LED Light Irradiations Differentially Affect the Physiological Characteristics, Ginsenoside Content, and Expressions of Ginsenoside Biosynthetic Pathway Genes in Panax ginseng
Abstract
1. Introduction
2. Materials and Methods
2.1. Experimental Materials
2.2. Light Treatment
2.3. Determination of Chlorophyll Content of P. ginseng Leaves
2.4. Determination of Photosynthetic Parameters
2.5. Determination of Content of the Photosynthetic Products of P. ginseng
2.6. Determination of Total Saponin and Ginsenoside Content
2.7. Key Genes Involved in the Ginsenoside Synthesis Pathway
2.8. Statistical Analyses
3. Results
3.1. Fresh Weight and Dry Weight of P. ginseng Roots
3.2. The Photosynthetic Pigment Content of P. ginseng Leaves
3.3. The Photosynthetic Parameters of P. ginseng Leaves
3.4. The Chlorophyll Fluorescence Parameters of P. ginseng Leaves
3.5. The Photosynthate Content of P. ginseng Root and Leaves
3.6. Ginsenoside Content of P. ginseng Roots, Leaves, and Stems
3.7. PCA and Correlations between Physiological Indicators and Ginsenoside
3.8. Key Enzyme Gene Expression in the Ginsenoside Synthesis Pathway
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Li, X.; Chu, S.; Lin, M.; Gao, Y.; Liu, Y.; Yang, S.; Zhou, X.; Zhang, Y.; Hu, Y.; Wang, H.; et al. Anticancer property of ginsenoside Rh2 from ginseng. Eur. J. Med. Chem. 2020, 203, 112627. [Google Scholar] [CrossRef]
- Li, Z.; Kim, H.J.; Park, M.S.; Ji, G.E. Effects of fermented ginseng root and ginseng berry on obesity and lipid metabolism in mice fed a high-fat diet. J. Ginseng Res. 2018, 42, 312–319. [Google Scholar] [CrossRef] [PubMed]
- Ok, S.; Kang, J.S.; Kim, K.M. Testicular antioxidant mechanism of cultivated wild ginseng extracts. Mol. Cell. Toxicol. 2016, 12, 149–158. [Google Scholar] [CrossRef]
- Chen, G.L.; Li, H.J.; Gao, Y.G.; Zhang, L.X.; Zhao, Y. Flavored black ginseng exhibited antitumor activity via improving immune function and inducing apoptosis. Food Funct. 2017, 8, 1880–1889. [Google Scholar] [CrossRef] [PubMed]
- Irfan, M.; Kwak, Y.S.; Han, C.K.; Hyun, S.H.; Rhee, M.H. Adaptogenic effects of Panax ginseng on modulation of cardiovascular functions. J. Ginseng Res. 2020, 44, 538–543. [Google Scholar] [CrossRef] [PubMed]
- Han, S.K.; Joo, M.K.; Kim, J.K.; Jeung, W.; Kang, H.; Kim, D.H. Bifidobacteria-Fermented Red Ginseng and Its Constituents Ginsenoside Rd and Protopanaxatriol Alleviate Anxiety/Depression in Mice by the Amelioration of Gut Dysbiosis. Nutrients 2020, 12, 901. [Google Scholar] [CrossRef] [PubMed]
- Dong, L.M.; Wang, Y.; Lv, J.W.; Zhang, H.X.; Jiang, N.; Lu, C.; Xu, P.; Liu, X.M. Memory enhancement of fresh ginseng on deficits induced by chronic restraint stress in mice. Nutr. Neurosci. 2019, 22, 235–242. [Google Scholar] [CrossRef]
- Fan, H.; Li, K.; Yao, F.; Sun, L.; Liu, Y. Comparative transcriptome analyses on terpenoids metabolism in field- and mountain-cultivated ginseng roots. BMC Plant Biol. 2019, 19, 82. [Google Scholar] [CrossRef]
- Zhang, T.; Han, M.; Yang, L.M.; Han, Z.M.; Cheng, L.; Sun, Z.; Yang, L.L. The Effects of Environmental Factors on Ginsenoside Biosynthetic Enzyme Gene Expression and Saponin Abundance. Molecules 2019, 24, 14. [Google Scholar] [CrossRef]
- Zhang, T.; Chen, C.B.; Chen, Y.Q.; Zhang, Q.H.; Li, Q.; Qi, W.C. Changes in the Leaf Physiological Characteristics and Tissue-Specific Distribution of Ginsenosides in Panax ginseng During Flowering Stage Under Cold Stress. Front. Bioeng. Biotechnol. 2021, 9, 637324. [Google Scholar] [CrossRef]
- Eo, J.; Park, K.C. Effect of vermicompost application on root growth and ginsenoside content of Panax ginseng. J. Environ. Manag. 2019, 234, 458–463. [Google Scholar] [CrossRef] [PubMed]
- Kozlowska, W.; Matkowski, A.; Zielinska, S. Light Intensity and Temperature Effect on Salvia yangii (B. T. Drew) Metabolic Profile in vitro. Front. Plant Sci. 2022, 13, 888509. [Google Scholar] [CrossRef] [PubMed]
- van Gelderen, K.; Kang, C.; Pierik, R. Light Signaling, Root Development, and Plasticity. Plant Physiol. 2018, 176, 1049–1060. [Google Scholar] [CrossRef] [PubMed]
- Ilic, Z.S.; Fallik, E. Light quality manipulation improves vegetable quality at harvest and postharvest: A review. Environ. Exp. Bot. 2017, 139, 79–90. [Google Scholar] [CrossRef]
- Shafiq, I.; Hussain, S.; Raza, M.A.; Iqbal, N.; Ahsan Asghar, M.; Raza, A.; Fan, Y.F.; Mumtaz, M.; Shoaib, M.; Ansar, M.; et al. Crop photosynthetic response to light quality and light intensity. J. Integr. Agric. 2021, 20, 4–23. [Google Scholar] [CrossRef]
- Chiang, C.; Bankestad, D.; Hoch, G. Reaching Natural Growth: Light Quality Effects on Plant Performance in Indoor Growth Facilities. Plants 2020, 9, 1273. [Google Scholar] [CrossRef] [PubMed]
- Chen, X.L.; Yang, Q.C. Effects of intermittent light exposure with red and blue light emitting diodes on growth and carbohydrate accumulation of lettuce. Sci. Hortic. 2018, 234, 220–226. [Google Scholar] [CrossRef]
- Liscum, E.; Young, J.C.; Poff, K.L.; Hangarter, R.P. Genetic separation of phototropism and blue light inhibition of stem elongation. Plant Physiol. 1992, 100, 267–271. [Google Scholar] [CrossRef]
- Westbrook, A.S.; McAdam, S.A.M. Atavistic Stomatal Responses to Blue Light in Marsileaceae. Plant Physiol. 2020, 184, 1378–1388. [Google Scholar] [CrossRef]
- Boccaccini, A.; Legris, M.; Krahmer, J.; Allenbach-Petrolati, L.; Goyal, A.; Galvan-Ampudia, C.; Vernoux, T.; Karayekov, E.; Casal, J.J.; Fankhauser, C. Low Blue Light Enhances Phototropism by Releasing Cryptochrome1-Mediated Inhibition of PIF4 Expression. Plant Physiol. 2020, 183, 1780–1793. [Google Scholar] [CrossRef]
- Wang, X.; Wang, Q.; Han, Y.J.; Liu, Q.; Gu, L.F.; Yang, Z.H.; Su, J.; Liu, B.B.; Zuo, Z.C.; He, W.J.; et al. A CRY-BIC negative-feedback circuitry regulating blue light sensitivity of Arabidopsis. Plant J. 2017, 92, 426–436. [Google Scholar] [CrossRef] [PubMed]
- Li, X.P.; Manuel, J.; Slavens, S.; Crunkleton, D.W.; Johannes, T.W. Interactive effects of light quality and culturing temperature on algal cell size, biomass doubling time, protein content, and carbohydrate content. Appl. Microbiol. Biotechnol. 2021, 105, 587–597. [Google Scholar] [CrossRef] [PubMed]
- Johkan, M.; Shoji, K.; Goto, F.; Hahida, S.; Yoshihara, T. Effect of green light wavelength and intensity on photomorphogenesis and photosynthesis in Lactuca sativa. Environ. Exp. Bot. 2012, 75, 128–133. [Google Scholar] [CrossRef]
- Nishio, J.N. Why are higher plants green? Evolution of the higher plant photosynthetic pigment complement. Plant Cell Environ. 2010, 23, 539–548. [Google Scholar] [CrossRef]
- Cao, B.; Lv, X.; Chen, Z.; Xu, K. Supplementing green light under strong sunlight improves growth and functional ingredients of ginger (Zingiber officinale Rosc.) in summer. Ind. Crops Prod. 2021, 167, 113527. [Google Scholar] [CrossRef]
- Lopes, E.M.; Guimaraes-Dias, F.; Gama, T.; Macedo, A.L.; Valverde, A.L.; de Moraes, M.C.; de Aguiar-Dias, A.C.A.; Bizzo, H.R.; Alves-Ferreira, M.; Tavares, E.S.; et al. Artemisia annua L. and photoresponse: From artemisinin accumulation, volatile profile and anatomical modifications to gene expression. Plant Cell Rep. 2020, 39, 101–117. [Google Scholar] [CrossRef]
- Liu, Y.; Fang, S.; Yang, W.; Shang, X.; Fu, X. Light quality affects flavonoid production and related gene expression in Cyclocarya paliurus. J. Photochem. Photobiol. B 2018, 179, 66–73. [Google Scholar] [CrossRef]
- Ratan, Z.A.; Haidere, M.F.; Hong, Y.H.; Park, S.H.; Lee, J.O.; Lee, J.; Cho, J.Y. Pharmacological potential of ginseng and its major component ginsenosides. J. Ginseng Res. 2021, 45, 199–210. [Google Scholar] [CrossRef]
- Yang, W.Z.; Hu, Y.; Wu, W.Y.; Ye, M.; Guo, D.A. Saponins in the genus Panax L. (Araliaceae): A systematic review of their chemical diversity. Phytochemistry 2014, 106, 7–24. [Google Scholar] [CrossRef]
- Thimmappa, R.; Geisler, K.; Louveau, T.; O’Maille, P.; Osbourn, A. Triterpene biosynthesis in plants. Annu. Rev. Plant Biol. 2014, 65, 225–257. [Google Scholar] [CrossRef]
- Yang, J.L.; Hu, Z.F.; Zhang, T.T.; Gu, A.D.; Gong, T.; Zhu, P. Progress on the Studies of the Key Enzymes of Ginsenoside Biosynthesis. Molecules 2018, 23, 589. [Google Scholar] [CrossRef]
- Deng, B.; Zhang, P.; Ge, F.; Liu, D.Q.; Chen, C.Y. Enhancement of triterpenoid saponins biosynthesis in Panax notoginseng cells by co-overexpressions of 3-hydroxy-3-methylglutaryl CoA reductase and squalene synthase genes. Biochem. Eng. J. 2017, 122, 38–46. [Google Scholar] [CrossRef]
- Kim, T.D.; Han, J.Y.; Huh, G.H.; Choi, Y.E. Expression and Functional Characterization of Three Squalene Synthase Genes Associated with Saponin Biosynthesis in Panax ginseng. Plant Cell Physiol. 2011, 52, 125–137. [Google Scholar] [CrossRef]
- Lee, M.H.; Jeong, J.H.; Seo, J.W.; Shin, C.G.; Kim, Y.S.; In, J.G.; Yang, D.C.; Yi, J.S.; Choi, Y.E. Enhanced triterpene and phytosterol biosynthesis in Panax ginseng overexpressing squalene synthase gene. Plant Cell Physiol. 2004, 45, 976–984. [Google Scholar] [CrossRef]
- Xu, S.; Zhao, C.L.; Wen, G.S.; Zhang, H.L.; Zeng, X.L.; Liu, Z.J.; Xu, S.Z.; Lin, C. Longitudinal expression patterns of HMGR, FPS, SS, SE and DS and their correlations with saponin contents in green-purple transitional aerial stems of Panax notoginseng. Ind. Crops Prod. 2018, 119, 132–143. [Google Scholar] [CrossRef]
- Han, J.-Y.; Kim, H.-J.; Kwon, Y.-S.; Choi, Y.-E. The Cyt P450 Enzyme CYP716A47 Catalyzes the Formation of Protopanaxadiol from Dammarenediol-II During Ginsenoside Biosynthesis in Panax ginseng. Plant Cell Physiol. 2011, 52, 2062–2073. [Google Scholar] [CrossRef] [PubMed]
- Hou, M.; Wang, R.; Zhao, S.; Wang, Z. Ginsenosides in Panax genus and their biosynthesis. Acta Pharm. Sin. B 2021, 11, 1813–1834. [Google Scholar] [CrossRef] [PubMed]
- Porra, R.J.; Schafer, W.; Cmiel, E.; Katheder, I.; Scheer, H. The derivation of the formyl-group oxygen of chlorophyll b in higher plants from molecular oxygen. Achievement of high enrichment of the 7-formyl-group oxygen from 18O2 in greening maize leaves. Eur. J. Biochem. 1994, 219, 671–679. [Google Scholar] [CrossRef]
- Yang, L.; Zhao, Y.; Zhang, Q.; Cheng, L.; Han, M.; Ren, Y.; Yang, L. Effects of drought–re-watering–drought on the photosynthesis physiology and secondary metabolite production of Bupleurum chinense DC. Plant Cell Rep. 2019, 38, 1181–1197. [Google Scholar] [CrossRef] [PubMed]
- Kim, N.H.; Jayakodi, M.; Lee, S.C.; Choi, B.S.; Jang, W.; Lee, J.; Kim, H.H.; Waminal, N.E.; Lakshmanan, M.; van Nguyen, B.; et al. Genome and evolution of the shade-requiring medicinal herb Panax ginseng. Plant Biotechnol. J. 2018, 16, 1904–1917. [Google Scholar] [CrossRef]
- Ben-Yehuda, O.A.; Posener, E.; Ben-Yehuda, M.; Schuster, A.; Mu’alem, A. Ginseng: Market-Driven Memory Allocation. ACM Sigplan Not. 2014, 49, 41–52. [Google Scholar] [CrossRef]
- Teixeira, R.T. Distinct Responses to Light in Plants. Plants 2020, 9, 894. [Google Scholar] [CrossRef] [PubMed]
- Izzo, L.G.; Mele, B.H.; Vitale, L.; Vitale, E.; Arena, C. The role of monochromatic red and blue light in tomato early photomorphogenesis and photosynthetic traits. Environ. Exp. Bot. 2020, 179, 104195. [Google Scholar] [CrossRef]
- Di, Q.; Li, J.; Du, Y.; Wei, M.; Yang, F. Combination of Red and Blue Lights Improved the Growth and Development of Eggplant (Solanum melongena L.) Seedlings by Regulating Photosynthesis. J. Plant Growth Regul. 2020, 40, 1477–1492. [Google Scholar] [CrossRef]
- Aoki, S.; Toh, S.; Nakamichi, N.; Hayashi, Y.; Wang, Y.; Suzuki, T.; Tsuji, H.; Kinoshita, T. Regulation of stomatal opening and histone modification by photoperiod in Arabidopsis thaliana. Sci. Rep. 2019, 9, 10054. [Google Scholar] [CrossRef] [PubMed]
- Brodersen, C.R.; Vogelmann, T.C. Do changes in light direction affect absorption profiles in leaves? Funct. Plant Biol. 2010, 37, 403–412. [Google Scholar] [CrossRef]
- Terashima, I.; Fujita, T.; Inoue, T.; Chow, W.S.; Oguchi, R. Green Light Drives Leaf Photosynthesis More Efficiently than Red Light in Strong White Light: Revisiting the Enigmatic Question of Why Leaves are Green. Plant Cell Physiol. 2009, 50, 684–697. [Google Scholar] [CrossRef] [PubMed]
- Yu, W.; Liu, Y.; Song, L.; Jacobs, D.F.; Wu, J. Effect of Differential Light Quality on Morphology, Photosynthesis, and Antioxidant Enzyme Activity in Camptotheca acuminata Seedlings. J. Plant Growth Regul. 2016, 36, 148–160. [Google Scholar] [CrossRef]
- Wang, P.; Sun, X.; Li, C.; Wei, Z.W.; Liang, D.; Ma, F.W. Long-term exogenous application of melatonin delays drought-induced leaf senescence in apple. J. Pineal Res. 2013, 54, 292–302. [Google Scholar] [CrossRef]
- Wang, W.; Su, M.; Li, H.; Zeng, B.; Chang, Q.; Lai, Z. Effects of supplemental lighting with different light qualities on growth and secondary metabolite content of Anoectochilus roxburghii. PeerJ 2018, 6, e5274. [Google Scholar] [CrossRef]
- Sobhani Najafabadi, A.; Khanahmadi, M.; Ebrahimi, M.; Moradi, K.; Behroozi, P.; Noormohammadi, N. Effect of different quality of light on growth and production of secondary metabolites in adventitious root cultivation of Hypericum perforatum. Plant Signal. Behav. 2019, 14, 1640561. [Google Scholar] [CrossRef] [PubMed]
- Huang, L.; Zou, C.; Liu, Y.H.; Li, R.; Duan, W.Y.; Du, R.A.; Yang, W.M. Progress in the Synthesis and Modification on Ginsenosides. Mini-Rev. Org. Chem. 2018, 15, 444–458. [Google Scholar] [CrossRef]
- Sanchez, S.E.; Rugnone, M.L.; Kay, S.A. Light Perception: A Matter of Time. Mol. Plant 2020, 13, 363–385. [Google Scholar] [CrossRef] [PubMed]
- Fu, X.; Peng, B.; Hassani, D.; Xie, L.; Liu, H.; Li, Y.; Chen, T.; Liu, P.; Tang, Y.; Li, L.; et al. AaWRKY9 contributes to light- and jasmonate-mediated to regulate the biosynthesis of artemisinin in Artemisia annua. New Phytol. 2021, 231, 1858–1874. [Google Scholar] [CrossRef] [PubMed]
- Karimi, M.; Ahmadi, N.; Ebrahimi, M. Red LED light promotes biomass, flowering and secondary metabolites accumulation in hydroponically grown Hypericum perforatum L. (cv. Topas). Ind. Crops Prod. 2022, 175, 114239. [Google Scholar] [CrossRef]
Gene | Primer Sequence 5–′3′ |
---|---|
GAPDH | F: ATGGACCATCAGCAAAGGAC R: GGTAGCACTTTCCCAACAGC |
HMGR | F: TTGCGGGTCCATTGCTGCT R: CTCTGGTCATCCCATCTTTTA |
FPS | F: CAAGAAGCATTTCCGACAA R: CTCTCCTACAAGGGTGGTGA |
SS | F: GGACTTGTTGGATTAGGGTTG R: ACTGCCTTGGCTGAGTTTTC |
SE | F: ATGCTTTGAATATGCGCCATC R: CATGGAGATCGCGTAAAGGTC |
DS | F: ATAGGGCAATGATAAGGGGAG R: ACCGCCGTTGAGATTAGATG |
CYP716A47 | F: TCACCTTCGTTCTCAACTATC R: TCTTCCTCAAATCCTCCCAAT |
CYP716A52v2 | F: AGGAGCAAATGGAGATAG R: AACCGTTGTAGGTGAAAT |
CYP716A53v2 | F: ATCGGACAACGAGGCAGCAC R: GCCAACAGGCCAACTCAA |
Treatments | Chl a (mg/g) | Chl b (mg/g) | Carotenoid (mg/g) | Chl a/b | Total Chl (mg/g) |
---|---|---|---|---|---|
CK | 1.2 ± 0.05 b | 0.33 ± 0.02 b | 0.4 ± 0.01 bc | 3.44 ± 0.17 ab | 1.53 ± 0.03 b |
NL | 1.02 ± 0.06 c | 0.33 ± 0.01 b | 0.37 ± 0.02 cd | 3.14 ± 0.05 cd | 1.35 ± 0.07 c |
B | 1.37 ± 0.06 a | 0.39 ± 0.02 a | 0.47 ± 0.02 a | 3.52 ± 0.06 a | 1.75 ± 0.08 a |
R | 0.95 ± 0.07 c | 0.32 ± 0.03 b | 0.34 ± 0.02 d | 3.02 ± 0.1 d | 1.27 ± 0.09 c |
G | 1.31 ± 0.1 ab | 0.43 ± 0.05 a | 0.43 ± 0.02 b | 3.28 ± 0.13 bc | 1.74 ± 0.12 a |
Treatment | Soluble Sugar (mg/g) | Starch (mg/g) | Glucose (mg/g) | Sucrose (mg/g) | |
---|---|---|---|---|---|
Root | CK | 18.86 ± 1.62 a | 462.52 ± 5.11 bc | 0.21 ± 0.02 a | 17.45 ± 0.25 a |
NL | 19.61 ± 0.74 a | 371.54 ± 10.49 d | 0.13 ± 0.01 b | 15.77 ± 1.21 b | |
B | 18.96 ± 1.26 a | 477.46 ± 4.15 ab | 0.11 ± 0.01 b | 12.78 ± 0.61 c | |
R | 19.77 ± 0.7 a | 495.72 ± 5.49 a | 0.2 ± 0.02 a | 18.88 ± 1.11 a | |
G | 20.79 ± 2.99 a | 442.27 ± 26.95 c | 0.11 ± 0.01 b | 12.33 ± 0.43 c | |
Leaf | CK | 58.6 ± 0.85 c | 49.42 ± 3.52 c | 4.58 ± 0.15 b | 25.05 ± 1.43 a |
NL | 72.19 ± 3.86 a | 54.22 ± 1.86 bc | 4.24 ± 0.2 bc | 24.38 ± 0.77 a | |
B | 61.29 ± 2.13 bc | 58.2 ± 3.74 ab | 3.29 ± 0.31 d | 24.07 ± 0.78 a | |
R | 75.17 ± 1.01 a | 61.09 ± 0.63 a | 5.08 ± 0.16 a | 23.23 ± 1.24 a | |
G | 63.6 ± 3.5 b | 49.56 ± 3.04 c | 4.12 ± 0.3 c | 23.08 ± 0.46 a |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Di, P.; Sun, Z.; Cheng, L.; Han, M.; Yang, L.; Yang, L. LED Light Irradiations Differentially Affect the Physiological Characteristics, Ginsenoside Content, and Expressions of Ginsenoside Biosynthetic Pathway Genes in Panax ginseng. Agriculture 2023, 13, 807. https://doi.org/10.3390/agriculture13040807
Di P, Sun Z, Cheng L, Han M, Yang L, Yang L. LED Light Irradiations Differentially Affect the Physiological Characteristics, Ginsenoside Content, and Expressions of Ginsenoside Biosynthetic Pathway Genes in Panax ginseng. Agriculture. 2023; 13(4):807. https://doi.org/10.3390/agriculture13040807
Chicago/Turabian StyleDi, Ping, Zhuo Sun, Lin Cheng, Mei Han, Li Yang, and Limin Yang. 2023. "LED Light Irradiations Differentially Affect the Physiological Characteristics, Ginsenoside Content, and Expressions of Ginsenoside Biosynthetic Pathway Genes in Panax ginseng" Agriculture 13, no. 4: 807. https://doi.org/10.3390/agriculture13040807
APA StyleDi, P., Sun, Z., Cheng, L., Han, M., Yang, L., & Yang, L. (2023). LED Light Irradiations Differentially Affect the Physiological Characteristics, Ginsenoside Content, and Expressions of Ginsenoside Biosynthetic Pathway Genes in Panax ginseng. Agriculture, 13(4), 807. https://doi.org/10.3390/agriculture13040807