Dry Weight.
During the heading stages (Figure 5B,D), the fungal community structure underwent significant shifts. In 2022, Trichoderma and Talaromyces demonstrated significant positive correlations with rice yield and yield-related parameters, whereas Nigrospora and Microscypha showed predominantly negative correlations. Correlations involving the genus Saitozyma were strengthened during the heading stage, showing highly significant positive associations with yield and GRP. This reflects sustained synergistic effects during the later growth phases. During the 2023 heading stage, Penicillium and Marquandomyces maintained a positive correlation, though weaker than that observed at the jointing stage. Saitozyma showed consistent positive correlations with rice and soil parameters in both years that intensified during the heading stage. Saitozyma exhibited significant positive correlations with rice yield, GRP, and total soil N content. These findings indicate that the abundance of the genera Penicillium at the jointing stage and Saitozyma at the heading stage is strongly correlated with both rice yield and soil physicochemical properties. These findings suggest that beneficial soil fungi during different rice growth stages can synergistically enhance crop yield and soil nutrient availability through coordinated interactions.

4. Discussion

4.1. Effects of Rice–Wheat Rotation, Wheat Straw Return, and Combined Application of Microbial Agents on Rice Growth and Soil Environment

Returning straw to the field is a pivotal strategy for enhancing farmland productivity and has positive effects on crop yield and nutrient utilization rates [24,25]. In this study, we showed that returning wheat straw to the field (T2) significantly elevated rice yield by 3.80–10.06% compared with the treatment without straw return (T1), which is consistent with the trends observed in previous studies. Wang et al. [26] demonstrated that, compared with the control, after straw return to the field rice yield increased by 3.50–7.65%, effective spikes by 7.77%, and thousand grain weight by 2.56%. Notably, straw carbonization increased the yield further by 5.64% [27], suggesting that straw treatment is critical in regulating fertilizer efficacy. The efficiency of straw decomposition directly affects the agricultural benefits. Inadequate decomposition rates may lead to a decline in crop yield. Recently, microbial agents have emerged as key regulatory tools [28,29]. In this study, wheat straw return to the field for the combined application of Bacillus subtilis and Trichoderma harzianum at a 1:1 ratio (T3) led to an increase in rice yield; this synergistic effect might stem from multiple functions of the microbial agents. Rais et al. [30] demonstrated that inoculating the soil with Bacillus significantly minimized the secondary damage caused by rice blast. Han et al. [31] found that the inoculation of soil with Bacillus subtilis under non-saline and saline conditions promoted plant growth by directly or indirectly regulating chlorophyll content, leaf osmotic potential, cell membrane integrity, and ion accumulation. Furthermore, Bacillus subtilis volatile compounds have a lasting beneficial effect on Arabidopsis growth, improving the seed-setting rate. Chang et al. [32] demonstrated that the use of microbial preparations containing Bacillus subtilis and Bacillus gelatinis significantly increases plant height, tillering number, and secondary root number of wheat, promotes growth, and increases the number of spikes of wheat to a maximum of 10.2%, with an increase in yield of 7.74–24.23%. Lu et al. [33] demonstrated that bio-organic bacterial fertilizers enhance the lodging ability of rice. Reducing the amount of nitrogen fertilizer applied in paddy fields can increase the 1000-grain weight of rice and increase the yield by 2.03–9.88%. This further increase in yield may be attributed to microbial agents promoting straw decomposition, thereby accelerating the release of nutrients from the straw. Li et al. [34] demonstrated that the introduction of straw powder into a Petri dish culture of Trichoderma enhanced its ability to degrade wheat over time; compared to the control group, after four cultivation cycles at 28 °C, the degradation capacity peaked, with a straw powder weight loss rate of 19.75%. We found that the combined application of microbial agents promoted nutrient release by accelerating the decomposition of wheat straw, which was reflected in the changes in dry matter accumulation. Compared with the control treatment T1, the dry matter weights of rice leaves in the T2 treatment increased by 11.09–22.71%, throughout the growth period, and the accumulation of dry matter in the spikes increased by 1.59–11.38% at the maturity stage. On the basis of straw return, the additional application of microbial inoculants further enhanced the increase in dry matter accumulation, which may be partly attributed to improved nutrient availability. Among our treatments, T3 exhibited the most significant increase in ammonium nitrogen during the jointing and maturity stages, indicating its potential to enhance nitrogen supply and maintain its availability in the later stages of crop growth. The synergistic increase of total nitrogen and ammonium nitrogen under T3 treatment provided a foundation for efficient nitrogen uptake and dry matter accumulation. In summary, the T3 treatment primarily improved the supply efficiency of various nitrogen forms, particularly promoting the early accumulation of total nitrogen and ammonium nitrogen, ultimately leading to further increases in dry matter accumulation. Zhao et al. [35] and Li et al. [36] reported that straw return increased rice dry matter accumulation by 8.78–13.66%. The present study further demonstrates that co-application with microbial inoculants can amplify this effect.
Fungal communities play a key role in soil ecosystems. They not only participate in the decomposition of organic matter and nutrient cycling, but also affect the health of the soil and the growth of crops [37,38]. The change in environmental factors can significantly change the structure of soil fungal communities [39,40]. In the present study, after returning wheat straw to the field and combined application of microbial agents, the structure of the fungal community in the soil changed. The T3 treatment showed the highest values for both the Shannon and Chao1 indices. This indicates that the richness and diversity of the soil fungal communities under this treatment were the most significant. Soil fungi participate in soil nutrient cycling by decomposing organic matter and affecting soil nutrient states [41]. Luo et al. [42] showed that the fungal genera Nigrospora and Cladosporium are significantly positively correlated with available soil phosphorus and potassium. Wang et al. [43] found that the application of microbial agents significantly increased the contents of total nitrogen, alkali-hydrolysable N, available P, and available K in the rhizosphere soil of continuously cropped flue-cured tobacco. Notably, certain fungi, such as those of the genus Articulospora, were positively correlated with the total N content and the increase in available P content. In this study, we found that T3 treatment exhibited higher soil nutrient content than the other treatments. This may be related to the optimization of the soil fungal community structure under this treatment. For instance, the fungal genera Penicillium and Saitozyma were positively correlated with rice indicators and soil nutrient content. This indicates that these fungi may play important roles in promoting soil nutrient transformation and improving nutrient availability. Moreover, at different periods in T3, the relative abundance of these fungal genera was significantly increased compared with the other treatments. This may explain the superior performance of the T3 treatment, which further supplements and improves the results of Zhou et al. [44]. This indicates that the T3 treatment can promote the decomposition of soil organic matter and the transformation of nutrients more effectively [45], aligning with the “microbial agents–enzyme activity–nutrient cycling” linkage mechanism proposed by Zhou et al. [44].
In conclusion, the return of wheat straw to the field and the combined application of microbial agents can increase rice yield by altering the structure of the soil fungal community, enhancing soil nutrient availability, and promoting root growth, as well as the accumulation of dry matter in the aboveground parts. Future research should further explore the effects of different ratios and application methods of microbial agents on soil fungal communities and their functions to optimize farmland management practices and promote sustainable agricultural development.

4.2. Improving Rice Yield and Soil Quality Through Wheat Straw Incorporation and Microbial Inoculants in a Rice–Wheat Rotation System

In recent years, with the continuous increase in crop yield, the amount of straw generated has increased substantially [46]. However, direct straw burning not only causes environmental pollution but also the loss of nutrients contained within the straw, preventing its reuse [47]. Therefore, the rational return of straw for recycling is an important agricultural practice. Previous studies have largely reported positive increases in crop yields following straw return to the field [48,49]. However, a decrease in crop yield after straw return has also been reported [50], which may be attributed to the accumulation of straw and its low decomposition rate, both of which have negative impacts on the soil environment. Microorganisms, integral components of the soil ecosystem, when applied appropriately, can improve the soil microenvironment and enhance crop production [51,52]. Therefore, in the context of straw return, it is of great significance to explore how the rational application of microbial agents can promote straw decomposition, thereby improving crop yield and soil environment. Previous studies have widely reported the positive increase in crop yield following straw return [28,49]. This study also found that, compared to the no-return treatment, straw return increased rice yield. However, some studies have pointed out that slow straw decomposition, leading to accumulation in the field, may have negative effects on the soil environment, ultimately reducing crop yield [53,54]. Microorganisms, as core components of the soil ecosystem, can optimize the soil microenvironment and enhance crop yield when applied appropriately [51,52]. Microbial inoculants have been shown to effectively promote straw decomposition and enhance soil microbial community diversity [28], thereby improving the soil environment. In this study, the application of microbial agents and their effects on fungal genera revealed that the relative abundances of Penicillium and Marquandomyces during the jointing and mature stages were significantly higher in the T3 treatment than in the other treatments. Moreover, the correlation analysis revealed that over the two years, during the jointing stage, both Penicillium and Marquandomyces were positively correlated with rice dry biomass, material transport, soil nutrients, and yield. Although the correlations weakened during the heading stage, they remained mostly positive. Notably, at the heading stage, the positive correlations of Saitozyma with rice dry biomass, material transport, total soil N, and yield were significantly stronger than those at the jointing stage.
Furthermore, rice yield is dependent on the accumulation of dry matter and its efficient transport to the spikes [55,56]. In this study, the T3 treatment exhibited higher values of MTL, MTSS, ADM, and GRP from the heading to the maturity stage, indicating that the combined application of microbial agents based on wheat straw return to the field can not only enhance the photosynthetic product accumulation capacity of plants, but also improve the transport efficiency of nutrients from vegetative organs to reproductive organs. In particular, the material contribution rates of stem sheaths and leaves were significantly higher in the T3 treatment than in the other treatments. This mechanism, which promotes the accumulation and transport efficiency of dry matter during the critical growth period of rice, represents an important pathway through which microbial agents contribute to rice yield increases and provides a strong foundation for the development of a high-yielding population structure.
In conclusion, the T3 treatment demonstrated the most favorable outcomes in terms of rice yield. The combined application of microbial agents alongside wheat straw return to the field increases rice yield and improves the soil environment by modulating the soil microenvironment. This modulation increases the relative abundance of beneficial microbes, such as the bacterial genus Anaeromyxobacter and the fungal genera Penicillium, Marquandomyces, and Saitozyma. These microbes promote the efficient decomposition of wheat straw, improving soil nutrient levels and enhancing soil enzyme activities, leading to an increase in soil total nitrogen and nitrate nitrogen content. These effects promote rice biomass formation, ultimately contributing to higher yields.

5. Conclusions

This study found that wheat straw return can lay the foundation for increasing rice yield by altering the composition of soil fungal communities and enhancing the levels of total nitrogen, nitrate nitrogen, ammonium nitrogen, and organic matter. On this basis, the combined application of Bacillus subtilis and Trichoderma harzianum at a dosage of 20 g m−2 further strengthens soil nitrogen supply, significantly promoting aboveground biomass accumulation and grain yield. The core mechanism underlying this effect lies in optimizing the soil fungal community structure, enriching the Penicillium genus during the jointing stage and the Saitozyma genus during the heading stage, enhancing straw decomposition and nitrogen transformation efficiency, and significantly increasing total nitrogen and ammonium nitrogen levels in the soil. At the same time, this treatment promotes efficient dry matter accumulation and transport, with significant increases in stem–leaf dry weight at heading and spike accumulation at maturity, as well as a synergistic increase in material transport efficiency and growth rate. This synergistic model, driven by microbial nutrient cycling and crop material allocation, provides both theoretical and practical support for sustainable high-yield rice cultivation.

6. Limitations of the Study

Uncertainty regarding the study period and long-term effects: This study is based solely on short-term experimental results from two years, without conducting long-term positioning trials. As such, it is unable to clarify the cumulative impacts of continuous straw return and microbial inoculant application on the evolution of soil fungal communities, nutrient pool balance, and crop yield stability over the long term.
Limited research on microbial community structure changes: The study offers a relatively limited examination of community dynamics and their ecological functions at different growth stages. Furthermore, there is insufficient exploration of the specific mechanisms underlying soil nitrogen transformation processes. Future studies should delve deeper into how the combined application of microbial inoculants influences the activity of specific microbial communities, thereby regulating key soil processes such as nitrogen mineralization, nitrogen fixation, and nitrification.
Experimental conditions and applicability: The experiment was conducted under the ecological conditions of Sichuan Province with a wheat straw return rate of 4710 kg hm−2 (10% moisture content). The applicability of the best microbial inoculant combination (1:1 Bacillus subtilis and Trichoderma harzianum, 20 gm−2 application rate) needs further validation under different ecological regions and soil conditions. The study focused solely on this specific ratio, dosage, and application method, without exploring optimization of other parameters. The results are also constrained by specific soil and climate conditions, and a lack of cross-regional validation limits their generalizability.

Author Contributions

Conceptualization, Y.S., Y.M. and Y.W.; Formal analysis, Y.M. and Y.W.; Investigation, Y.M. and Y.W.; Methodology, Y.S., Y.M. and Y.W.; Visualization, Y.M. and Y.W.; Writing—original draft, Y.S., Y.M., Y.W., R.L., Z.P., G.L. and C.W.; Writing—review and editing, Y.M., R.L.; Funding acquisition, Z.Y., Y.S. and J.M.; Resources, Y.S. and J.M.; Supervision, Z.W., Z.Y., Z.C., J.M. and Y.S. All authors have read and agreed to the published version of the manuscript.

Funding

This work was supported by the Sichuan Natural Science Foundation Project (Grant No. 2024NSFSC0031); the National Key Research and Development Program Foundation of Ministry of Science and Technology of China (Grant No. 2023YFD2301903); the Sichuan Science and Technology Program (Grant No. 2024NZZJ0005); the National Modern Agricultural Industry Technology System Sichuan Rice Innovation Team (Grant No. SCCXTD-2024-SD-2); the Rice Breeding Project Foundation of Sichuan Provincial Science and Technology Department (Grant No. 2021YFYZ0005).

Data Availability Statement

The original contributions presented in this study are included in the article. Further inquiries can be directed to the corresponding authors.

Acknowledgments

We are grateful to Shanghai Personal Biology-Nology Co., Ltd. (China, Shanghai) for providing sequencing services; Thanks to Sichuan Green Microbial Tech-nology Co., Ltd. (China, Chengdu) for the microbial reagents provided.

Conflicts of Interest

The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as potential conflicts of interest.

References

  1. Zhang, L.; Zhang, F.; Zhang, K.; Liao, P.; Xu, Q. Effect of Agricultural Management Practices on Rice Yield and Greenhouse Gas Emissions in the Rice–Wheat Rotation System in China. Sci. Total Environ. 2024, 916, 170307. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  2. Li, H.; Dai, M.; Dai, S.; Dong, X. Current Status and Environment Impact of Direct Straw Return in China’s Cropland—A Review. Ecotoxicol. Environ. Saf. 2018, 159, 293–300. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  3. Khan, M.N.; Gong, Y.; Hu, T.; Lal, R.; Zheng, J.; Justine, M.F.; Azhar, M.; Che, M.; Zhang, H. Effect of Slope, Rainfall Intensity and Mulch on Erosion and Infiltration under Simulated Rain on Purple Soil of South-Western Sichuan Province, China. Water 2016, 8, 528. [Google Scholar] [CrossRef] [Scilit]
  4. Dai, Z.G.; Lu, J.W.; Li, X.K.; Lu, M.X.; Yang, W.B.; Gao, X.Z. Experiment on Nutrient Release Characteristics of Straw Returned to the Field from Different Crops. Trans. Chin. Soc. Agric. Eng. 2010, 26, 272–276. [Google Scholar] [CrossRef]
  5. Zhang, N.; Bai, L.; Wei, X.; Li, T.; Tang, Y.; Zeng, X.; Lei, Z.; Wen, J.; Su, S. Promoted Decomposition in Straw Return to Double-Cropped Rice Fields Controls Soil Acidity, Increases Soil Fertility and Improves Rice Yield. Chem. Eng. J. 2025, 509, 161309. [Google Scholar] [CrossRef] [Scilit]
  6. Kandeler, E. Chapter 7—Physiological and Biochemical Methods for Studying Soil Biota and Their Functions. In Soil Microbiology, Ecology and Biochemistry, 4th ed.; Paul, E.A., Ed.; Academic Press: Boston, MA, USA, 2015; pp. 187–222. ISBN 978-0-12-415955-6. [Google Scholar]
  7. Gałązka, A.; Jankiewicz, U.; Orzechowski, S. The Role of Ligninolytic Enzymes in Sustainable Agriculture: Applications and Challenges. Agronomy 2025, 15, 451. [Google Scholar] [CrossRef] [Scilit]
  8. Glick, B.R. Plant Growth-Promoting Bacteria: Mechanisms and Applications. Scientifica 2012, 2012, 963401. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  9. Singh, R.; Soni, P.; Jain, R.; Chauhan, A.; Kumar, R.; Gunsola, D.; Chattaraj, S.; de los Santos-Villalobos, S.; Mitra, D.; Gaur, A. Microbial Metabolites: A Sustainable Solution for Agricultural Challenges. Pedosphere, 2025; in press. [CrossRef] [Scilit]
  10. Hashem, A.; Tabassum, B.; Fathi Abd Allah, E. Bacillus subtilis: A Plant-Growth Promoting Rhizobacterium That Also Impacts Biotic Stress. Saudi J. Biol. Sci. 2019, 26, 1291–1297. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  11. Bai, J.; Yang, X.; Du, R.; Chen, Y.; Wang, S.; Qiu, R. Biosorption Mechanisms Involved in Immobilization of Soil Pb by Bacillus subtilis DBM in a Multi-Metal-Contaminated Soil. J. Environ. Sci. 2014, 26, 2056–2064. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  12. Chowdappa, P.; Mohan Kumar, S.P.; Jyothi Lakshmi, M.; Upreti, K.K. Growth Stimulation and Induction of Systemic Resistance in Tomato against Early and Late Blight by Bacillus subtilis OTPB1 or Trichoderma harzianum OTPB3. Biol. Control 2013, 65, 109–117. [Google Scholar] [CrossRef] [Scilit]
  13. de Lima, B.C.; Moro, A.L.; Santos, A.C.P.; Bonifacio, A.; Araujo, A.S.F.; de Araujo, F.F. Bacillus Subtilis Ameliorates Water Stress Tolerance in Maize and Common Bean. J. Plant Interact. 2019, 14, 432–439. [Google Scholar] [CrossRef] [Scilit]
  14. Xie, X.; Zhang, H.; Pare, P. Sustained Growth Promotion in Arabidopsis with Long-Term Exposure to the Beneficial Soil Bacterium Bacillus Subtilis (GB03). Plant Signal. Behav. 2009, 4, 948–953. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  15. Gu, K.; Zhang, D.; Guan, C.; Xu, J.; Li, S.; Shen, G.; Luo, Y.; Li, Y. Safe Antifungal Lipopeptides Derived from Bacillus marinus B-9987 against Grey Mold Caused by Botrytis cinerea. J. Integr. Agric. 2017, 16, 1999–2008. [Google Scholar] [CrossRef] [Scilit]
  16. de Oliveira, H.P.; de Melo, R.O.; Cavalcante, V.S.; Monteiro, T.S.A.; de Freitas, L.G.; Lambers, H.; Valadares, S.V. Phosphate Fertilizers Coated with Phosphate-Solubilising Trichoderma harzianum Increase Phosphorus Uptake and Growth of Zea mays. Plant Soil. 2025, 508, 613–624. [Google Scholar] [CrossRef] [Scilit]
  17. Al-Zuhairi, F.F.A.; Al-Aareji, J.M.A.; Al-Taae, A.K. Effect of Rootstock and Bio-Fertilizers on Some Mineral Concentrations in the Leaves of Local Lemon (Citrus limon L.) Transplants and Available Nutrients in the Media. IOP Conf. Ser. Earth Environ. Sci. 2021, 735, 12049. [Google Scholar] [CrossRef] [Scilit]
  18. Ghorbanpour, A.; Salimi, A.; Ghanbary, M.A.T.; Pirdashti, H.; Dehestani, A. The Effect of Trichoderma harzianum in Mitigating Low Temperature Stress in Tomato (Solanum lycopersicum L.) Plants. Sci. Hortic. 2018, 230, 134–141. [Google Scholar] [CrossRef] [Scilit]
  19. Zin, N.A.; Badaluddin, N.A. Biological Functions of Trichoderma Spp. for Agriculture Applications. Ann. Agric. Sci. 2020, 65, 168–178. [Google Scholar] [CrossRef] [Scilit]
  20. Zheng, K.; Cheng, J.; Xia, J.; Liu, G.; Xu, L. Effects of Soil Bulk Density and Moisture Content on the Physico-Mechanical Properties of Paddy Soil in Plough Layer. Water 2021, 13, 2290. [Google Scholar] [CrossRef] [Scilit]
  21. Lu, H.F. The Effects of Combined Application of Bacillus Subtilis and Yeast on the Soil Habitat and Physiology and Biochemistry of Rice Irrigated with Reclaimed Water. Ph.D. Thesis, Chinese Academy of Agricultural Sciences, Beijing, China, 2020. [Google Scholar]
  22. Bao, S.D. Soil Agrochemical Analysis; China Agriculture Press: Beijing, China, 2000. [Google Scholar]
  23. Wang, C.; Ma, Y.M.; Wang, C.Y.; Li, Z.X.; Luo, J.S.; Peng, Z.L.; Liu, R.H.J.; Huang, X.H.; Cao, Y.; Peng, Z.B.; et al. The effects of planting methods and nitrogen application rates on nutrient absorption characteristics and root vitality of hybrid indica rice. Acta Agron. Sin. 2024, 50, 3069–3082. [Google Scholar] [CrossRef] [Scilit]
  24. Hu, Y.; Ma, P.; Yang, Z.; Liu, S.; Li, Y.; Li, L.; Wang, T.; Siddique, K.H.M. The Responses of Crop Yield and Greenhouse Gas Emissions to Straw Returning from Staple Crops: A Meta-Analysis. Agriculture 2025, 15, 408. [Google Scholar] [CrossRef] [Scilit]
  25. Zhang, R.; Yu, H.; Zhang, W.; Li, W.; Su, H.; Wu, S.; Xu, Q.; Li, Y.; Yao, H. Straw Return Enhances Grain Yield and Quality of Three Main Crops: Evidence from a Meta-Analysis. Front. Plant Sci. 2024, 15, 1433220. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  26. Wang, L.; Wu, Y.H.; Qin, Y.H.; Dan, Y.B.; Chen, H.; Hao, X.S.; Tian, X.H. The effects of combined straw returning and reduced nitrogen fertilizer application on dry matter accumulation, nitrogen transport and yield of red clover rice. Acta Agron. Sin. 2023, 50, 756–770. [Google Scholar]
  27. Wu, J.; Wang, R.; Lu, G.D.; Long, B.; Yang, F.X.; Chen, H.N.; Huang, H. The effects of different straw returning methods in Huanghuang on rice yield and soil nutrients. Acta Agric. Boreali-Sin. 2019, 34, 177–183. [Google Scholar] [CrossRef]
  28. Zhao, B.; Dong, W.; Chen, Z.; Zhao, X.; Cai, Z.; Feng, J.; Li, S.; Sun, X. Microbial Inoculation Accelerates Rice Straw Decomposition by Reshaping Structure and Function of Lignocellulose-Degrading Microbial Consortia in Paddy Fields. Bioresour. Technol. 2024, 413, 131545. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  29. de Souza, A.E.S.; Filla, V.A.; da Silva, J.P.M.; Barbosa Júnior, M.R.; de Oliveira-Paiva, C.A.; Coelho, A.P.; Lemos, L.B. Application of Bacillus spp. Phosphate-Solubilizing Bacteria Improves Common Bean Production Compared to Conventional Fertilization. Plants 2023, 12, 3827. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  30. Rais, A.; Shakeel, M.; Malik, K.; Hafeez, F.Y.; Yasmin, H.; Mumtaz, S.; Hassan, M.N. Antagonistic Bacillus spp. Reduce Blast Incidence on Rice and Increase Grain Yield under Field Conditions. Microbiol. Res. 2018, 208, 54–62. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  31. Han, Q.Q.; Lü, X.P.; Bai, J.P.; Qiao, Y.; Paré, P.W.; Wang, S.M.; Zhang, J.L.; Wu, Y.N.; Pang, X.P.; Xu, W.B.; et al. Beneficial Soil Bacterium Bacillus Subtilis (GB03) Augments Salt Tolerance of White Clover. Front. Plant Sci. 2014, 5, 525. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  32. Chang, N.; Zhang, X.J.; Ma, L.L.; Shi, J.J.; Jia, W.; Qi, Y.Z.; Yin, B.Z.; Zhen, W.C. The influence of microbial agents on the growth of wheat and the prevention effect of soil-borne diseases. Crop Mag. 2017, 155–160. [Google Scholar] [CrossRef]
  33. Lu, J.; Liu, B.Z.; Zhou, C.Y.; Wang, C.A.; Zhang, W.X. The Influence of Bio-Organic Bacterial Fertilizer on Rice Yield and Rice Quality. Bull. Chin. Agric. Sci. 2009, 25, 146–150. [Google Scholar]
  34. Qu, H.Y.; Liu, L.M.; Wu, C. The degradation effect of Trichoderma liquid fermentation on straw. Jiangsu Agric. Sci. 2014, 42, 283–285. [Google Scholar] [CrossRef]
  35. Zhao, J.T.; Shi, Y.P.; Cao, M.J.; Ren, J.J.; Wang, Y.Q.; Chen, Y.P.; Wang, Y.R.; Chen, G. The influence of slow and controlled release fertilizers combined with straw returning to the field on rice yield and nitrogen utilization rate. Zhejiang Agric. Sci. 2025, 66, 590–594. [Google Scholar] [CrossRef]
  36. Li, J.Y.; Chen, J.; Wu, J.F.; Ni, G.R.; Xie, K.L.; Zhou, C.H.; Rong, Q.L.; Zhao, X.M. The influence of returning straw and its biochar to the field on nutrient absorption, distribution and yield of rice. J. Jiangxi Agric. Univ. 2023, 45, 1118–1128. [Google Scholar] [CrossRef]
  37. Zhao, J.; Gao, Q.; Zhou, J.; Wang, M.; Liang, Y.; Sun, B.; Chu, H.; Yang, Y. The Scale Dependence of Fungal Community Distribution in Paddy Soil Driven by Stochastic and Deterministic Processes. Fungal Ecol. 2019, 42, 100856. [Google Scholar] [CrossRef] [Scilit]
  38. Salamanca-Fonseca, M.; Sanchez, A.; Corrales, A.; Kauserud, H.; Thoen, E.; Krabberød, A.K.; Skrede, I. Beyond Seasonal and Host Factors: Ecosystem Dynamics Drive Palm-Associated Root Fungal Communities at a Local Scale. Plant Soil. 2025, 1–15. [Google Scholar] [CrossRef] [Scilit]
  39. Man, B.Y.; Xiang, X.; Luo, Y.; Mao, X.T.; Zhang, C.; Sun, B.H.; Wang, X. Characteristics of soil fungal communities under typical vegetation types in Huangshan Mountain and their influencing factors. Mycosystema 2021, 40, 2735–2751. [Google Scholar] [CrossRef]
  40. Wan, R.Y.; Ma, H.J.; Jiang, B.; Yang, L.R.; Zhou, D.P.; He, M.Z.; Yang, G.R. Composition of soil fungal communities in tea gardens and their influencing factors. Chin. Agric. Sci. Bull. 2021, 37, 88. [Google Scholar] [CrossRef]
  41. Xia, M.; Li, P.; Liu, J.; Qin, W.; Dai, Q.; Wu, M.; Li, Z.; Li, D.; Liu, M. Long-Term Fertilization Promotes the Microbial-Mediated Transformation of Soil Dissolved Organic Matter. Commun. Earth Environ. 2025, 6, 114. [Google Scholar] [CrossRef] [Scilit]
  42. Luo, J.R.; Song, W.J.; Liu, W.; Zhang, D.H.; Jiang, X.; Lu, B.L. Effects of Straw Returning Combined with Nitrogen Fertilizer Application on Rice Growth, Soil Properties, and Microbial Diversity in the Early Stage. J. Agric. Biotechnol. 2023, 31, 2019–2034. [Google Scholar] [CrossRef]
  43. Wang, Z.; Liu, J.Y.; Li, Z.; Li, B.; Li, Y.; Ao, J.C. Effects of applying different beneficial microbial agents on the rhizosphere soil microecology of continuously cropped flue-cured tobacco. Southwest China J. Agric. Sci. 2024, 37, 612–621. [Google Scholar] [CrossRef]
  44. Zhou, X.; Wang, J.; Liu, F.; Liang, J.; Zhao, P.; Tsui, C.K.M.; Cai, L. Cross-Kingdom Synthetic Microbiota Supports Tomato Suppression of Fusarium Wilt Disease. Nat. Commun. 2022, 13, 7890. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  45. Wen, Y.; Ma, Y.; Wu, Z.; Yang, Y.; Yuan, X.; Chen, K.; Luo, Y.; He, Z.; Huang, X.; Deng, P.; et al. Enhancing Rice Ecological Production: Synergistic Effects of Wheat-Straw Decomposition and Microbial Agents on Soil Health and Yield. Front. Plant Sci. 2024, 15, 1368184. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  46. Liu, R.Z.; Borjigin, Q.; Gao, J.L.; Yu, X.F.; Hu, S.P.; Li, R.P. Effects of Different Straw Return Methods on Soil Properties and Yield Potential of Maize. Sci. Rep. 2024, 14, 28682. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  47. Li, H.; Li, J.; Jiao, X.; Jiang, H.; Liu, Y.; Wang, X.; Ma, C. The Fate and Challenges of the Main Nutrients in Returned Straw: A Basic Review. Agronomy 2024, 14, 698. [Google Scholar] [CrossRef] [Scilit]
  48. Lin, S.; Quan, G.; Fu, X.J.; Liu, Z.Z.; Lü, X.H. Effects of straw returning on soil physicochemical properties and yield and quality of japonica rice in coastal rice areas. North. Rice 2023, 53, 29–32. [Google Scholar] [CrossRef]
  49. Akwakwa, G.H.; Xiaoyan, W. Impact of Rice–Wheat Straw Incorporation and Varying Nitrogen Fertilizer Rates on Soil Physicochemical Properties and Wheat Grain Yield. Agronomy 2023, 13, 2363. [Google Scholar] [CrossRef] [Scilit]
  50. Peng, X.L.; Dong, Q.; Zhang, C.; Li, P.F.; Li, B.L.; Liu, Z.L.; Yu, C.L. Effects of straw incorporation rate on soil reductive substances and rice growth under different soil conditions. Chin. J. Rice Sci. 2024, 38, 198–210. [Google Scholar] [CrossRef]
  51. Solanki, K.; Choudhary, S.K.; Singh, A.; Maurya, S.; Shukla, S.; Yadav, S.; Anshuman, K.; Singh, R.D. Response of Combined Application of Nutrient Levels with Microbial Strains on Crop Growth, Nodulation and Yield of Soybean. Int. J. Environ. Clim. Change 2023, 13, 919–924. [Google Scholar] [CrossRef] [Scilit]
  52. Sahu, R.K.; Kumar, S.; Thakur, R.; Mitra, N.G. Effects of Bioinoculants on Total Chlorophyll Content, Yield of Soybean and Fertility Status of a Vertisols. J. Exp. Agric. Int. 2023, 45, 266–272. [Google Scholar] [CrossRef] [Scilit]
  53. Peng, J.; Feng, Y.; Wang, X.; Li, J.; Xu, G.; Phonenasay, S.; Luo, Q.; Han, Z.; Lu, W. Effects of Nitrogen Application Rate on the Photosynthetic Pigment, Leaf Fluorescence Characteristics, and Yield of Indica Hybrid Rice and Their Interrelations. Sci. Rep. 2021, 11, 7485. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  54. Singh, D.P.; Singh, H.B.; Prabha, R. (Eds.) Microbial Inoculants in Sustainable Agricultural Productivity: Vol. 2: Functional Applications; Springer: Berlin/Heidelberg, Germany, 2016; ISBN 978-81-322-2643-7. [Google Scholar]
  55. Liu, K.; Zhou, S.; Li, S.; Wang, J.; Wang, W.; Zhang, W.; Zhang, H.; Gu, J.; Yang, J.; Liu, L. Differences and Mechanisms of Post-Anthesis Dry Matter Accumulation in Rice Varieties with Different Yield Levels. Crop Environ. 2022, 1, 262–272. [Google Scholar] [CrossRef] [Scilit]
  56. Smith, C.W.; Dilday, R.H. (Eds.) Rice: Origin, History, Technology, and Production; Wiley: Hoboken, NJ, USA, 2002; ISBN 978-0-471-34516-9. [Google Scholar]
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Article Metrics

Citations

Article Access Statistics

Multiple requests from the same IP address are counted as one view.