Impact of Salinity, Elevated Temperature, and Their Interaction with the Photosynthetic Efficiency of Halophyte Crop Chenopodium quinoa Willd
Abstract
:1. Introduction
2. Materials and Methods
2.1. Plant Growth Conditions
2.2. Dry Biomass, Water, Ions, and MDA Contents
2.3. Activity of Cyclic Electron Transport of PSI and Efficiency of PSII
2.4. Western Blot Analysis
2.5. RNA Isolation and Quantitative Real Time (RT)-PCR
2.6. Statistical Analysis
3. Results
3.1. Biomass, Water, Na+, K+, and MDA Contents
3.2. Activity of Cyclic Electron Transport for PSI and Efficiency of PSII
3.3. Western Blot Analysis
3.4. Expression of Photosynthetic Genes
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Data Availability Statement
Conflicts of Interest
References
- Basu, S.; Kumar, A.; Benazir, I.; Kumar, G. Reassessing the role of ion homeostasis for improving salinity tolerance in crop plants. Physiol. Plant. 2021, 171, 502–519. [Google Scholar] [CrossRef]
- Ivushkin, K.; Bartholomeus, H.; Bregt, A.K.; Pulatov, A.; Kempen, B.; De Sousa, L. Global mapping of soil salinity change. Remote Sens. Environ. 2019, 231, 111260. [Google Scholar] [CrossRef]
- Shabala, S. Learning from halophytes: Physiological basis and strategies to improve abiotic stress tolerance in crops. Ann. Bot. 2013, 112, 1209–1221. [Google Scholar] [CrossRef]
- Solomon, B.D. Intergovernmental panel on climate change (IPCC). In Dictionary of Ecological Economics; Edward Elgar Publishing: Cheltenham, UK, 2023; p. 302. [Google Scholar] [CrossRef]
- Wahid, A.; Gelani, S.; Ashraf, M.; Foolad, M.R. Heat tolerance in plants: An overview. Environ. Exp. Bot. 2007, 61, 199–223. [Google Scholar] [CrossRef]
- Becker, V.I.; Goessling, J.W.; Duarte, B.; Caçador, I.; Liu, F.; Rosenqvist, E.; Jacobsen, S.-E. Combined effects of soil salinity and high temperature on photosynthesis and growth of quinoa plants (Chenopodium quinoa). Funct. Plant Biol. 2017, 44, 665–678. [Google Scholar] [CrossRef] [PubMed]
- Toderich, K.N.; Mamadrahimov, A.A.; Khaitov, B.B.; Karimov, A.A.; Soliev, A.A.; Nanduri, K.R.; Shuyskaya, E.V. Differential Impact of Salinity Stress on Seeds Minerals, Storage Proteins, Fatty Acids, and Squalene Composition of New Quinoa Genotype, Grown in Hyper-Arid Desert Environments. Front. Plant Sci. 2020, 11, 607102. [Google Scholar] [CrossRef] [PubMed]
- Hinojosa, L.; González, J.A.; Barrios-Masias, F.H.; Fuentes, F.; Murphy, K.M. Quinoa Abiotic Stress Responses: A Review. Plants 2018, 7, 106. [Google Scholar] [CrossRef] [Green Version]
- Abbas, G.; Areej, F.; Asad, S.A.; Saqib, M.; Anwar-ul-Haq, M.; Afzal, S.; Murtaza, B.; Amjad, M.; Naeem, M.A.; Akram, M.; et al. Differential Effect of Heat Stress on Drought and Salt Tolerance Potential of Quinoa Genotypes: A Physiological and Biochemical Investigation. Plants 2023, 12, 774. [Google Scholar] [CrossRef] [PubMed]
- Yang, A.; Akhtar, S.S.; Amjad, M.; Iqbal, S.; Jacobsen, S.-E. Growth and physiological responses of quinoa to drought and temperature stress. J. Agron. Crop Sci. 2016, 202, 445–453. [Google Scholar] [CrossRef]
- Ruiz, K.B.; Rapparini, F.; Bertazza, G.; Silva, H.; Torrigiani, P.; Biondi, S. Comparing salt-induced responses at the transcript level in a salares and coastal-lowlands landrace of quinoa (Chenopodium quinoa Willd). Environ. Exp. Bot. 2017, 139, 127–142. [Google Scholar] [CrossRef]
- Orsini, F.; Accorsi, M.; Gianquinto, G.; Dinelli, G.; Antognoni, F.; Carrasco, K.B.R.; Martinez, E.A.; Alnayef, M.; Marotti, I.; Bosi, S.; et al. Beyond the ionic and osmotic response to salinity in Chenopodium quinoa: Functional elements of successful halophytism. Funct. Plant Biol. 2011, 38, 818–831. [Google Scholar] [CrossRef]
- Manaa, A.; Goussi, R.; Derbali, W.; Cantamessa, S.; Abdelly, C.; Barbato, R. Salinity tolerance of quinoa (Chenopodium quinoa Willd) as assessed by chloroplast ultrastructure and photosynthetic performance. Environ. Exp. Bot. 2019, 162, 103–114. [Google Scholar] [CrossRef]
- Waqas, M.; Yaning, C.; Iqbal, H.; Shareef, M.; ur Rehman, H.; Bilal, H.M. Synergistic consequences of salinity and potassium deficiency in quinoa: Linking with stomatal patterning, ionic relations and oxidative metabolism. Plant Physiol. Biochem. 2021, 159, 17–27. [Google Scholar] [CrossRef]
- Shabala, L.; Mackay, A.; Tian, Y.; Jacobsen, S.E.; Zhou, D.; Shabala, S. Oxidative stress protection and stomatal patterning as components of salinity tolerance mechanism in quinoa (Chenopodium quinoa). Physiol. Plant. 2012, 146, 26–38. [Google Scholar] [CrossRef]
- Delatorre-Herrera, J.; Ruiz, K.B.; Pinto, M. The Importance of Non-Diffusional Factors in Determining Photosynthesis of Two Contrasting Quinoa Ecotypes (Chenopodium quinoa Willd.) Subjected to Salinity Conditions. Plants 2021, 10, 927. [Google Scholar] [CrossRef] [PubMed]
- Razzaghi, F.; Jacobsen, S.-E.; Jensen, C.R.; Andersen, M.N. Ionic and photosynthetic homeostasis in quinoa challenged by salinity and drought—Mechanisms of tolerance. Funct. Plant Biol. 2014, 42, 136–148. [Google Scholar] [CrossRef] [PubMed]
- Killi, D.; Haworth, M. Diffusive and Metabolic Constraints to Photosynthesis in Quinoa during Drought and Salt Stress. Plants 2017, 6, 49. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Allakhverdiev, S.I.; Kreslavski, V.D.; Fomina, I.R.; Los, D.A.; Klimov, V.V.; Mimuro, M.; Mohanty, P.; Carpentier, R. Inactivation and Repair of Photosynthetic Machinery under Heat Stress. In Photosynthesis: Overviews on Recent Progress and Future Perspective; IK International Publishing House Pvt. Ltd.: New Delhi, India, 2012; p. 189. [Google Scholar]
- Almeselmani, M.; Deshmukh, P.S.; Chinnusamy, V. Effects of prolonged high temperature stress on respiration, photosynthesis and gene expression in wheat (Triticum aestivum L.) varieties differing in their thermotolerance. Plant Stress 2012, 6, 25–32. [Google Scholar]
- Muhammad, I.; Shalmani, A.; Ali, M.; Yang, Q.-H.; Ahmad, H.; Li, F.B. Mechanisms Regulating the Dynamics of Photosynthesis Under Abiotic Stresses. Front. Plant Sci. 2021, 11, 615942. [Google Scholar] [CrossRef]
- Yanhui, C.; Hongrui, W.; Beining, Z.; Shixing, G.; Zihan, W.; Yue, W.; Huihui, Z.; Guangyu, S. Elevated air temperature damage to photosynthetic apparatus alleviated by enhanced cyclic electron flow around photosystem I in tobacco leaves. Ecotoxicol. Environ. Saf. 2020, 204, 111136. [Google Scholar] [CrossRef]
- Fan, D.Y.; Fitzpatrick, D.; Oguchi, R.; Ma, W.; Kou, J.; Chow, W.S. Obstacles in the quantification of the cyclic electron flux around photosystem I in leaves of C3 plants. Photosynth. Res. 2016, 129, 239–251. [Google Scholar] [CrossRef]
- Lu, J.; Yin, Z.; Lu, T.; Yang, X.; Wang, F.; Qi, M.; Li, T.; Liu, Y. Cyclic electron flow modulate the linear electron flow and reactive oxygen species in tomato leaves under high temperature. Plant Sci. 2020, 292, 110387. [Google Scholar] [CrossRef]
- Sonoike, K. Photoinhibition of photosystem I. Physiol. Plant. 2011, 142, 56–64. [Google Scholar] [CrossRef]
- Munekage, Y.; Hashimoto, M.; Miyake, C.; Tomizawa, K.I.; Endo, T.; Tasaka, M.; Shikanai, T. Cyclic electron flow around photosystem I is essential for photosynthesis. Nature 2004, 429, 579–582. [Google Scholar] [CrossRef] [PubMed]
- Shikanai, T. Cyclic electron transport around photosystem I: Genetic approaches. Annu. Rev. Plant Biol. 2007, 58, 199–217. [Google Scholar] [CrossRef] [PubMed]
- Yamori, W.; Shikanai, T. Physiological functions of cyclic electron transport around photosystem I in sustaining photosynthesis and plant growth. Annu. Rev. Plant Biol. 2016, 67, 81–106. [Google Scholar] [CrossRef] [PubMed]
- Ma, M.; Liu, Y.; Bai, C.; Yang, Y.; Sun, Z.; Liu, X.; Zhang, S.; Han, X.; Yong, J.W.H. The Physiological Functionality of PGR5/PGRL1-Dependent Cyclic Electron Transport in Sustaining Photosynthesis. Front. Plant Sci. 2021, 12, 702196. [Google Scholar] [CrossRef]
- Shikanai, T.; Yamamoto, H. Contribution of cyclic and pseudo-cyclic electron transport to the formation of proton motive force in chloroplasts. Mol. Plant 2017, 10, 20–29. [Google Scholar] [CrossRef] [Green Version]
- Wang, P.; Duan, W.; Takabayashi, A.; Endo, T.; Mi, H. Chloroplastic NAD(P)H dehydrogenase in tobacco leaves functions in alleviation of oxidative damage caused by temperature stress. Plant Physiol. 2006, 141, 465–474. [Google Scholar] [CrossRef] [Green Version]
- He, Y.; Yu, C.; Zhou, L.; Chen, Y.; Liu, A.; Jin, J.; Hong, J.; Qi, Y.; Jiang, D. Rubisco decrease is involved in chloroplast protrusion and Rubisco-containing body formation in soybean (Glycine max.) under salt stress. Plant Physiol. Biochem. 2014, 74, 118–124. [Google Scholar] [CrossRef]
- Yoshitake, Y.; Nakamura, S.; Shinozaki, D.; Izumi, M.; Yoshimoto, K.; Ohta, H.; Shimojima, M. RCB-mediated chlorophagy caused by oversupply of nitrogen suppresses phosphate-starvation stress in plants. Plant Physiol. 2021, 185, 318–330. [Google Scholar] [CrossRef] [PubMed]
- Jeanneau, M.; Vidal, J.; Gousset-Dupont, A.; Lebouteiller, B.; Hodges, M.; Gerentes, D.; Perez, P. Manipulating PEPC levels in plants. J. Exp. Bot. 2002, 53, 1837–1845. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- O’Leary, B.; Park, J.; Plaxton, W.C. The remarkable diversity of plant PEPC (phosphoenolpyruvate carboxylase): Recent insights into the physiological functions and post-translational controls of non-photosynthetic PEPCs. Biochem. J. 2011, 436, 15–34. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Eustis, A.; Murphy, K.M.; Barrios-Masias, F.H. Leaf Gas Exchange Performance of Ten Quinoa Genotypes under a Simulated HeatWave. Plants 2020, 9, 81. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Bunce, J. Thermal acclimation of the temperature dependence of the VCmax of Rubisco in quinoa. Photosynthetica 2018, 56, 1171–1176. [Google Scholar] [CrossRef]
- Mittler, R. Abiotic stress, the field environment and stress combination. Trends Plant Sci. 2006, 11, 15–19. [Google Scholar] [CrossRef]
- Hinojosa, L.; Matanguihan, J.B.; Murphy, K.M. Effect of high temperature on pollen morphology, plant growth and seed yield in quinoa (Chenopodium quinoa Willd.). J. Agron. Crop Sci. 2019, 205, 33–45. [Google Scholar] [CrossRef] [Green Version]
- Mamedi, A.; Afshari, R.T.; Sepahvand, N.A.; Oweyse, M. Evaluation of various temperatures on Quinoa plant seeds under salinity stress. Iran. J. Field Crop Sci. 2016, 46, Pe583–Pe589. [Google Scholar]
- Voronin, P.Y.; Maevskaya, S.N.; Nikolaeva, M.K. Physiological and molecular responses (Zea mays L.) plants to drought and rehydration. Photosynthetica 2019, 57, 850–856. [Google Scholar] [CrossRef] [Green Version]
- Shuyskaya, E.; Rakhmankulova, Z.; Prokofieva, M.; Saidova, L.; Toderich, K.; Voronin, P. Intensity and duration of salinity required to form adaptive response in C4 halophyte Kochia prostrata (L.) Shrad. Front. Plant Sci. 2022, 13, 955880. [Google Scholar] [CrossRef]
- Eisa, S.; Hussin, S.; Geissler, N.; Koyro, H.W. Effect of NaCl salinity on water relations, photosynthesis and chemical composition of Quinoa (Chenopodium quinoa Willd.) as a potential cash crop halophyte. Aust. J. Crop Sci. 2012, 6, 357–368. [Google Scholar]
- Talebnejad, R.; Sepaskhah, A.R. Physiological characteristics, gas exchange, and plant ion relations of quinoa to different saline groundwater depths and water salinity. Arch. Agron. Soil Sci. 2016, 62, 1347–1367. [Google Scholar] [CrossRef]
- Flowers, T.J.; Glenn, E.P.; Volkov, V. Could vesicular transport of Na+ and Cl– be a feature of salt tolerance in halophytes? Ann. Bot. 2019, 123, 1–18. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Okutani, S.; Hanke, G.T.; Satomi, Y.; Takao, T.; Kurisu, G.; Suzuki, A.; Hase, T. Three Maize Leaf Ferredoxin: NADPH Oxidoreductases Vary in Subchloroplast Location, Expression, and Interaction with Ferredoxin. Plant Physiol. 2005, 139, 1451–1459. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Mulo, P. Chloroplast-targeted ferredoxin-NADP(+) oxidoreductase (FNR): Structure, function and location. Biochim. Biophys. Acta Bioenerg. 2011, 1807, 927–934. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Zörb, C.; Herbst, R.; Forreiter, C.; Schubert, S. Short-term effects of salt exposure on the maize chloroplast protein pattern. Proteomics 2009, 9, 4209–4220. [Google Scholar] [CrossRef] [PubMed]
- Hasanuzzaman, M.; Bhuyan, M.H.M.B.; Nahar, K.; Hossain, M.S.; Al Mahmud, J.; Hossen, M.S.; Masud, A.A.C.; Moumita; Fujita, M. Potassium: A vital regulator of plant responses and tolerance to abiotic stresses. Agronomy 2018, 8, 31. [Google Scholar] [CrossRef] [Green Version]
- Azedo-Silva, J.; Osorio, J.; Fonseca, F.; Correia, M.J. Effects of soil drying and subsequent rewatering on the activity of nitrate reductase in roots and leaves of Helianthus annuus. Funct. Plant Biol. 2004, 31, 611–621. [Google Scholar] [CrossRef] [Green Version]
- Wen, X.; Qiu, N.; Lu, Q.; Lu, C. Enhanced thermotolerance of photosystem II in salt-adapted plants of the halophyte Artemisia anethifolia. Planta 2005, 220, 486–497. [Google Scholar] [CrossRef]
- Quiles, M.J. Stimulation of chlororespiration by heat and high light intensity in oat plants. Plant Cell Environ. 2006, 29, 1463–1470. [Google Scholar] [CrossRef]
- Kusnetsov, V.V. Chloroplasts: Structure and Expression of the Plastid Genome. Russ. J. Plant Physiol. 2018, 65, 465–476. [Google Scholar] [CrossRef]
- Rakhmankulova, Z.F.; Shuyskaya, E.V.; Prokofieva, M.Y.; Toderich, K.N.; Yamanaka, N.; Voronin, P.Y. The effect of elevated temperature on salt tolerance mechanism in C4 xero-halophyte Kochia prostrata. Russ. J. Plant Physiol. 2022, 69, 137. [Google Scholar] [CrossRef]
- Foyer, C.H.; Neukermans, J.; Queval, G.; Noctor, G.; Harbinson, J. Photosynthetic control of electron transport and the regulation of gene expression. J. Exp. Bot. 2012, 63, 1637–1661. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Pfannschmidt, T.; Liere, K. Redox regulation and modification of proteins controlling chloroplast gene expression. Antioxid. Redox Signal. 2005, 7, 607–618. [Google Scholar] [CrossRef] [PubMed]
- DalCorso, G.; Pesaresi, P.; Masiero, S.; Aseeva, E.; Schunemann, D.; Finazzi, G.; Joliot, P.; Barbato, R.; Leister, D. A complex containing PGRL1 and PGR5 is involved in the switch between linear and cyclic electron flow in Arabidopsis. Cell 2008, 132, 273–285. [Google Scholar] [CrossRef] [PubMed]
- Rumeau, D.; Peltier, G.; Cournac, L. Chlororespiration and cyclic electron flow around PSI during photosynthesis and plant stress response. Plant Cell Environ. 2007, 30, 1041–1051. [Google Scholar] [CrossRef]
Primer | Gene | Function | 5′–3′ Sequence |
---|---|---|---|
rbcL | LOC32958948 | Large subunit (L) Rubisco | TCACATGTAGCGGCAGTAGC AGCCGTTTATGCGTTGGAGA |
Ppc1 | LOC110691154 | PEPC isoform 1 | GGTTGCTGGGCATAAGGACT ATGCCAGCAGCAATACCCTT |
Ppc2 | LOC110737782 | PEPC isoform 2 | GGAGGTGGACCTACCCATCT CTCAAGAGTGGCAGCAGTGA |
psaA | LOC32958941 | Apoprotein A1 of photosystem I | GTGAGTAGGGTCGCTTAGCC TACCAGCGACTTGGAGGAGA |
psaB | LOC32958940 | Apoprotein A2 of photosystem I | GAACCGCGTGCATCTAAAGC GCCTGGCTGGTTAAATGCTG |
psbA | LOC32959011 | Protein D1 of photosystem II | AGACCCGGAAACAGGTTCAC ACCAGCACTGAAAACCGTCT |
FDI | LOC110699227 | Ferredoxin I protein (a LET participant) | GAGTTTGAGTGCCCGGATGA CTGGTCGAGAGTACCAGACG |
FDII | LOC110691003 | Ferredoxin II protein (a CET PSI participant) | GAGGGAATGGGGTGGACTTG CTTCAGCCATCTGCCCATCA |
FNR1 | LOC110694708 | Ferredoxin:NADP+ oxidoreductase | TATGCCAACGAACTGTGGGA TCCATTTGCTGCCAGCTTAC |
PGR5 | LOC110692940 | PGR5 protein, a key part of the main CET pathway of PSI | TCACAACCACAAGAGGAGCAA TCGCGTCCGGTGAGAATTAC |
NdhH | LOC32959000 | 49 kDa subunit of the NADH dehydrogenase in the second CET pathway of PSI | GGCCATTTCACCGATTCGTA GGCCCTATGCTACGAGCTTC |
UBQ10 | LOC110721034 | Ubiquitin 10 (reference gene) | CGAGCAGAAACAAGCCTAATCG GCGATTAATTTCCATGTTGTCCG |
b-Tubulin | LOC110711758 | b-tubulin (reference gene) | ACCGGAGAAGGTATGGACGA GTACTCTTCCTCATCGGCGG |
Parameters 1 | MS | ||
---|---|---|---|
NaCl | eTem | eTem + NaCl | |
DW | 2.292 *** | 0.004 | 0.310 * |
W | 5.414 | 40.897 *** | 3.433 |
Na+ | 8.007 *** | 4.891 *** | 6.344 *** |
K+ | 0.003 | 8.103 *** | 0.002 |
MDA | 7.993 * | 68.260 *** | 14.126 ** |
PSI | 1.818 | 3.367 | 0.501 |
Fv/Fm | 0.010 | 0.399 *** | 0.013 |
F′v/F′m | 0.022 | 1.021 *** | 0.024 |
rbcL | 0.962 | 4.255 *** | 3.895 *** |
psbA | 4.647 | 11.706 *** | 18.587 *** |
FDI | 0.012 | 3.443 *** | 3.571 *** |
FNR1 | 2.703 *** | 0.604 | 3.335 *** |
PGR5 | 0.403 | 0.772 | 1.751 ** |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Shuyskaya, E.; Rakhmankulova, Z.; Prokofieva, M.; Kazantseva, V.; Lunkova, N. Impact of Salinity, Elevated Temperature, and Their Interaction with the Photosynthetic Efficiency of Halophyte Crop Chenopodium quinoa Willd. Agriculture 2023, 13, 1198. https://doi.org/10.3390/agriculture13061198
Shuyskaya E, Rakhmankulova Z, Prokofieva M, Kazantseva V, Lunkova N. Impact of Salinity, Elevated Temperature, and Their Interaction with the Photosynthetic Efficiency of Halophyte Crop Chenopodium quinoa Willd. Agriculture. 2023; 13(6):1198. https://doi.org/10.3390/agriculture13061198
Chicago/Turabian StyleShuyskaya, Elena, Zulfira Rakhmankulova, Maria Prokofieva, Varvara Kazantseva, and Nina Lunkova. 2023. "Impact of Salinity, Elevated Temperature, and Their Interaction with the Photosynthetic Efficiency of Halophyte Crop Chenopodium quinoa Willd" Agriculture 13, no. 6: 1198. https://doi.org/10.3390/agriculture13061198
APA StyleShuyskaya, E., Rakhmankulova, Z., Prokofieva, M., Kazantseva, V., & Lunkova, N. (2023). Impact of Salinity, Elevated Temperature, and Their Interaction with the Photosynthetic Efficiency of Halophyte Crop Chenopodium quinoa Willd. Agriculture, 13(6), 1198. https://doi.org/10.3390/agriculture13061198