Physiological and Molecular Analysis Revealed the Role of Silicon in Modulating Salinity Stress in Mung Bean
Abstract
:1. Introduction
2. Materials and Methods
2.1. Plant Materials and Growth Conditions
2.2. Experimental Design
2.3. Scanning Electron Microscope (SEM Analysis)
2.4. Determination of Total Soluble Protein, Total Soluble Sugars and Total Phenolic Content
2.5. Determination of Nitrate Reductase (NR) Activity
2.6. Estimation of Silicon Concentration
2.7. Determination of Hydrogen Peroxide (H2O2) and Superoxide (O2−) Content
2.8. Estimation of Antioxidants Enzyme Activity and Their Relative Staining
2.9. Native PAGE Profiling of Isozymes of Peroxidases’ Enzyme(s)
2.10. Protein Extraction and One-Dimensional Gel Electrophoresis (SDS-PAGE)
2.11. In-Gel Digestion of Protein Bands and Mass Spectrometer Analysis
2.12. RNA Isolation, cDNA Preparation, and RT-PCR
2.13. Statistical Analysis
3. Results
3.1. Effect of Salinity Stress on Structure and Opening/Closing of Stomatal Pore of Mung Bean Supplemented with Si
3.2. Effect of Salinity Stress on the Soluble Protein, Sugar, and Phenolic Content of Mung Bean Supplemented with Si
3.3. Effect of Salinity Stress on the Nitrate Reductase Activity of Mung Bean Supplemented with Si
3.4. Silicon Concentration in Leaves and Roots
3.5. Effects of Salinity Stress on Hydrogen Peroxide (H2O2) and Superoxide (O2−) Content of Mung Bean Supplemented with Si
3.6. Effect of Salinity Stress on Antioxidant Activity and Their Isozyme Patterns in Mung Bean Supplemented with Si
3.7. Effect of Salinity Stress on the Isozymes of Peroxidase Enzymes’ in Mung Bean Supplemented with Si
3.8. Changes in the Expression of Proteins
3.8.1. Proteins Related to Photosynthesis
3.8.2. Proteins Related to Metabolic Processes
3.8.3. Proteins Having Oxidoreductase Activity
3.8.4. Proteins Involved in Stress Response
3.8.5. Proteins Responsible for Transmembrane Transport
3.8.6. Proteins Involved in Signal Transduction
3.8.7. Proteins Involved in Metal Binding
3.8.8. Proteins Involved in Cell Division
3.8.9. Proteins Responsible for Transcription and DNA Replication
3.9. Expression of Si-Transporter and Salt-Responsive Genes
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Zhu, J.-K. Plant Salt Tolerance. Trends Plant Sci. 2001, 6, 66–71. [Google Scholar]
- Parida, A.K.; Das, A.B. Salt Tolerance and Salinity Effects on Plants: A Review. Ecotoxicol. Environ. Saf. 2005, 60, 324–349. [Google Scholar]
- Rehman, S.; Abbas, G.; Shahid, M.; Saqib, M.; Umer Farooq, A.B.; Hussain, M.; Murtaza, B.; Amjad, M.; Naeem, M.A.; Farooq, A. Effect of Salinity on Cadmium Tolerance, Ionic Homeostasis and Oxidative Stress Responses in Conocarpus Exposed to Cadmium Stress: Implications for Phytoremediation. Ecotoxicol. Environ. Saf. 2019, 171, 146–153. [Google Scholar]
- Huang, H.; Ullah, F.; Zhou, D.-X.; Yi, M.; Zhao, Y. Mechanisms of ROS Regulation of Plant Development and Stress Responses. Front. Plant Sci. 2019, 10, 800. [Google Scholar]
- Sehrawat, N.; Bhat, K.V.; Sairam, R.K.; Jaiwal, P.K. Identification of salt resistant wild relatives of mungbean (Vigna radiata (L.) Wilczek). Asian J. Plant Sci. Res. 2013, 3, 41–49. [Google Scholar]
- Dutta, P.; Bera, A.K. Effect of NaCl Salinity on Seed Germination and Seedling Growth of Mungbean Cultivars. Legume Res. Int. J. 2014, 37, 161. [Google Scholar]
- Al Murad, M.; Muneer, S. Silicon Supplementation Modulates Physiochemical Characteristics to Balance and Ameliorate Salinity Stress in Mung Bean. Front. Plant Sci. 2022, 13, 810991. [Google Scholar] [PubMed]
- Sehrawat, N.; Yadav, M.; Bhat, K.; Sairam, R.; Jaiwal, P. Effect of Salinity Stress on Mungbean [Vigna radiata (L.) Wilczek] during Consecutive Summer and Spring Seasons. J. Agric. Sci. Belgrade 2015, 60, 23–32. [Google Scholar]
- Muneer, S.; Kim, E.; Park, J.; Lee, J. Influence of Green, Red and Blue Light Emitting Diodes on Multiprotein Complex Proteins and Photosynthetic Activity under Different Light Intensities in Lettuce Leaves (Lactuca sativa L.). Int. J. Mol. Sci. 2014, 15, 4657–4670. [Google Scholar]
- Deshmukh, R.; Sonah, H.; Belanger, R.R. New Evidence Defining the Evolutionary Path of Aquaporins Regulating Silicon Uptake in Land Plants. J. Exp. Bot. 2020, 71, 6775–6788. [Google Scholar]
- Tripathi, D.K.; Singh, V.P.; Lux, A.; Vaculik, M. Silicon in Plant Biology: From Past to Present, and Future Challenges. J. Exp. Bot. 2020, 71, 6699–6702. [Google Scholar]
- Flam-Shepherd, R.; Huynh, W.Q.; Coskun, D.; Hamam, A.M.; Britto, D.T.; Kronzucker, H.J. Membrane Fluxes, Bypass Flows, and Sodium Stress in Rice: The Influence of Silicon. J. Exp. Bot. 2018, 69, 1679–1692. [Google Scholar]
- Ma, J.F.; Yamaji, N. Silicon Uptake and Accumulation in Higher Plants. Trends Plant Sci. 2006, 11, 392–397. [Google Scholar]
- Ma, J.F.; Yamaji, N.; Mitani, N.; Tamai, K.; Konishi, S.; Fujiwara, T.; Katsuhara, M.; Yano, M. An Efflux Transporter of Silicon in Rice. Nature 2007, 448, 209–212. [Google Scholar] [PubMed]
- Xiong, J.; Sun, Y.; Yang, Q.; Tian, H.; Zhang, H.; Liu, Y.; Chen, M. Proteomic Analysis of Early Salt Stress Responsive Proteins in Alfalfa Roots and Shoots. Proteome Sci. 2017, 15, 19. [Google Scholar]
- Chen, F.; Fang, P.; Peng, Y.; Zeng, W.; Zhao, X.; Ding, Y.; Zhuang, Z.; Gao, Q.; Ren, B. Comparative Proteomics of Salt-Tolerant and Salt-Sensitive Maize Inbred Lines to Reveal the Molecular Mechanism of Salt Tolerance. Int. J. Mol. Sci. 2019, 20, 4725. [Google Scholar] [PubMed] [Green Version]
- Benjamin, J.J.; Miras-Moreno, B.; Araniti, F.; Salehi, H.; Bernardo, L.; Parida, A.; Lucini, L. Proteomics Revealed Distinct Responses to Salinity between the Halophytes Suaeda maritima (L.) Dumort and Salicornia brachiata (Roxb). Plants 2020, 9, 227. [Google Scholar] [PubMed] [Green Version]
- Muneer, S.; Jeong, B.R. Proteomic Analysis of Salt-Stress Responsive Proteins in Roots of Tomato (Lycopersicon esculentum L.) Plants towards Silicon Efficiency. Plant Growth Regul. 2015, 77, 133–146. [Google Scholar]
- Manivannan, A.; Soundararajan, P.; Muneer, S.; Ko, C.H.; Jeong, B.R. Silicon Mitigates Salinity Stress by Regulating the Physiology, Antioxidant Enzyme Activities, and Protein Expression in Capsicum annuum ‘Bugwang’. BioMed Res. Int. 2016, 2016, 3076357. [Google Scholar]
- Soundararajan, P.; Manivannan, A.; Ko, C.H.; Muneer, S.; Jeong, B.R. Leaf Physiological and Proteomic Analysis to Elucidate Silicon Induced Adaptive Response under Salt Stress in Rosa hybrida ‘Rock Fire’. Int. J. Mol. Sci. 2017, 18, 1768. [Google Scholar]
- Ji, H.; Pardo, J.M.; Batelli, G.; Van Oosten, M.J.; Bressan, R.A.; Li, X. The Salt Overly Sensitive (SOS) Pathway: Established and Emerging Roles. Mol. Plant 2013, 6, 275–286. [Google Scholar]
- Sathee, L.; Sairam, R.K.; Chinnusamy, V.; Jha, S.K. Differential Transcript Abundance of Salt Overly Sensitive (SOS) Pathway Genes Is a Determinant of Salinity Stress Tolerance of Wheat. Acta Physiol. Plant. 2015, 37, 169. [Google Scholar]
- Yousefirad, S.; Soltanloo, H.; Ramezanpour, S.S.; Zaynalinezhad, K.; Shariati, V. Salt Oversensitivity Derived from Mutation Breeding Improves Salinity Tolerance in Barley via Ion Homeostasis. Biol. Plant. 2018, 62, 775–785. [Google Scholar]
- Nutan, K.K.; Kumar, G.; Singla-Pareek, S.L.; Pareek, A. A Salt Overly Sensitive Pathway Member from Brassica Juncea BjSOS3 Can Functionally Complement Atsos3 in Arabidopsis. Curr. Genom. 2017, 19, 60–69. [Google Scholar]
- Ma, D.-M.; Xu, W.-R.; Li, H.-W.; Jin, F.-X.; Guo, L.-N.; Wang, J.; Dai, H.-J.; Xu, X. Co-Expression of the Arabidopsis SOS Genes Enhances Salt Tolerance in Transgenic Tall Fescue (Festuca arundinacea Schreb.). Protoplasma 2013, 251, 219–231. [Google Scholar]
- Razi, K.; Bae, D.-W.; Muneer, S. Target-Based Physiological Modulations and Chloroplast Proteome Reveals a Drought Resilient Rootstock in Okra (Abelmoschus esculentus) Genotypes. Int. J. Mol. Sci. 2021, 22, 12996. [Google Scholar]
- Bradford, M.M. A Rapid and Sensitive Method for the Quantitation of Microgram Quantities of Protein Utilizing the Principle of Protein-Dye Binding. Anal. Biochem. 1976, 72, 248–254. [Google Scholar] [CrossRef]
- Liu, H.; Fu, Y.; Hu, D.; Yu, J.; Liu, H. Effect of Green, Yellow and Purple Radiation on Biomass, Photosynthesis, Morphology and Soluble Sugar Content of Leafy Lettuce via Spectral Wavebands “Knock Out”. Sci. Hortic. 2018, 236, 10–17. [Google Scholar]
- Song, F.-L.; Gan, R.-Y.; Zhang, Y.; Xiao, Q.; Kuang, L.; Li, H.-B. Total Phenolic Contents and Antioxidant Capacities of Selected Chinese Medicinal Plants. Int. J. Mol. Sci. 2010, 11, 2362–2372. [Google Scholar]
- López-Serrano, L.; Canet-Sanchis, G.; Vuletin Selak, G.; Penella, C.; San Bautista, A.; López-Galarza, S.; Calatayud, Á. Pepper Rootstock and Scion Physiological Responses Under Drought Stress. Front. Plant Sci. 2019, 10, 38. [Google Scholar]
- Velikova, V.; Yordanov, I.; Edreva, A. Oxidative Stress and Some Antioxidant Systems in Acid Rain-Treated Bean Plants. Plant Sci. 2000, 151, 59–66. [Google Scholar]
- Giannopolitis, C.N.; Ries, S.K. Superoxide Dismutases. Plant Physiol. 1977, 59, 309–314. [Google Scholar] [CrossRef] [PubMed]
- Nakano, Y.; Asada, K. Hydrogen peroxide is scavenged by ascorbate-specific peroxidase in spinach chloroplasts. Plant Cell Physiol. 1981, 22, 867–880. [Google Scholar]
- Pham, N.-T.; Kim, J.-G.; Jung, S. Differential Antioxidant Responses and Perturbed Porphyrin Biosynthesis after Exposure to Oxyfluorfen and Methyl Viologen in Oryza sativa. Int. J. Mol. Sci. 2015, 16, 16529–16544. [Google Scholar]
- Lee, B.-R.; Kim, K.-Y.; Jung, W.-J.; Avice, J.-C.; Ourry, A.; Kim, T.-H. Peroxidases and Lignification in Relation to the Intensity of Water-Deficit Stress in White Clover (Trifolium repens L.). J. Exp. Bot. 2007, 58, 1271–1279. [Google Scholar]
- Muneer, S.; Jeong, H.K.; Park, Y.G.; Jeong, B.R. Proteomic Analysis of Aphid-Resistant and -Sensitive Rose (Rosa hybrida) Cultivars at Two Developmental Stages. Proteomes 2018, 6, 25. [Google Scholar]
- Muneer, S.; Soundararajan, P.; Jeong, B.R. Proteomic and Antioxidant Analysis Elucidates the Underlying Mechanism of Tolerance to Hyperhydricity Stress in In Vitro Shoot Cultures of Dianthus caryophyllus. J. Plant Growth Regul. 2016, 35, 667–679. [Google Scholar]
- Hedrich, R.; Shabala, S. Stomata in a Saline World. Curr. Opin. Plant Biol. 2018, 46, 87–95. [Google Scholar]
- Zhu, X.; Cao, Q.; Sun, L.; Yang, X.; Yang, W.; Zhang, H. Stomatal Conductance and Morphology of Arbuscular Mycorrhizal Wheat Plants Response to Elevated CO2 and NaCl Stress. Front. Plant Sci. 2018, 9, 1363. [Google Scholar]
- Piñero, M.C.; Houdusse, F.; Garcia-Mina, J.M.; Garnica, M.; del Amor, F.M. Regulation of Hormonal Responses of Sweet Pepper as Affected by Salinity and Elevated CO2concentration. Physiol. Plant. 2013, 151, 375–389. [Google Scholar] [PubMed]
- Gamage, D.; Thompson, M.; Sutherland, M.; Hirotsu, N.; Makino, A.; Seneweera, S. New Insights into the Cellular Mechanisms of Plant Growth at Elevated Atmospheric Carbon Dioxide. Plant Cell Environ. 2018, 41, 1233–1246. [Google Scholar] [PubMed]
- Liu, Y.; He, Z.; Xie, Y.; Su, L.; Zhang, R.; Wang, H.; Li, C.; Long, S. Drought Resistance Mechanisms of Phedimus aizoon L. Sci. Rep. 2021, 11, 13600. [Google Scholar] [CrossRef] [PubMed]
- Aouz, A.; Khan, I.; Chattha, M.B.; Ahmad, S.; Ali, M.; Ali, I.; Ali, A.; Alqahtani, F.M.; Hashem, M.; Albishi, T.S.; et al. Silicon Induces Heat and Salinity Tolerance in Wheat by Increasing Antioxidant Activities, Photosynthetic Activity, Nutrient Homeostasis, and Osmo-Protectant Synthesis. Plants 2023, 12, 2606. [Google Scholar]
- Akhter, M.S.; Noreen, S.; Ummara, U.; Aqeel, M.; Saleem, N.; Ahmed, M.M.; Mahmood, S.; Athar, H.-u.-R.; Alyemeni, M.N.; Kaushik, P.; et al. Silicon-Induced Mitigation of NaCl Stress in Barley (Hordeum vulgare L.), Associated with Enhanced Enzymatic and Non-Enzymatic Antioxidant Activities. Plants 2022, 11, 2379. [Google Scholar]
- El Moukhtari, A.; Carol, P.; Mouradi, M.; Savoure, A.; Farissi, M. Silicon Improves Physiological, Biochemical, and Morphological Adaptations of Alfalfa (Medicago sativa L.) during Salinity Stress. Symbiosis 2021, 85, 305–324. [Google Scholar]
- Farouk, S.; Elhindi, K.M.; Alotaibi, M.A. Silicon Supplementation Mitigates Salinity Stress on Ocimum basilicum L. via Improving Water Balance, Ion Homeostasis, and Antioxidant Defense System. Ecotoxicol. Environ. Saf. 2020, 206, 111396. [Google Scholar]
- Pinedo-Guerrero, Z.H.; Cadenas-Pliego, G.; Ortega-Ortiz, H.; González-Morales, S.; Benavides-Mendoza, A.; Valdés-Reyna, J.; Juárez-Maldonado, A. Form of Silica Improves Yield, Fruit Quality and Antioxidant Defense System of Tomato Plants under Salt Stress. Agriculture 2020, 10, 367. [Google Scholar]
- Laxa, M.; Liebthal, M.; Telman, W.; Chibani, K.; Dietz, K.-J. The Role of the Plant Antioxidant System in Drought Tolerance. Antioxidants 2019, 8, 94. [Google Scholar]
- Xu, G.; Fan, X.; Miller, A.J. Plant Nitrogen Assimilation and Use Efficiency. Annu. Rev. Plant Biol. 2012, 63, 153–182. [Google Scholar]
- Ahmad, S.; Wang, G.-Y.; Muhammad, I.; Chi, Y.-X.; Zeeshan, M.; Nasar, J.; Zhou, X.-B. Interactive Effects of Melatonin and Nitrogen Improve Drought Tolerance of Maize Seedlings by Regulating Growth and Physiochemical Attributes. Antioxidants 2022, 11, 359. [Google Scholar]
- Ashraf, M.; Shahzad, S.M.; Imtiaz, M.; Rizwan, M.S. Salinity Effects on Nitrogen Metabolism in Plants—Focusing on the Activities of Nitrogen Metabolizing Enzymes: A Review. J. Plant Nutr. 2018, 41, 1065–1081. [Google Scholar]
- Shao, Q.S.; Shu, S.; Du, J.; Xing, W.W.; Guo, S.R.; Sun, J. Effects of NaCl Stress on Nitrogen Metabolism of Cucumber Seedlings. Russ. J. Plant Physiol. 2015, 62, 638–646. [Google Scholar]
- Irani, S.; Todd, C.D. Ureide Metabolism under Abiotic Stress in Arabidopsis Thaliana. J. Plant Physiol. 2016, 199, 87–95. [Google Scholar] [PubMed]
- Cui, J.; Zhang, E.; Zhang, X.; Wang, Q. Silicon Alleviates Salinity Stress in Licorice (Glycyrrhiza uralensis) by Regulating Carbon and Nitrogen Metabolism. Sci. Rep. 2021, 11, 1115. [Google Scholar]
- Conceição, S.S.; de Oliveira Neto, C.F.; Marques, E.C.; Barbosa, A.V.C.; Galvão, J.R.; de Oliveira, T.B.; Okumura, R.S.; da Silva Martins, J.T.; Costa, T.C.; Gomes-Filho, E. Silicon Modulates the Activity of Antioxidant Enzymes and Nitrogen Compounds in Sunflower Plants under Salt Stress. Arch. Agron. Soil Sci. 2019, 65, 1237–1247. [Google Scholar]
- Zhu, Y.-X.; Xu, X.-B.; Hu, Y.-H.; Han, W.-H.; Yin, J.-L.; Li, H.-L.; Gong, H.-J. Silicon Improves Salt Tolerance by Increasing Root Water Uptake in Cucumis sativus L. Plant Cell Rep. 2015, 34, 1629–1646. [Google Scholar] [PubMed]
- Zhu, Z.; Wei, G.; Li, J.; Qian, Q.; Yu, J. Silicon Alleviates Salt Stress and Increases Antioxidant Enzymes Activity in Leaves of Salt-Stressed Cucumber (Cucumis sativus L.). Plant Sci. 2004, 167, 527–533. [Google Scholar]
- Alzahrani, Y.; Kuşvuran, A.; Alharby, H.F.; Kuşvuran, S.; Rady, M.M. The Defensive Role of Silicon in Wheat against Stress Conditions Induced by Drought, Salinity or Cadmium. Ecotoxicol. Environ. Saf. 2018, 154, 187–196. [Google Scholar]
- Shah, K.; Nahakpam, S. Heat Exposure Alters the Expression of SOD, POD, APX and CAT Isozymes and Mitigates Low Cadmium Toxicity in Seedlings of Sensitive and Tolerant Rice Cultivars. Plant Physiol. Biochem. 2012, 57, 106–113. [Google Scholar] [PubMed]
- Yousif, A.; Ali, A.; Eldeen, M.; Ibrahim, H.; Zhou, G.; Eltyb, N.; Nimir, A.; Mohammed, A.; Elsiddig, I.; Jiao, X.; et al. Gibberellic acid and nitrogen efficiently protect early seedlings growth stage from salt stress damage in Sorghum. Sci. Rep. 2021, 11, 6672. [Google Scholar]
- Singh, P.; Kumar, V.; Sharma, J.; Saini, S.; Sharma, P.; Kumar, S.; Sinhmar, Y.; Kumar, D.; Sharma, A. Silicon Supplementation Alleviates the Salinity Stress in Wheat Plants by Enhancing the Plant Water Status, Photosynthetic Pigments, Proline Content and Antioxidant Enzyme Activities. Plants 2022, 11, 2525. [Google Scholar]
- Abdelaal, K.A.A.; Mazrou, Y.S.A.; Hafez, Y.M. Silicon Foliar Application Mitigates Salt Stress in Sweet Pepper Plants by Enhancing Water Status, Photosynthesis, Antioxidant Enzyme Activity and Fruit Yield. Plants 2020, 9, 733. [Google Scholar] [PubMed]
- Shekari, F.; Abbasi, A.; Mustafavi, S.H. Effect of silicon and selenium on enzymatic changes and productivity of dill in saline condition. J. Saudi Soc. Agric. Sci. 2017, 16, 367–374. [Google Scholar]
- Alam, P.; Balawi, T.A.; Qadir, S.U.; Ahmad, P. Gibberellic Acid and Silicon Ameliorate NaCl Toxicity in Brassica juncea: Possible Involvement of Antioxidant System and Ascorbate-Glutathione Cycle. Plants 2023, 12, 1210. [Google Scholar]
- Moura, J.C.; Bonine, C.A.; de Oliveira Fernandes, V.J.; Dornelas, M.C.; Mazzafera, P. Abiotic and biotic stresses and changes in the lignin content and composition in plants. J. Integr. Plant Biol. 2010, 52, 360–376. [Google Scholar] [PubMed]
- Jbir, N.; Ammar, S.; Chaïbi, W.; Ayadi, A. PAL activity and ionic contents of two wheat species differing in their sensitivity to NaCl, in response to salt stress. J. Trace Microprobe Tech. 2001, 19, 447–450. [Google Scholar]
- Sanchez-Aguayo, I.; Rodriguez-Galan, J.M.; Garcia, R.; Torreblanca, J.; Pardo, J.M. Salt Stress Enhances Xylem Development and Expression of S-Adenosyl-l-Methionine Synthase in Lignifying Tissues of Tomato Plants. Planta 2004, 220, 278–285. [Google Scholar]
- Chaves, M.M.; Flexas, J.; Pinheiro, C. Photosynthesis under Drought and Salt Stress: Regulation Mechanisms from Whole Plant to Cell. Ann. Bot. 2008, 103, 551–560. [Google Scholar] [PubMed] [Green Version]
- Nwugo, C.C.; Huerta, A.J. The Effect of Silicon on the Leaf Proteome of Rice (Oryza sativa L.) Plants under Cadmium-Stress. J. Proteome Res. 2010, 10, 518–528. [Google Scholar]
- Lee, H.-J.; Park, O.K. Lipases Associated with Plant Defense against Pathogens. Plant Sci. 2019, 279, 51–58. [Google Scholar] [PubMed]
- Alscher, R.G. Role of Superoxide Dismutases (SODs) in Controlling Oxidative Stress in Plants. J. Exp. Bot. 2002, 53, 1331–1341. [Google Scholar] [CrossRef]
- Hanano, A.; Burcklen, M.; Flenet, M.; Ivancich, A.; Louwagie, M.; Garin, J.; Blée, E. Plant Seed Peroxygenase Is an Original Heme-Oxygenase with an EF-Hand Calcium Binding Motif. J. Biol. Chem. 2006, 281, 33140–33151. [Google Scholar]
- Kieffer, P.; Dommes, J.; Hoffmann, L.; Hausman, J.-F.; Renaut, J. Quantitative Changes in Protein Expression of Cadmium-Exposed Poplar Plants. Proteomics 2008, 8, 2514–2530. [Google Scholar] [PubMed]
- Bailey-Serres, J.; Voesenek, L.A.C.J. Flooding Stress: Acclimations and Genetic Diversity. Annu. Rev. Plant Biol. 2008, 59, 313–339. [Google Scholar]
- Chiu, J.; Dawes, I.W. Redox Control of Cell Proliferation. Trends Cell Biol. 2012, 22, 592–601. [Google Scholar] [CrossRef] [PubMed]
- Kozuleva, M.; Goss, T.; Twachtmann, M.; Rudi, K.; Trapka, J.; Selinski, J.; Ivanov, B.; Garapati, P.; Steinhoff, H.-J.; Hase, T.; et al. Ferredoxin: NADP(H) Oxidoreductase Abundance and Location Influences Redox Poise and Stress Tolerance. Plant Physiol. 2016, 172, 1480–1493. [Google Scholar]
- Tola, A.J.; Jaballi, A.; Germain, H.; Missihoun, T.D. Recent Development on Plant Aldehyde Dehydrogenase Enzymes and Their Functions in Plant Development and Stress Signaling. Genes 2020, 12, 51. [Google Scholar]
- Coskun, D.; Deshmukh, R.; Shivaraj, S.M.; Isenring, P.; Bélanger, R.R. Lsi2: A Black Box in Plant Silicon Transport. Plant Soil 2021, 466, 1–20. [Google Scholar] [PubMed]
- Bokor, B.; Bokorová, S.; Ondoš, S.; Švubová, R.; Lukačová, Z.; Hýblová, M.; Szemes, T.; Lux, A. Ionome and Expression Level of Si Transporter Genes (Lsi1, Lsi2, and Lsi6) Affected by Zn and Si Interaction in Maize. Environ. Sci. Pollut. Res. 2014, 22, 6800–6811. [Google Scholar] [CrossRef]
- Sun, H.; Duan, Y.; Qi, X.; Zhang, L.; Huo, H.; Gong, H. Isolation and Functional Characterization of CsLsi2, a Cucumber Silicon Efflux Transporter Gene. Ann. Bot. 2018, 122, 641–648. [Google Scholar]
- Hosseini, S.A.; Maillard, A.; Hajirezaei, M.R.; Ali, N.; Schwarzenberg, A.; Jamois, F.; Yvin, J.-C. Induction of Barley Silicon Transporter HvLsi1 and HvLsi2, Increased Silicon Concentration in the Shoot and Regulated Starch and ABA Homeostasis under Osmotic Stress and Concomitant Potassium Deficiency. Front. Plant Sci. 2017, 8, 1359. [Google Scholar] [CrossRef] [Green Version]
- Munns, R.; Tester, M. Mechanisms of Salinity Tolerance. Annu. Rev. Plant Biol. 2008, 59, 651–681. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Kumar, G.; Purty, R.S.; Sharma, M.P.; Singla-Pareek, S.L.; Pareek, A. Physiological Responses among Brassica Species under Salinity Stress Show Strong Correlation with Transcript Abundance for SOS Pathway-Related Genes. J. Plant Physiol. 2009, 166, 507–520. [Google Scholar] [PubMed]
- Shi, H.; Quintero, F.J.; Pardo, J.M.; Zhu, J.-K. The Putative Plasma Membrane Na+/H+ Antiporter SOS1 Controls Long-Distance Na+ Transport in Plants. Plant Cell 2002, 14, 465–477. [Google Scholar] [PubMed] [Green Version]
- Bosnic, P.; Bosnic, D.; Jasnic, J.; Nikolic, M. Silicon Mediates Sodium Transport and Partitioning in Maize under Moderate Salt Stress. Environ. Exp. Bot. 2018, 155, 681–687. [Google Scholar]
- Gupta, B.K.; Sahoo, K.K.; Anwar, K.; Nongpiur, R.C.; Deshmukh, R.; Pareek, A.; Singla-Pareek, S.L. Silicon Nutrition Stimulates Salt-Overly Sensitive (SOS) Pathway to Enhance Salinity Stress Tolerance and Yield in Rice. Plant Physiol. Biochem. 2021, 166, 593–604. [Google Scholar]
- Yang, Q.; Chen, Z.-Z.; Zhou, X.-F.; Yin, H.-B.; Li, X.; Xin, X.-F.; Hong, X.-H.; Zhu, J.-K.; Gong, Z. Overexpression of SOS (Salt Overly Sensitive) Genes Increases Salt Tolerance in Transgenic Arabidopsis. Mol. Plant 2009, 2, 22–31. [Google Scholar]
- Kim, J.H.; Nguyen, N.H.; Jeong, C.Y.; Nguyen, N.T.; Hong, S.-W.; Lee, H. Loss of the R2R3 MYB, AtMyb73, Causes Hyper-Induction of the SOS1 and SOS3 Genes in Response to High Salinity in Arabidopsis. J. Plant Physiol. 2013, 170, 1461–1465. [Google Scholar] [CrossRef]
- Ma, Y.; Wang, L.; Wang, J.; Zhong, Y.; Cheng, Z.-M. (Max) Isolation and Expression Analysis of Salt Overly Sensitive Gene Family in Grapevine (Vitis vinifera) in Response to Salt and PEG Stress. PLoS ONE 2019, 14, e0212666. [Google Scholar]
Gene | Forward Sequence (5′---------3′) | Reverse Sequence (5′---------3′) |
---|---|---|
Lsi-1 | ATGGAGAGTGAAGGAGGGAA | TTAGAGGGTAACACATTGTT |
Lsi-2 | CGATGACTTTGCCCATCGTG | GCAATATGAACCTCGTCCGC |
Lsi-3 | TATTTYTTCCTGGCCAACCT | TTAAGCTATAGATGAGGGGG |
SOS1 | GCCAGCTATAAGCTAAGCAC | GCAATCCCTAAAGCAAGACC |
SOS2 | GCATTCATCGTGCAGCATC | GTATAGTCTCGCCATCACCTC |
SOS3 | ACGAAGAATTTCAGCTCGC | TCACCTAACTCGATGACTCC |
Actin | ATCCTCCGTCTTGACCTTG | TGTCCGTCAGGCAACTCAT |
Band no. | Protein Name | Plant Species | Accession Number | Protein Score | Biological Function |
---|---|---|---|---|---|
1A | Fumarylacetoacetase | Cephalotus follicularis | A0A1Q3BBE1 | 28 | Metal ion binding, chaperone binding |
Uncharacterized protein | Apolygus lucorum | A0A6A4KDN9 | 26 | Integral component of membrane | |
Protein kinase domain-containing protein | Rhizophagus irregularis | U9V622 | 26 | ATP binding, protein kinase activity | |
1B | Ribulose bisphosphate carboxylase large chain | Alfaroa guanacastensis | A0A068L6A4 | 43 | Photorespiration, photosynthesis |
5B protein like protein | Arabidopsis thaliana | Q9SUZ2 | 30 | Stress response | |
DHA1 family multidrug resistance protein-like MFS transporter | Paenibacillus prosopidis | A0A368W0U8 | 29 | Transmembrane transport | |
1C | Ribulose bisphosphate carboxylase large chain | Soleirolia soleirolii | A0A0F7C9I4 | 101 | Photosynthesis |
Uracil permease | Paludibacterium purpuratum | A0A4R7BCH9 | 39 | Transmembrane transport | |
Putative metallothionein expression activator | Diaporthe ampelina | A0A0G2HMQ0 | 35 | Metal binding | |
1D | Ribulose bisphosphate carboxylase large chain | Trifolium repens | A0A023HPA0 | 186 | Photosynthesis |
Peptidyl-tRNA hydrolase | Glycomyces artemisiae | A0A2T0UIK1 | 45 | Translation | |
Flavodoxin | Eggerthella lenta | A0A369MMS0 | 42 | Metal binding | |
1E | Ribulose bisphosphate carboxylase large chain | Berchemia lineata | A0A7L8XJV8 | 223 | Photosynthesis |
Ribulose bisphosphate carboxylase large chain | Pycnarrhena cauliflora | B3FWZ0 | 223 | Photosynthesis | |
Ribulose bisphosphate carboxylase large chain | Soleirolia soleirolii | A0A0F7C9I4 | 193 | Photosynthesis | |
1F | Biosynthetic peptidoglycan transglycosylase | Xanthomonas arboricola | A0A7W9QLL5 | 30 | Peptidoglycan synthesis |
LRRNT_2 domain-containing protein | Quercus lobata | A0A7N2MTJ2 | 30 | Transmembrane transport | |
Cell division protein FtsQ | Aeromonas veronii | A0A6S4V1U8 | 29 | Cell division | |
1G | Ribulose bisphosphate carboxylase large chain | Agathis borneensis | Q9MVV3 | 61 | Photosynthesis |
Lysine-specific demethylase 3A | Capsicum chinense | A0A2G3CFW6 | 33 | Methylation | |
Glucose-1-phosphate adenylyl transferase | Rhodospirillaceae bacterium | A0A2E5LIM1 | 31 | Glycogen biosynthetic process | |
1H | Lysozyme | Enterobacter phage vB_EkoM5VN | A0A7I8HQY3 | 32 | Defense response, catabolic process |
Putative N-glycosyltransferase | Frankia alni | Q0RGF9 | 32 | Transferase activity | |
probable transcription factor KAN4 | Juglans regia | A0A2I4EQ27 | 31 | Transcription regulation | |
1I | Ribulose bisphosphate carboxylase small subunit | Arachis duranensis | A0A6P4D9J6 | 94 | Photosynthesis |
Uncharacterized protein | Marchantia polymorpha | A0A2R6WJ30 | 31 | NIL | |
Uncharacterized protein | Pseudocercospora fijiensis | M2ZM51 | 31 | NIL | |
2A | Ribulose bisphosphate carboxylase large chain | Trifolium repens | A0A023HPA0 | 39 | Photosynthesis |
Uncharacterized protein | Setaria italica | K4A228 | 32 | NIL | |
Endonuclease/exonuclease/phosphatase family metal-dependent hydrolase | Rhizobium pisi | A0A7W5BJJ3 | 27 | Endonuclease activity | |
2B | tRNA wybutosine-synthesizing protein 4 | Trichoderma arundinaceum | A0A395NCK0 | 38 | Endonuclease activity |
ABC-type branched-subunit amino acid transport system substrate-binding protein | Streptomyces sp. BK022 | A0A4Q7Z6F6 | 34 | Transmembrane transport | |
TPX2 domain-containing protein | Marchantia polymorpha subsp. ruderalis | A0A176W329 | 33 | Kinase activity, cell cycle/division | |
2C | Uncharacterized protein | Kribbella sp. VKM Ac-2527 | A0A4R6KBE5 | 35 | NIL |
Cellulase | Bosea sp. AK1 | A0A542B873 | 30 | Metabolic process | |
Multiple sugar transport system permease protein | Kribbella sp. VKM Ac-2569 | A0A4Q7QE40 | 29 | Transmembrane transport | |
2D | Ribulose bisphosphate carboxylase large chain | Kayea stylosa | Q8MCX9 | 213 | Photosynthesis |
Precorrin-2 dehydrogenase | Winogradskyella arenosi | A0A368ZJY7 | 53 | Oxidoreductase | |
Uncharacterized protein | Klebsormidium nitens | A0A1Y1HR37 | 47 | Transmembrane transport | |
Haemolysin activation/secretion protein | Cupriavidus plantarum | A0A316F4A6 | 43 | Protein transport | |
2E | Ribulose bisphosphate carboxylase large chain | Cornus eydeana | Q2TV61 | 143 | Photosynthesis |
Ribulose bisphosphate carboxylase large chain | Crossostylis grandiflora | A0ZQX2 | 120 | Photosynthesis | |
Acyltransferase | Tardiphaga robiniae | A0A7G6TUN4 | 41 | Transmembrane transport, transferase activity | |
2F | Uncharacterized protein | Salix brachista | A0A5N5L7N0 | 33 | Electron transport |
Peptide hydrolase | Trichoderma arundinaceum | A0A395NEC7 | 33 | Catabolic process | |
Shugoshin_C domain-containing protein | Kalanchoe fedtschenkoi | A0A7N0U758 | 33 | Cell cycle/division | |
2G | Ribulose bisphosphate carboxylase large chain | Aloe vera (Aloe) | Q6VW13 | 82 | Photosynthesis/photorespiration |
Nitronate monooxygenase | Paraburkholderia unamae | A0A328WWJ8 | 33 | Nitronate monooxygenase activity | |
3-deoxy-7-phosphoheptulonate synthase | Paenibacillus peoriae | A0A0K2F5Q8 | 30 | Metabolic process | |
2H | Superoxide dismutase | Phaseolus lunatus | Q3S614 | 46 | Stress response |
Histidine kinase | Massilia aurea | A0A7W9U5Y5 | 34 | Signaling, protein modification process | |
Positive regulator of purine utilization | Pyrenophora seminiperda CCB06 | A0A3M7MHM2 | 34 | Transcription, metal binding | |
2I | Ribulose bisphosphate carboxylase large chain | Kalanchoe fedtschenkoi | A0A7N0TKL3 | 141 | Photosynthesis/photorespiration |
UDP-N-acetylglucosamine transferase subunit ALG13 | Botryotinia fuckeliana | A0A384JFM8 | 30 | Glycosylation, metabolic process | |
2-keto-3-deoxy-L-fuconate dehydrogenase | Rhizobium sp. PP-F2F-G48 | A0A4R1X109 | 28 | Oxidoreductase | |
3A | Ribulose bisphosphate carboxylase large chain | Trifolium repens | A0A023HPA0 | 88 | Photosynthesis/photorespiration |
DUF4328 domain-containing protein | Streptomyces violarus | A0A7W4ZSR6 | 41 | Transmembrane transport | |
PAS domain S-box-containing protein | Mucilaginibacter sp. E4BP6 | A0A7Y9HYI9 | 38 | Signaling, kinase activity | |
3B | Fumarylacetoacetase | Cephalotus follicularis | A0A1Q3BBE1 | 26 | Catabolic process |
Protein kinase domain-containing protein | Phaeosphaeria nodorum | Q0UFQ8 | 26 | Transcription, phosphorylation | |
Uncharacterized protein | Prunus persica | A0A251QEC7 | 25 | Defense response | |
3C | Ribulose bisphosphate carboxylase large chain | Trifolium repens | A0A023HPA0 | 96 | Photosynthesis/photorespiration |
Ribulose bisphosphate carboxylase large chain | Spirodela polyrhiza | A0A0F7EWB6 | 96 | Photosynthesis/photorespiration | |
Ribulose bisphosphate carboxylase large chain | Cladopus austro-osumiensis | O03046 | 93 | Photosynthesis/photorespiration | |
3D | Ribulose bisphosphate carboxylase large chain | Vanilla planifolia | A0A0D3M9U3 | 151 | Photosynthesis/photorespiration |
Uncharacterized protein | Lactuca sativa | A0A2J6KPN6 | 33 | Protein auto phosphorylation | |
ATPase subunit of ABC transporter with duplicated ATPase domains | Rhizobium sp. BK049 | A0A7W5KML0 | 31 | ATP binding | |
3E | Uncharacterized protein | Chara braunii | A0A388KU15 | 31 | Polymerase activity, DNA integration |
ATP-binding protein | Raoultella ornithinolytica | A0A225U1S1 | 29 | ATP binding | |
Methyltransferase family protein | Cellulomonas sp. PhB143 | A0A3N2JFI2 | 29 | Methylation | |
3F | Chromosome partition protein Smc | Cohnella lupini | A0A3D9IW82 | 35 | DNA replication, chromosome condensation |
Long-chain acyl-CoA synthetase | Streptomyces sp. BK239 | A0A4Q7XQB8 | 34 | Aspartic-type endopeptidase activity | |
SOS response UmuD protein | Arthrobacter sp. SLBN-122 | A0A542G4S1 | 32 | SOS response, DNA repair, transcription | |
Diacylglycerol kinase iota | Aegilops tauschii | N1QUQ4 | 32 | Defense response | |
3G | Fructose-bisphosphatase | Brassica napus (Rape) | A0A078FJK5 | 45 | Metabolic process |
Putative phosphoketolase | Fusarium culmorum | A0A2T4H188 | 38 | Carbohydrate metabolic process | |
Ferredoxin-NADP reductase | Xanthomonas campestris | A0A7W6KYF2 | 34 | Oxidoreductase | |
3H | Superoxide dismutase | Glycine max | Q71UA1 | 60 | Stress response |
GntR family transcriptional regulator | Rathayibacter sp. PhB93 | A0A3N1NHP1 | 37 | Transcription | |
Putative phospho-2-dehydro-3-deoxyheptonate aldolase | Phaeomoniella chlamydospora | A0A0G2EP81 | 36 | Amino acid biosynthesis, metal binding | |
3I | Ribulose bisphosphate carboxylase small subunit | Arachis duranensis | A0A6P4D9J6 | 80 | Photosynthesis/photorespiration |
Uncharacterized protein | Punica granatum | A0A218W2T9 | 31 | Transcription | |
UDP-N-acetylglucosamine transferase subunit ALG13 | Botryotinia fuckeliana | A0A384JFM8 | 31 | Protein glycosylation, lipid metabolic process | |
6A | Ribulose bisphosphate carboxylase large chain | Psychotria sp. PSN 1 | D6C638 | 118 | Photosynthesis/photorespiration |
Putative oxidoreductase, NAD(P)-binding domain | Frankia alni | Q0RJX8 | 33 | Oxidoreductase | |
Phosphomethylpyrimidine synthase | Halomonas songnenensis | A0A2T0V5C0 | 31 | Metabolic process | |
6B | Signal recognition particle subunit SRP68 | Klebsormidium nitens | A0A1Y1IMJ0 | 34 | Transport |
Pseudouridine synthase | Azospirillum brasilense | A0A560AZY8 | 32 | Ribosome biogenesis | |
Histidine kinase | Pseudomonas putida | A0A7D6A9J0 | 31 | Kinase activity | |
6C | Alpha-mannosidase | Penicillium expansum | A0A0A2JQF2 | 32 | Metabolic process |
Cytochrome c domain-containing protein | Nitrospirillum amazonense | A0A560G155 | 31 | Metal binding | |
Ubiquitin-like domain-containing protein | Lupinus angustifolius | A0A1J7GL54 | 31 | Cell cycle | |
Peroxidase | Hibiscus syriacus | A0A6A3AV07 | 28 | Stress response | |
PNP_UDP_1 domain-containing protein | Fusarium poae | A0A1B8A859 | 27 | Metabolic process | |
6D | Ribulose bisphosphate carboxylase large chain | Trichocladus crinitus | O98531 | 226 | Photosynthesis/photorespiration |
Ribulose bisphosphate carboxylase large chain | Ceriops tagal | O20035 | 201 | Photosynthesis/photorespiration | |
Ribulose bisphosphate carboxylase large chain | Trifolium aureum | A0A023HQ08 | 196 | Photosynthesis/photorespiration | |
6E | Fructose-bisphosphatase | Brassica napus | A0A078FJK5 | 45 | Sucrose biosynthesis |
Ferredoxin-NADP reductase | Xanthomonas campestris | A0A7W6KYF2 | 34 | Oxidoreductase, metal binding | |
LacI family transcriptional regulator | Cohnella phaseoli | A0A3D9INY3 | 33 | Transcription | |
GDSL esterase/lipase | Noccaea caerulescens | A0A1J3D4B7 | 32 | Lipid metabolic process | |
6F | Fructose-bisphosphate aldolase | Spinacia oleracea | A0A0K9QFF9 | 86 | Glycolytic process |
GH43 family beta-xylosidase | Novosphingobium sp. PhB57 | A0A4R3T5L4 | 32 | Carbohydrate metabolic process | |
Thioesterase domain-containing protein | Microbispora sp. GKU 823 | A0A1V4EJK0 | 32 | Biosynthetic process | |
Protein kinase domain-containing protein | Jatropha curcas | A0A067L8H1 | 32 | Protein kinase activity, ATP binding | |
6G | Phosphoinositide 5-phosphatase | Penicillium italicum | A0A0A2KL89 | 39 | Lipid metabolic process |
Amidase domain-containing protein | Fusarium poae | A0A1B8AW33 | 39 | Oxidoreductase | |
SNF2 domain-containing protein | Bradyrhizobium huanghuaihaiense | A0A562QI78 | 36 | ATP binding, helicase activity | |
Acyl-CoA reductase-like NAD-dependent aldehyde dehydrogenase | Halomonas stenophila | A0A7W5EU67 | 36 | Oxidoreductase | |
6H | Superoxide dismutase | Phaseolus lunatus | Q3S614 | 95 | Stress response, metal ion binding |
Putative phospho-2-dehydro-3-deoxyheptonate aldolase | Phaeomoniella chlamydospora | A0A0G2EP81 | 32 | Amino acid biosynthesis | |
Formate dehydrogenase subunit alpha | Citrobacter freundii | A0A2S4Q6X5 | 31 | Formate metabolic process | |
Two-component system alkaline phosphatase synthesis response regulator PhoP | Staphylococcus sp. AtHG25 | A0A318R5E0 | 31 | Transcription | |
6I | Ribulose bisphosphate carboxylase small subunit | Arachis duranensis | A0A6P4D9J6 | 89 | Photosynthesis/photorespiration |
Epidermal patterning factor-like protein | Nicotiana tabacum | A0A1S3YWQ1 | 38 | Cell differentiation, developmental protein | |
Predicted protein | Hordeum vulgare | F2DSS8 | 32 | RNA catabolic process | |
7A | Ribulose bisphosphate carboxylase large chain | Phalaenopsis sp. SH-2010 | E0D9N8 | 146 | Photosynthesis/photorespiration |
CopA family copper-resistance protein | Sphingomonas sp. BK481 | A0A7W5SGK6 | 49 | Oxidoreductase | |
Protein TonB | Bacteroidales bacterium | A0A7Y5A3N0 | 34 | Protein transport | |
Replicative DNA helicase | Candidatus Xiphinematobacter | A0A0P0FJI7 | 34 | DNA replication | |
7B | Ribulose bisphosphate carboxylase large chain | Kayea stylosa | Q8MCX9 | 216 | Photosynthesis/photorespiration |
Ribulose bisphosphate carboxylase large chain | Trifolium aureum | A0A023HQ08 | 204 | Photosynthesis/photorespiration | |
Ribulose bisphosphate carboxylase large chain | Crossostylis grandiflora | A0ZQX2 | 204 | Photosynthesis/photorespiration | |
7C | Ribulose bisphosphate carboxylase large chain | Mucuna sp. SH-2010 | E0D986 | 263 | Photosynthesis/photorespiration |
Ribulose bisphosphate carboxylase large chain | Kayea stylosa | Q8MCX9 | 262 | Photosynthesis/photorespiration | |
Ribulose bisphosphate carboxylase large chain | Adenophora liliifolioides | H6VPA5 | 258 | Photosynthesis/photorespiration | |
7D | Cytochrome bo(3) ubiquinol oxidase subunit 1 | Pseudomonas putida | A0A059URU4 | 45 | Transmembrane Transport, respiration |
1-phosphatidylinositol 4-kinase | Cucurbita maxima | A0A6J1I6A0 | 43 | Lipid metabolic process, signal transduction | |
Protoporphyrinogen oxidase | Dothistroma septosporum | N1PK36 | 32 | Oxidoreductase | |
Rho-GAP domain-containing protein | Botryotinia fuckeliana | A0A384JQ00 | 30 | Signal transduction | |
7E | Uncharacterized protein | Sorghum bicolor | A0A1B6QGR0 | 37 | Transmembrane transport |
Histidine kinase | Cellulomonas cellasea | A0A7W4UJ46 | 37 | Signaling | |
Putative oxidoreductase | Clavibacter michiganensis | B0RF25 | 37 | Oxidoreductase | |
7F | Fructose-bisphosphate aldolase | Spinacia oleracea | A0A0K9QFF9 | 48 | Carbohydrate metabolic process |
Ferredoxin-NADP reductase | Xanthomonas campestris | A0A7W6KYF2 | 33 | Metal binding, oxidoreductase activity | |
tRNA(Ile)-lysidine synthetase | Setosphaeria turcica | R0JM12 | 31 | tRNA metabolic process | |
Cyclase family protein | Streptomyces sp. CAI-21 | A0A7Y6LZ28 | 29 | Amino acid metabolic process | |
7G | Peptidylprolyl isomerase | Micractinium conductrix | A0A2P6V266 | 33 | Isomerase activity |
Quinone oxidoreductase, putative | Colletotrichum orbiculare | N4V6N5 | 33 | Oxidoreductase | |
AAHS family benzoate transporter-like MFS transporter | Arthrobacter sp. SLBN-122 | A0A542G607 | 30 | Transmembrane transport | |
Protein translocase subunit SecE | Thermobifida cellulosilytica TB100 | A0A147KLB0 | 29 | Protein transport, translocation | |
7H | Precorrin-2 dehydrogenase | Winogradskyella arenosi | A0A368ZJY7 | 38 | Porphyrin biosynthesis, oxidoreductase |
Putative K(+)-stimulated pyrophosphate-energized sodium pump | Gemmatimonadales bacterium | A0A7Y4VZE7 | 37 | Sodium ion transport, metal binding | |
BHLH domain-containing protein | Physcomitrium patens | A0A2K1KTX7 | 36 | Transcription | |
2,5-diketo-D-gluconate reductase A | Microbacterium sp. SLBN-154 | A0A542N566 | 33 | Oxidoreductase | |
7I | Uncharacterized protein | Algoriphagus boseongensis | A0A4R6T7V4 | 43 | Transmembrane transport |
GntR family transcriptional regulator | Klebsiella quasipneumoniae | A0A2N4VV92 | 37 | Transcription | |
Cytochrome P450 | Mycobacterium sp. BK558 | A0A4Q7PXL0 | 37 | Oxidoreductase | |
TonB-dependent receptor plug domain-containing protein | Nitrospiraceae bacterium | A0A7Y4SCD5 | 33 | Transmembrane transport |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Al Murad, M.; Muneer, S. Physiological and Molecular Analysis Revealed the Role of Silicon in Modulating Salinity Stress in Mung Bean. Agriculture 2023, 13, 1493. https://doi.org/10.3390/agriculture13081493
Al Murad M, Muneer S. Physiological and Molecular Analysis Revealed the Role of Silicon in Modulating Salinity Stress in Mung Bean. Agriculture. 2023; 13(8):1493. https://doi.org/10.3390/agriculture13081493
Chicago/Turabian StyleAl Murad, Musa, and Sowbiya Muneer. 2023. "Physiological and Molecular Analysis Revealed the Role of Silicon in Modulating Salinity Stress in Mung Bean" Agriculture 13, no. 8: 1493. https://doi.org/10.3390/agriculture13081493
APA StyleAl Murad, M., & Muneer, S. (2023). Physiological and Molecular Analysis Revealed the Role of Silicon in Modulating Salinity Stress in Mung Bean. Agriculture, 13(8), 1493. https://doi.org/10.3390/agriculture13081493