High Resistance and Yield: A New Cultivar ‘ZJLZS002’ of Lyophyllum decastes Suitable for Industrial Cultivation

Abstract

Lyophyllum decastes, commonly known as Luronggu, is extensively cultivated across China. It exhibits rich germplasm in China. However, the number of cultivars available for commercial production is limited, highlighting the importance of targeted breeding programs. In this study, we utilized selected breeding and SSR molecular markers to develop improved strains of L. decastes for the first time. The breeding process strictly adhered to China’s national standard for ‘Technical inspection for mushroom selecting and breeding’. It encompassed pure strain isolation, biological classification, primary screening, secondary screening, physiological performance determination, molecular characterization, intermediate test, and demonstration cultivation. As a result, strain ZJLZS002, known for its high yield (380 ± 3.6 g·bag⁻¹), shortened growth period (75.6 ± 1.3 d), and stable traits, is well suited for industrial cultivation. This new cultivar has achieved a significant milestone as the first variety in China to be officially recognized at the provincial level, under the name ‘Zhongjunluronggu No. 1’. Its development signifies a crucial advancement in achieving seed source independence and promotes the replacement of imported varieties with domestic ones, contributing to the sustainable development of China’s edible fungi industry.

1. Introduction

Lyophyllum decastes (Fr.) Singer, a rare and valuable edible–medicinal mushroom, possesses exceptional nutritional and pharmacological properties [1]. This mushroom, belonging to the phylum Basidiomycota, order Agaricales, family Lyophyllaceae, and the genus Lyophyllum [2,3], exhibits a natural distribution across temperate regions of the northern hemisphere, including China, Japan, Korea, and European and American countries [4,5]. Particularly in China, in regions such as Yunnan, Guizhou, Liaoning, Jilin, Heilongjiang, and the Inner Mongolia Autonomous Region, its genetic diversity is abundant [6]. It is particularly prized for its delicate texture, aromatic grass-like scent, and delightful taste [7]. Both the fruiting body and mycelium are abundant in proteins, amino acids, and various vitamins, as well as critical trace elements, including iron, zinc, and selenium [8,9,10]. Notably, it has garnered significant attention for its bioactive substances. Its polysaccharides exhibit a variety of potential health-promoting properties, such as antioxidant, hypolipidemic, antitumor, antibacterial, and antidiabetic effects [11,12,13,14].

As an emerging culinary-medicinal mushroom, L. decastes has experienced rapid production growth following the development of industrial cultivation [7]. China currently dominates global production, with official data from the China Edible Fungi Association Public Service Platform reporting 193,131 tons of output in 2023 (https://bigdata.cefa.org.cn/output.html, accessed on 28 April 2025). Major production regions are concentrated in the provinces of Guizhou, Shandong, Jiangxi, Fujian, Sichuan, and Gansu [15]. However, our research team has identified concerning genetic uniformity among commercial strains (non-published material). Market analysis revealed that most cultivated strains in China can be traced back to a single progenitor—the KX-HA092 variety, originally introduced in Japan by Shanghai Fengke Biotechnology Co., Ltd. (Shanghai, China) [16].

There have been reports on the breeding of new strains and varieties of L. decastes. Using selected breeding, Woo et al. [17] evaluated nine strains from South Korea and Japan, identifying SPA202 and SPA205 as high-yield stains. Yoshihama et al. [18] achieved fruiting body formation on artificial media, and applied for a US patent in 1994. Wei et al. [19] successfully isolated wild strains from China’s Qilian Mountains using potato dextrose agar (PDA) enrichment medium. Qiu et al. [20] developed the dark-brown cultivar ‘Changli No. 1’. Utilizing monosporous hybridization, the commercially valuable KX-HA092 variety was developed through crossing Japanese strains 5-99 and 62-33(2) with Swiss strain IFO32185, and its growth period was 78 days [21]. Pan et al. [22] developed three improved hybrids (KL4, KL10, KL17) with superior fruiting body characteristics, among which KL17 demonstrated optimal morphology and the shortest production cycle. Furthermore, Liang et al. [23] successfully screened a high-yield laccase strain HY1022-01 through UV-induced protoplast mutagenesis and selected a new high-polysaccharide-yield strain ZY481-1 by protoplast mutagenesis; its polysaccharide yield was up to 643.1961 mg/g, which revealed a 31.05% increase compared with the original strain, ZY48-1 [24]. Despite the successful establishment of large-scale industrial cultivation for L. decastes, several critical challenges persist that hinder its full commercial potential. These include (1) the scarcity of potential strains with independent intellectual property rights, (2) slow mycelial growth rates, (3) suboptimal yield performance, (4) rapid spawn degeneration, and (5) poor resistance [1,25]. These limitations collectively constrain its commercial development and market competitiveness.

Simple sequence repeat (SSR) molecular markers offer a powerful solution for germplasm improvement. As codominant markers that detect genetic variation at the DNA level, SSRs exhibit several superior characteristics: (1) environmental stability, (2) high reproducibility, and (3) exceptional discriminatory power. Notably, SSR molecular markers, developed from whole genome sequences, demonstrate enhanced polymorphism and more comprehensive genome coverage compared to other marker systems [26,27]. These attributes make SSR analysis an indispensable tool for assessing genetic diversity and germplasm resources in edible fungi; however, there are no reports on L. decastes to date.

In developing the new variety ‘ZJLZS002’, our research team implemented a comprehensive breeding strategy for (1) precise strain identification, (2) intellectual property protection, and (3) varietal registration.

Considering China’s current cultivation scenario, this strategy facilitates (1) systematic development of improved industrial strains, (2) the creation of novel cultivars, and (3) the sustainable advancement of the industry. The implementation of this strategy is particularly significant for (1) optimizing L. decastes germplasm resources, and (2) enhancing China’s independent germplasm innovation capacity.

2. Materials and Methods

2.1. Materials

2.1.1. Tested Strains

The nine tested strains utilized in the present study are illustrated in

Table 1. Tested strains and their origins.

Code	Strain No.	Taxon	Type	Origin of Resource
1	ZJLZS001	Lyophyllum decastes	Wild	Dandong City, Liaoning Province
2	ZJLZS002	Lyophyllum decastes	Wild	Dandong City, Liaoning Province
3	ZJLZS003	Lyophyllum decastes	Wild	Hohhot City, Inner Mongolia Autonomous Region
4	ZJLZS004	Lyophyllum decastes	Wild	Yongping County, Yunnan Province
5	ZJLZS005	Lyophyllum decastes	Wild	Xinjiang Uygur Autonomous Region
6	ZJLZS006	Lyophyllum decastes	Wild	Yuxi County, Yunnan Province
7	ZJLZS007	Lyophyllum decastes	Wild	Lijiang City, Yunnan Province
8	ZJLZS008	Lyophyllum decastes	Wild	Diqing Tibetan Autonomous Prefecture
9	LR-A	Lyophyllum decastes	Cultivation	Jiangsu Hongsheng Biotechnology Co., Ltd.

and are stored at the Germplasm Resource Bank of Edible Fungi, Kunming Edible Fungi Institute of All China Federation of Supply and Marketing Cooperatives. LR-A, obtained from Jiangsu Hongsheng Biotechnology Co., Ltd. (Xuzhou, China), was used as the benchmark control variety. We executed the preservation of patented strains at the China Center for Type Culture Collection of Wuhan University, and filed patent applications for potential strains.

2.1.2. Culture Conditions

PDA enrichment medium was used for pure strain isolation and culture. It included 200 g of potatoes (immersed), 20 g of glucose, 16 g of agar, 3 g of yeast powder, 3 g of potassium dihydrogen phosphate, and 1.5 g of magnesium sulfate, all dissolved in 1 L of water, with the pH adjusted to 6. Pure strains were maintained in darkness at 25 °C. A liquid medium was used to produce liquid spawn. It included 200 g of potatoes (immersed), 20 g of glucose, 3 g of yeast powder, 3 g of potassium dihydrogen phosphate, and 1.5 g of magnesium sulfate, combined with 1 L of water, with the pH adjusted to 6. The liquid spawn were incubated in a shaking incubator (in darkness at 25 °C, shaken at 160 rpm). The culture medium for cultivation comprised 35% wood chips, 35% corn cob, 20% wheat bran, 4% corn meal, 4% soybean meal, and 2% calcium bicarbonate, with the pH adjusted to 6. Mycelium was cultured in darkness at 25 °C, with a relative humidity of less than 70%.

2.2. Methods

Adhering to the national standard for ‘Technical inspection for mushroom selecting and breeding’ [28], the breeding process is shown in Figure 1.

2.2.1. Tissue Isolation and Purification

First, a small piece of tissue at the junction of the cap and stipe of the fruiting body, approximately 5 mm × 5 mm in size, was excised using a sterile scalpel, transferred into the PDA enrichment medium, and purified 2–3 times. Strains exhibiting superior mycelium growth were then selected. These selected strains were incubated in darkness at 25 °C for 12–15 days.

2.2.2. Biological Classification

DNA was successfully extracted from the mycelium using an optimized CTAB procedureDNA [29,30]. Primer sets LR0R-LR5 [31], were applied to amplify the nuclear ribosomal large subunit (nrLSU) sequence. The PCR reaction conditions followed the protocol described by Tang et al. [3]. The PCR products were dispatched to Tianyi Huayu Gene Technology Co., Ltd. (Wuhan, China) for subsequent sequencing analysis.

The L. decastes sequences produced in this study were submitted to the NCBI database for Basic Local Alignment Search Tool (https://blast.ncbi.nlm.nih.gov/Blast.cgi?PROGRAM=blastn&PAGE_TYPE=BlastSearch&LINK_LOC=blasthome), and clusters with closely related sequences were downloaded. The nrLSU dataset was submitted to the MAFFT version 7 [32] online platform for alignment, and maximum likelihood (ML) analyses was conducted at IQTREE Web Server (http://iqtree.cibiv.univie.ac.at/, accessed on 28 April 2025). The optimal TNe+G4 model was obtained using 1000 replicates with default parameters. Calocybe vinacea was used as the outgroup. Only bootstrap support values of branches ≥70 were displayed on the phylogenetic tree.

2.2.3. Primary Screening

Strains of the same fungal age and with a diameter of 5 mm were connected to the center of the PDA enrichment medium and incubated at a constant temperature at 25 °C for 14 days. Utilizing colony characteristics, mycelial growth potential, and growth rate as criteria, each strain was tested three times to screen for the good-performing strains. Subsequently, the strains capable of fruiting on the PDA enrichment medium were selected for further secondary screening.

2.2.4. Secondary Screening

Polypropylene bags, each measuring 18 cm × 33 cm, were used to contain 400 g of dry cultivation substrate (comprising 35% wood chips, 35% corn cob, 20% wheat bran, 4% corn meal, 4% soybean meal, and 2% calcium bicarbonate). These bags were then sterilized at a temperature of 121 °C and pressure of 0.15 MPa for 120 min. A total of 60 bags were allocated for each strain. In a sterile environment, the liquid spawn of the dominant strains was introduced into the sterilized bags and maintained at a stable temperature of 25 °C in darkness for 50 days. Fruiting management was carried out according to the industrial cultivation method of L. decastes [33].

The potential strains, characterized by high yield and suitability for industrial production, were selected based on their agronomic characteristics, such as single fruit mass, cap diameter, stipe diameter, yield, biological efficiency, and growth period.

$$Z={\displaystyle \frac{X}{Y}}\times 100\%$$

In the equation, Z represents biological efficiency; X denotes the yield weight per bag, measured in grams; Y stands for the weight of the dry cultivation substrate per package, also measured in grams.

2.2.5. Physiological Performance Determination of Potential Strains

Antagonistic Reaction Determination

So far, no varieties of L. decastes have been identified in China. The prevalent cultivar LR-A served as the control. Mycelium pieces of the same fungal age and dimensions from potential strains and LR-A were excised using a 5 mm punch and planted on PDA enrichment medium via the two-point inoculation technique [34]. Subsequent observation of the antagonistic response was conducted at a temperature of 25 °C.

Antibacterial TEST

Using a 5 mm hole punch, mycelium pieces of the same fungal age and dimensions were selected from the potential strains, Penicillium brevicompactum and Trichoderma pleuroticola, and were planted in the PDA enrichment medium via the two-point inoculation technique. The cultures were monitored for growth at a temperature of 25 °C for a designated duration, and the antibacterial efficacy was determined through calculation, with triple repetition. The antibacterial efficacy, denoted as E, was calculated using the following formula:

$$E={\displaystyle \frac{(R1-R2)}{R1}}\times 100\%$$

where R1 signifies the radius of mold growth under normal conditions, measured in centimeters, and R2 represents the radius of mold growth in the two-point confrontation experiment, also in centimeters.

2.2.6. Molecular Characterization: SSR Molecular Markers

Based on the sequencing platform, SSR loci were identified in the sequence of the L. decastes genome (GCF_021015755.1) from the database for development and screening. Following DNA extraction [30] and PCR amplification [35], capillary electrophoresis (CE) was performed on an ABI 3730XL sequencer (Applied Biosystems, Carlsbad, CA, USA). Capillary electropherograms were analyzed with GeneMarker^® version 2.7.0. Ten pairs of SSR primers with clear amplification bands, high reproducibility, and high specificity were obtained. These included LD045, LD063, LD089, LD093, LD094, LD095, LD098, LD129, LD149, and LD157. The details of these 10 pairs of SSR primers are presented in

Table 2. Information of 10 pairs of SSR primers.

Primer Name	Size of Primer Fragment
LD045	F: CCGCACAACACCTCAACAAG; R: TCGTCGCACAAAGAGCAGTA
LD063	F: TCATCGGGACAAAGCCGAAA; R: GTCAACCCAAGCGACAACAC
LD089	F: CCAAACAGTGCCGTTGAGTG; R: CTCCGGCGTTGAGTGACTAG
LD093	F: TGGGTGTCGTTTGGGTATGG; R: CACGAGGACAGGCACATTCT
LD094	F: GGGACGGAAGGGAAGGAAAG; R: TCTTTAACGCAGCGGTCCAT
LD095	F: TGATGATGAGGCTTCGACGG; R: GTCACGACAACGCACTGTTC
LD098	F: TCGGTGCGTAATCGTTTGGA; R: ATCGCCGCTTTCTGCAAATG
LD129	F: CGTCGTTACATCGTTGACGC; R: TGGCACATCCATGAAGCAGT
LD149	F: AAACTCAAGCTGTCCCGGTC; R: TCAAAGGAAGCTCCACCGAC
LD157	F: ACGAGCTATTGGACGACCAC; R: TTTCGTTTCCACGCCGACTA

F stands for forward primer; R stands for reverse primer.

.

2.2.7. Intermediate Test

Utilizing the industrial cultivation method of L. decastes [33], potential strains and LR-A were cultivated, with a total of 1500 bags set up for each strain across three replicate groups. The yield of each strain was measured with 100 bags randomly selected, and the agronomic traits of the fruiting bodies were documented to determine the yield and growth period.

2.2.8. Demonstration Cultivation

From April 2022 to April 2024, demonstration cultivation was carried out at Base 1: Jinning Baofeng Base, Kunming Institute of Edible Fungi, All China Supply and Marketing Cooperative Society; and Base 2: Jiangsu Hongsheng Biotechnology Co., Ltd., situated in Suining County, Xuzhou City, Jiangsu Province.

Following the provisions set forth in the national standard ‘Technical inspection for mushroom selecting and breeding’ [28], the experimental design for the demonstration cultivation was designed with 10,000 bags per group, across three groups. Utilizing the industrial cultivation method of L. decastes [33], potential strains and LR-A were cultivated. Metrics such as the fresh single fruit mass, first-tide yield, and biological efficiency were counted.

2.2.9. Determination of Nutrient Content in Fruiting Body

Dried fruiting body samples of the potential strains were sent to Yunnan Sanzheng Technical Testing Co., Ltd. (Kunming, China) for analysis, which included the detection of proteins [36], amino acids [37], polysaccharides [38], trace elements, and vitamins, among other components.

2.3. Analysis of Data

Statistical analyses were performed using SPSS version 22. Continuous data were presented as the mean ± standard deviation ($\overline{\mathrm{X}}$ ± s). One-way ANOVA, followed by the LSD post hoc test, was used for multiple comparisons among the groups. A p-value < 0.05 was considered statistically significant.

3. Results

3.1. Isolation of Strains

A total of 22 wild fruiting bodies were collected from seven provinces across China. Following successful isolation and purification, eight pure strains were obtained.

3.2. Phylogenetic Analyses

Nine new nrLSU sequences were generated (

Table 3. The data employed in this study.

Species	Voucher	nrLSU	Reference
Lyophyllum decastes	ZJLZS001	PV570115	This study
L. decastes	ZJLZS002	PV570116	This study
L. decastes	ZJLZS003	PV570117	This study
L. decastes	ZJLZS004	PV570118	This study
L. decastes	ZJLZS005	PV570119	This study
L. decastes	ZJLZS006	PV570120	This study
L. decastes	ZJLZS007	PV570121	This study
L. decastes	ZJLZS008	PV570122	This study
L. decastes	LR-A	PV570114	This study
L. decastes	Sundberg091007a	HM572548	[39]
L. decastes	F-855	PQ652409	Genbank
L. ambustum	F-810	PQ652355	Genbank
L. fumosu	Lipovac090903	HM572538	[39]
L. shimeji	Eilertsen090908	HM572531	[39]
L. shimeji	CBS 451.87	AF223215	[40]
L. shimeji	haukebo1982	HM572529	[39]
Calocybe vinacea	HMJU 5135	NG243053	Genbank

). The phylogenetic tree based on nrLSU sequences indicates that the nine strains, along with two other known L. decastes strains, are clustered in the large clade (Figure 2).

3.3. Comparison of Preliminary Screening

Analysis of the mycelium growth rates revealed that, as detailed in

Table 4. Preliminary screening results.

Strain	Mycelium Growth Rate (cm/d)	Growth Vigor	Fruiting
ZJLZS001	0.27 ± 0.01 bc	+	T
ZJLZS002	0.35 ± 0.01 a	+++	T
ZJLZS003	0.36 ± 0.04 a	+++	T
ZJLZS004	0.31 ± 0.01 b	++	N
ZJLZS005	0.3 ± 0.00 b	++	N
ZJLZS006	0.3 ± 0.02 b	++	N
ZJLZS007	0.27 ± 0.02 bc	+	T
ZJLZS008	0.3 ± 0.02 b	++	N

+ Mycelium is thin and weak. ++ Mycelium is thin and general. +++ Mycelium is thick and strong. Lowercase letters indicate significant difference at p < 0.05. T stands for fruiting; N stands for non-fruiting.

, strains ZJLZS002 and ZJLZS003 exhibited thick and strong growth, with respective mycelium growth rates of 0.35 cm/d and 0.36 cm/d. ZJLZS002 and ZJLZS003 had significant differences compared with the other six strains (p < 0.05). Strains ZJLZS004, ZJLZS005, ZJLZZS006, and ZJLZS008 displayed thin and average growth, with mycelial growth rates of 0.31 cm/d, 0.30 cm/d, 0.30 cm/d, and 0.30 cm/d, respectively. ZJLZS001 and ZJLZS007, however, presented as thin and weak, with mycelial growth of 0.27 cm/d. As depicted in Figure 3, ZJLZS001, ZJLZS002, ZJLZS003, and ZJLZS007 demonstrated their capability to form fruiting bodies at the later stage of mycelium culture in the PDA enrichment medium, indicating their fruiting potential. Consequently, strains ZJLZS002 and ZJLZS003, marked by their good growth and fruiting ability, were selected for the secondary screening.

3.4. Comparison of Secondary Screening

Compared to strain ZJLZS003, ZJLZS002 demonstrated superior fruiting body development, characterized by greater thickness and higher quality, as indicated in Figure 4 and

Table 5. Rescreening results.

Strain	Growth Period /Day	Stipe Characteristics			Cap Diameter /mm	Single Fruit Mass/g	Yield /(g·bag−1)	Biological Efficiency/%
		Length /cm	Upper Diameter /mm	Bottom Diameter /mm
ZJLZS002	75.7 ± 1.5 b	9.80 ± 0.36	10.92 ± 0.33 a	16.49 ± 1.00 a	33.89 ± 0.57	16.00 ± 0.26	374.67 ± 8.50 a	93.67 ± 2.13 a
ZJLZS003	80.7 ± 1.5 a	10.73 ± 0.92	8.53 ± 0.72 b	10.87 ± 0.11 b	32.61 ± 1.13	14.03 ± 1.76	337.00 ± 21.0 b	84.25 ± 6.00 b

Lowercase letters indicate significant difference at p < 0.05.

. Its yield reached an impressive 374.67 ± 8.5 g per bag, significantly higher than that of ZJLZS003, with 337 ± 21 g (p < 0.05). The cap was of moderate size, with a diameter of 33.89 ± 0.57 mm. The length of the stipe was 9.8 ± 0.36 cm, its upper diameter was 10.92 ± 0.33 mm (p < 0.05), and its bottom diameter was 16.49 ± 1.00 mm (p < 0.05). The single fruit mass was 16 ± 0.26 g, and the growth period was 75.7 ± 1.5 d (p < 0.05). Consequently, ZJLZS002 was selected as a potential strain for physiological performance detection, distinguishing identification, intermediate testing, and demonstration cultivation.

3.5. Results of Antagonistic Reaction

The results of the antagonism tests reveal an isolated antagonistic interaction between ZJLZS002 and LR-A, as depicted in Figure 5. Additionally, distinct differences were observed in the mycelial morphology.

3.6. Results of Antibacterial Test

As depicted in Figure 6 and

Table 6. Antibacterial rates of ZJLZS002 and LR-A.

Strain	P. brevicompactum				T. pleuroticola
	R1/cm	R2/cm	R1 − R2/cm	E/%	R1/cm	R2/cm	R1 − R2/cm	E/%
ZJLZS002	2.4	1.1	1.3	54.2	2.1	4.1	2	48.8
LR-A	2.4	1.6	0.8	33.3	3.2	4.1	0.9	21.9

R1 signifies the radius of mold growth under normal conditions, measured in centimeters; R2 represents the radius of mold growth in the two-point confrontation experiment, also in centimeters; E is the antibacterial rate.

, during the antibacterial evaluation against Penicillium brevicompactum and Trichoderma pleuroticola, the potential strain ZJLZS002 demonstrated impressive antibacterial efficacy, with rates of 54.2% and 48.8%, respectively, outperforming LR-A, which achieved rates of only 33.3% and 21.9%. This indicates that ZJLZS002 possessed higher resistance.

3.7. Amplification Results of SSR

Following amplification with ten SSR primer pairs (LD045, LD063, LD089, LD093, LD094, LD095, LD098, LD129, LD149, and LD157), capillary electropherograms revealed distinct fragment size profiles between ZJLZS002 and LR-A,, as displayed in Figure 7 and

Table 7. Comparison of amplified fragment sizes of ten primer pairs in ZJLZS002 and LR-A.

Primer Name	LR-A	ZJLZS002
LD045	171	(167, 169)
LD063	(288, 290)	281
LD089	189	192
LD093	169	162
LD094	181	158
LD095	217	200
LD098	286	(284, 299)
LD129	(172, 187)	(187, 190)
LD149	206	346
LD157	135	(142, 145)

. The amplified fragments of ZJLZS002 measured (167, 169), 281, 192, 162, 158, 200, (284, 299), (187, 190), 346, and (142, 145) bp, respectively. In contrast, LR-A produced fragments of 171, (288, 290), 189, 169, 181, 217, 286, (172, 187), 206, and 135 bp. These results demonstrate that the ten SSR markers effectively differentiate LR-A from ZJLZS002 based on their polymorphic fragment sizes.

3.8. Results of Intermediate Test

In contrast to LR-A, ZJLZS002 exhibited a higher yield and biological efficiency. There was a significant disparity in the bottom diameter and single fruit mass (p < 0.05), with ZJLZS002 having a bottom diameter of 16.47 ± 0.53 mm, compared to LR-A’s 10.93 ± 1.18 mm. Similarly, the single fruit mass of ZJLZS002 was 15.77 ± 0.95 g, whereas LR-A’s was 11.5 ± 0.78 g. Notably, significant differences (p < 0.05) were also observed in the stipe length, upper diameter, and yield. Specifically, the stipe length of ZJLZS002 was 9.63 ± 0.49 cm, compared to LR-A’s 10.9 ± 0.4 cm; the upper diameter was 10.38 ± 0.48 mm, while LR-A’s was 7.87 ± 1.27 mm; and the yield was 380 ± 3.6 g, compared to LR-A’s 345.7 ± 13.9 g. Although the growth period of ZJLZS002 was 2 days shorter than that of LR-A, this discrepancy was not statistically significant, nor was the discrepancy in cap size (

Table 8. Biological efficiencies of ZJLZS002 and LR-A in intermediate test.

Strain	Growth Period /Day	Stipe Characters			Cap Diameter/mm	Single Fruit Mass/g	Yield /(g·bag−1)	Biological Efficiency/%
		Length /cm	Upper Diameter /mm	Bottom Diameter /mm
ZJLZS002	75.6 ± 1.3	9.63 ± 0.49 b	10.38 ± 0.48 a	16.47 ± 0.53 a	33.89 ± 0.67	15.77 ± 0.95 a	380 ± 3.6 a	95 a
LR-A	77.7 ± 1.5	10.9 ± 0.4 a	7.87 ± 1.27 b	10.93 ± 1.18 b	33.87 ± 1.72	11.5 ± 0.78 b	345.7 ± 13.9 b	86.4 b

Lowercase letters indicate significant difference at p < 0.05.

). Intermediate testing revealed that ZJLZS002 was characterized by its stability, shortened growth period, and the advantages of high yield and biological efficiency.

3.9. Results of Demonstration Cultivation

Compared to LR-A, as shown in

Table 9. Biological efficiencies of ZJLZS002 and LR-A in demonstration cultivation.

Strain	Biological Efficiency of the First Group/%		Biological Efficiency of the Second Group/%		Biological Efficiency of the Third Group/%
	1	2	1	2	1	2
ZJLZS002	95.17 ± 0.38 a	94.5 ± 1.64 a	94.75 ± 0.66 a	94.92 ± 0.63 a	94.67 ± 0.58 a	95.92 ± 1.26 a
LR-A	86.5 ± 3.19 b	86.5 ± 2.54 b	86.67 ± 3.15 b	86.58 ± 3.26 b	86.42 ± 2.98 b	87.42 ± 3.36 b

Lowercase letters indicate significant difference at p < 0.05.

, the biological efficiency of the ZJLZS002 groups 1, 2, and 3 were significantly higher (p < 0.05). Across different locations and multiple demonstration cultivations, the yield of ZJLZS002 increased by 8.31%.

The results of these trials for ZJLZS002 satisfy the criteria for new cultivar identification, as shown in Figure 8 and Figure 9. On 20 August 2024, ZJLZS002 passed the identification of non-major crop varieties in Yunnan Province by Yunnan Seed Management Station. The new cultivar was named ‘Zhongjunluronggu No. 1’, which successfully bred the first new variety of L. decastes suitable for industrial cultivation in China.

3.10. Nutrient Contents of ZJLZS002 Fruiting Bodies

The nutrient contents of ZJLZS002 are shown in

Table 10. Nutrient contents of ZJLZS002.

Item	ZJLZS002	Units	Item	ZJLZS002	Units
Asp	1.27	g/100 g	Protein	16.9	g/100 g
Thr	0.59	g/100 g	Crude fiber	24.1	%
Ser	0.63	g/100 g	Fat	1.6	g/100 g
Glu	1.65	g/100 g	Total reducing sugar	55.6	%
Pro	0.45	g/100 g	Polysaccharide	5.59	g/100 g
Gly	0.57	g/100 g	Mg	1217	mg/kg
Ala	0.64	g/100 g	Se	0.08	mg/kg
Val	0.58	g/100 g	Mn	9.09	mg/kg
Met	0.13	g/100 g	Zn	40.3	mg/kg
Ile	0.55	g/100 g	Fe	93.2	mg/kg
Leu	0.77	g/100 g	Ca	28.7	mg/kg
Tyr	0.43	g/100 g	K	4209	mg/100 g
Phe	0.54	g/100 g	Na	21.8	mg/100 g
His	0.33	g/100g	Cu	6.7	mg/kg
Lys	1.46	g/100 g	P	471	mg/100 g
Arg	0.72	g/100 g	VB2	1.37	mg/100 g
Total amino acids	11.31	g/100 g	VB6	4.57	mg/kg
Moisture	7.25	g/100 g	VB3	21	mg/100 g
Ash content	6.0	g/100 g	-	-	-

-: None.

.

4. Discussion

Lyophyllum decastes is known as Luronggu in China because of its striking resemblance to an antler [8]. It is also referred to as the fried chicken mushroom in Europe [41]. Unlike well-established cultivated mushrooms, such as Lentinula edodes [42] and Agaricus bisporus [43], which have centuries of domestication history, L. decastes has a relatively short cultivation timeline of approximately 50 years. It was first successfully cultivated outdoors in 1973 in Zhaotong city, China [44], and its industrial production was initially achieved in Japan in 1998 [7]. Subsequently, it has been widely cultivated in China. China’s successful year-round facility cultivation of this mushroom began in 2006. The establishment of its mechanized and industrial cultivation followed in 2013. The production went from less than 1 ton in 2013 to 193,131 tons in 2023 [7].

Germplasm resources constitute the foundation of the edible fungi industry. However, the seed industry of edible fungi remains an underrecognized sector in China’s agriculture [45]. Thus far, China’s edible fungi industry has been reliant on imported spawn, particularly for industrial varieties. Production heavily depends on foreign-sourced spawns: (1) wood-rotting fungi (e.g., L. decastes, Flammulina filiformis, L. edodes) predominantly originate from Japan and South Korea; (2) straw-rotting fungi (e.g., A. bisporus) are mainly sourced from Europe and North America [46]. Moreover, the domestic capacity for strain development remains limited, with varietal improvement programs operating below the optimal efficiency levels [40]. This has created a critical ‘jam neck’ in China’s edible fungi industry, affecting not only major varieties, such as L. edodes, A. bisporus, and F. velutipes [41,42], but also L. decastes.

Many studies on L. decastes breeding have been conducted globally, including selected breeding, monosporous hybridization, mutagenesis, and protoplasmic fusion. As the most conventional approach, selected breeding, also called natural selection, utilizes naturally occurring genetic variations within existing strains to develop new cultivars [28]. Although methodologically straightforward, this process is often time-intensive. Monosporous hybridization, a dominant breeding method, offers strong directional selection, operational feasibility, and hybrid vigor, albeit with significant time and labor requirements. While mutagenesis and protoplast fusion represent efficient breeding methodologies, they present significant challenges, including uncontrollable DNA mutation and genetic instability in the resulting strains. These limitations substantially complicate breeding efforts and strain stabilization [47].

Recently, SSR molecular markers have become indispensable tools for cultivar identification, population genetics studies, genetic mapping, and marker-assisted breeding. Their successful applications in edible fungi include Lentinula edodes [27], Auricularia heimuer [26], Agaricus bisporus [48], and Flammulina velutipes [49], but not L. decastes. Our investigation identified concerning homogeneity in the Chinese production of this mushroom. Most commercial strains are derived from the Japanese cultivar KX-HA092, and we confirm Tan Qi’s [17] findings of severe uniformity.

Analysis of the Japanese Plant Variety Registration System revealed 28 registered cultivars of L. decastes from 1998 to 2012. However, 21 cultivars are currently inactive (https://www.hinshu2.maff.go.jp/vips/cmm/apCMM110.aspx?MOSS=1, accessed on 28 April 2025). No novel cultivars have been reported in other countries, particularly in China, which exhibits a rich germplasm. In order to bridge the domestic research gap concerning new cultivars of L. decaste and meet industry demands, it is crucial to breed new strains and cultivars. We have successfully developed a novel cultivar utilizing selected breeding and SSR molecular markers for the first time. The cultivar demonstrates superior agronomic characteristics, including high resistance and yield (380 ± 3.6 g·bag⁻¹), a shortened growth period (75.6 ± 1.3 d), and stable traits. Concurrently, we have provided a feasible strategy: (1) precise strain identification, (2) intellectual property protection, and (3) varietal registration. These advancements will be critical for breaking through current production bottlenecks, ensuring seed source security and enhancing the global competitiveness of China’s edible fungi industry.

5. Conclusions

Utilizing selected breeding and SSR molecular markers, this study successfully developed an elite cultivar with significant commercial potential. The key findings include the following: (1) We collected 22 wild specimens from natural habitats and isolated and purified 8 strains with good mycelial growth. (2) after preliminary screening, we selected two stains (ZJLZS002 and ZJLZS003) based on their growth characteristics and fruiting potential. (3) We selected ZJLZS002 as the potential strain, which exhibited a shorter growth period (75.7 ± 1.5 d) and a higher yield (374.67 ± 8.50 g·bag⁻¹) compared to ZJLZS003 based on secondary screening. (4) The results of the antagonism reaction revealed an isolated antagonistic interaction between ZJLZS002 and LR-A. (5) Compared to RL-A, ZJLZS002 had higher resistance based on antibacterial testing. (6) The results of the intermediate test and demonstration cultivation indicate that ZJLZS002 was characterized by its stability, shortened growth period (75.6 ± 1.3 d), high yield (380 ± 3.6 g·bag⁻¹), and high biological efficiency (95%) compared to RL-A. (7) LR-A and ZJLZS002 were differentiated utilizing 10 pairs of SSR primers. (8) ZJLZS002 was officially certified as ‘Zhongjunluronggu No.1’ by the Yunnan Seed Management Station on 20 August 2024. We conclude that ZJLZS002 is well suited for industrial cultivation because of its high yield, shortened growth period, and stable traits.

6. Patents

The strain ZJLZS002 of Lyophyllum decastes, along with its application and SSR molecular marker primer, has the application number 202410492240.1. Application date: 23 April 2024.