Adaptation and High Yield Performance of Honglian Type Hybrid Rice in Pakistan with Desirable Agricultural Traits
Abstract
1. Introduction
2. Materials and Methods
2.1. Plant Materials
2.2. Traits Measurement
2.3. Seed Morphological Traits
2.4. Principal Component Analysis, Variance and Correlation
2.5. NUYT and DUS Trials
2.6. DNA Extraction and Quality Analysis
2.7. DNA fingerprinting and PCR Analysis
2.8. Statistical Analysis
3. Results
3.1. In-house Yield Trials
3.2. Genetic Diversity Study of HonglianType Hybrid Rice
3.3. Principal Component Analysis (PCA) with Respect to Yield and Other Traits
3.4. DNA Analysis
4. Discussion
4.1. Genetic Studies and Characteristics of HonglianType Hybrid Rice
4.2. Correlation Studies
4.3. Principal Component Analysis (PCA) Studies
4.4. Honglian Type Hybrid Rice Research Importance and Future Prospects
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Seck, P.A.; Diagne, A.; Mohanty, S.; Wopereis, M.C. Crops that feed the world 7: Rice. Food Secur. 2012, 4, 7–24. [Google Scholar] [CrossRef] [Scilit]
- FAO. The Future of Food and Agriculture—Alternative Pathways to 2050; License: CCBY-NC-SA3.0IGO; FAO: Rome, Italy, 2018; 224p. [Google Scholar]
- Ram, S.G.; Thiruvengadam, V.; Vinod, K.K. Genetic diversity among cultivars, landraces and wild relatives of rice as revealed by microsatellite markers. J. Appl. Genet. 2007, 48, 337–345. [Google Scholar] [CrossRef] [Scilit]
- Khush, G. What it will take to Feed 5.0 Billion Rice consumers in 2030. Plant Mol. Biol. 2005, 59, 1–6. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ren, G.J.; Yan, L.A.; Xie, H.A. Retrospective and perspective on indica three-line hybrid rice breeding research in China. Chin. Sci. Bull. 2016, 61, 3748–3760. [Google Scholar] [CrossRef] [Scilit]
- Yang, Z.A. Retrospects and prospects on the development of japonica hybrid rice in the north of China. Acta Agron. Sin. 1998, 24, 840–846. [Google Scholar]
- Li, S.; Yang, D.; Zhu, Y. Characterization and use of male sterility in hybrid rice breeding. J. Integr. Plant Biol. 2007, 49, 791–804. [Google Scholar] [CrossRef] [Scilit]
- Zhang, S.; Haung, X.; Han, B. Understanding the genetic basis of rice heterosis: Advances and prospects. Crop J. 2021, 9, 688–692. [Google Scholar] [CrossRef] [Scilit]
- Verma, R.L.; Katara, J.L.; Sah, R.P.; Sarkar, S.; Azaharudin, T.P.; Patra, B.C.; Sahu, R.K.; Mohapatra, S.D.; Mukherjee, A.; Manish, K.; et al. CRMS 54A and CRMS 55A: Cytoplasmic male sterile lines with enhanced seed producibility. NRRI Newsl. Jan. March 2018, 39, 1–14. [Google Scholar]
- Takai, T.; Arai-Sanoh, Y.; Iwasawa, N.; Hayashi, T.; Yoshinaga, S.; Kondo, M. Comparative Mapping Suggests Repeated Selection of the Same Quantitative Trait Locus for High Leaf Photosynthesis Rate in Rice High-Yield Breeding Programs. Crop Sci. 2012, 52, 2649–2658. [Google Scholar] [CrossRef] [Scilit]
- Xie, F.; Zhang, J. Shanyou 63: An elite mega rice hybrid in China. Rice 2018, 11, 17. [Google Scholar] [CrossRef] [Scilit]
- Boyce, C.K.; Jung, E.L. Plant evolution and climate over geological timescales. Annu. Rev. Earth Planet. Sci. 2017, 45, 61–87. [Google Scholar] [CrossRef] [Scilit]
- Mittler, R.; Blumwald, E. Genetic engineering for modern agriculture: Challenges and perspectives. Annu. Rev. Plant Biol. 2010, 61, 443–462. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Madan, P.; Jagadish, S.; Craufurd, P.; Fitzgerald, M.; Lafarge, T.; Wheeler, T. Effect of elevated CO2 and high temperature on seed-set and grain quality of rice. J. Exp. Bot. 2012, 63, 3843–3852. [Google Scholar] [CrossRef] [Scilit]
- Mohammed, A.R.; Tarpley, L. Effects of high night temperature and spikelet position on yield-related parameters of rice (Oryza sativa L.) plants. Eur. J. Agron. 2010, 33, 117–123. [Google Scholar] [CrossRef] [Scilit]
- Morita, S.; Wada, H.; Matsue, Y. Countermeasures for heat damage in rice grain quality under climate change. Plant Prod. Sci. 2016, 19, 1–11. [Google Scholar] [CrossRef] [Scilit]
- Fitzgerald, M.A.; McCouch, S.R.; Hall, R.D. Not just a grain of rice: The quest for quality. Trends Plant Sci. 2009, 14, 133–139. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Miura, K.; Ashikari, M.; Matsuoka, M. The role of QTLs in the breeding of high-yielding rice. Trends Plant Sci. 2011, 16, 319–326. [Google Scholar] [CrossRef] [Scilit]
- Goff, S.A.; Ricke, D.; Lan, T.H.; Presting, G.; Wang, R.; Dunn, M.; Glazebrook, J.; Sessions, A.; Oeller, P.; Varma, H.; et al. A draft sequence of the rice genome (Oryza sativa L. ssp. japonica). Science 2002, 296, 92–100. [Google Scholar] [CrossRef] [Scilit]
- International Rice Genome Sequencing Project. The map-based sequence of the rice genome. Nature 2005, 436, 793–800. [Google Scholar] [CrossRef] [Scilit]
- Waddington, S.R.; Li, X.; Dixon, J.; Hyman, G.; De Vicente, M.C. Getting the focus right: Production constraints for six major food crops in Asian and African farming systems. Food. Secur. 2010, 2, 27–48. [Google Scholar] [CrossRef] [Scilit]
- Kamoshita, A.; Babu, R.C.; Boopathi, N.; Fukai, S. Phenotypic and genotypic analysis of drought-resistance traits for development of rice cultivars adapted to rainfed environments. Field Crops Res. 2008, 109, 1–23. [Google Scholar] [CrossRef] [Scilit]
- Vikram, P.; Swamy, B.P.M.; Dixit, S.; Trinidad, J.; Sta, M.T.; Cruz, P.C.; Maturan, M.; Amante, M.; Kumar, A. Linkages and interactions analysis of major effect drought grain yield QTLs in rice. PLoS ONE 2016, 11, e0151532. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Murray, M.G.; Thompson, W.F. Rapid isolation of high molecular weight plant DNA. Nucl. Acids Res. 1980, 8, 4321–4326. [Google Scholar] [CrossRef] [Scilit]
- Panaud, O.; Chen, X.; McCouch, S. Development of microsatellite markers and characterisation of simple sequence length polymorphism (SSLP) in rice (Oryza sativa L.). Mol. Gen. Gene 1996, 252, 597–607. [Google Scholar]
- MOA. Protocol for Identifcation of Rice Varieties-SSR Marker Method; NY/T 1433-2014; China Agriculture Press: Beijing, China, 2014. [Google Scholar]
- SAS Institute Inc. SAS® 9.2 Enhanced Logging Facilities; SAS Institute Inc.: Cary, NC, USA, 2008. [Google Scholar]
- Dutta, P.; Dutta, P.N.; Borua, P.K. Morphological Traits as Selection Indices in Rice: A Statistical View. Univ. J. Agric. Res. 2013, 1, 85–96. [Google Scholar]
- Konate, A.K.; Zongo, A.; Kam, H.; Sanni, A.; Audebert, A. Genetic variability and correlation analysis of rice (Oryza sativa L.) inbred lines based on agro-morphological traits. Afr. J. Agric. Res. 2016, 11, 3340–3346. [Google Scholar]
- Ogunbayo, S.A.; Sié, M.; Ojo, D.K.; Sanni, K.A.; Akinwale, M.G.; Toulou, B.; Shittu, A.; Idehen, E.O.; Popoola, A.R.; Daniel, I.O.; et al. Genetic variation and heritability of yield and related traits in promising rice genotypes (Oryza sativa L.). J. Plant Breed. Crop Sci. 2014, 6, 153–159. [Google Scholar]
- Paswan, S.K.; Sharma, V.; Singh, V.K.; Ahmad, A.; Deepak. Genetic Variability Studies for Yield and Related Attributes in Rice Genotypes (Oryza sativa L.). Res. J. Agric. Sci. 2019, 5, 750–752. [Google Scholar]
- Tiwari, D.N.; Tripathi, S.R.; Tripathi, M.P.; Khatri, N.; Bastola, B.R. Genetic Variability and Correlation Coefficients of Major Traits in Early Maturing Rice under Rainfed Lowland Environments of Nepal. Adv. Agric. 2019, 2019, 5975901. [Google Scholar] [CrossRef] [Scilit]
- Zhu, R.S.; Yu, J.H.; Ding, J.P. Research and utilization of honglian type hybrid rice. Hybrid Rice 2010, 25, 12–16. (In Chinese) [Google Scholar]
- Li, J.; Xin, Y.; Yuan, L. Hybrid Rice Technology Development, Ensuring China’s Food Security. In IFPRI Discussion Paper 00918; International Food Policy Research Institute: Washington, DC, USA, 2009; China National Hybrid Rice Research and Development Center: Changsha, China, 2009; Available online: www.ifpri.org/pubs/otherpubs.htm#dp (accessed on 30 October 2022).
- Rao, Y.; Li, Y.; Qian, Q. Recent progress on molecular breeding of rice in China. Plant Cell Rep. 2014, 33, 551–564. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Rout, D.; Jena, D.; Singh, V.; Kumar, M.; Arsode, P.; Singh, P.; Lalkatara, J.; Samantaray, S.; Verma, R. Hybrid Rice Research, Current Status and Prospects. In Recent Advances in Rice Reserach; IntechOpen: London, UK, 2020; Available online: https://www.intechopen.com/chapters/73489 (accessed on 30 October 2022). [CrossRef] [Scilit]
- Chen, L.K.; Yan, X.C.; Dai, J.H.; Chen, S.P.; Liu, Y.Z.; Wang, H.; Chen, Z.Q.; Guo, T. Significant association of the novel Rf4-targeted SNP marker with the restorer for WA-CMS in different rice backgrounds and its utilisation in molecular screening. J. Integr. Agric. 2017, 16, 2128–2135. [Google Scholar] [CrossRef] [Scilit]
- Tang, H.W.; Luo, D.P.; Zhou, D.G.; Zhang, Q.Y.; Tian, D.S.; Zheng, X.M.; Chen, L.T.; Liu, Y.G. The rice restorer Rf4 for wild-abortive cytoplasmic male sterility encodes a mitochondrial-localised PPR protein that functions in reduction of WA352 transcripts. Mol. Plant 2014, 7, 1497–1500. [Google Scholar] [CrossRef] [Scilit]
- Khatun, K.M.; Hanafi, M.M.; Yusop, M.R.; Wong, M.Y.; Salleh, F.M.; Ferdous, J. Genetic variation, heritability, and diversity analysis of upland rice (Oryza sativa L.) genotypes based on quantitative traits. BioMed Res. Inter. 2015, 2015, 290861. [Google Scholar]
- Hossain, S.; Haque, M.; Rahman, J. Genetic variability, correlation and path coefficient analysis of morphological traits in some extinct local Aman rice (Oryza sativa L). J. Rice. Res. 2015, 4, 1–6. [Google Scholar] [CrossRef]
- Girma, B.T.; Kitil, M.A.; Banje, D.G.; Biru, H.M.; Serbessa, T.B. Genetic variability study of yield and yield related traits in rice (Oryza sativa L.) genotypes. Adv. Crop Sci. Technol. 2018, 6, 381–387. [Google Scholar]
- Kamana, B.; Ankur, P.; Subarna, S.; Prasad, K.B.; Koshraj, U. Genetic variability, correlation and path analysis of rice genotypes in rainfed condition at Lamjung, Nepal. Russ. J. Agric. Socio Econ. Sci. 2019, 8, 274–280. [Google Scholar]
- Sharma, R.C.; Chaudhary, N.K.; Ojha, B.; Yadav, L.; Pandey, M.P.; Shrestha, S.M. Variation in rice landraces adapted to the lowlands and hills in Nepal. Plant Genet. Res. 2007, 5, 120–127. [Google Scholar] [CrossRef] [Scilit]
- Shahidullah, S.M.; Hanafi, M.M.; Ashrafuzzaman, M.; Ismail, M.R.; Salam, M.A. Phenological characters and genetic divergence in aromatic rices. Afr. J. Biotechnol. 2009, 8, 3199–3207. [Google Scholar]
- Sanni, K.; Fawole, I.; Guei, R.; Ojo, D.; Somado, E.; Tia, D.; Ogunbayo, S.; Sanchez, I. Geographical patterns of phenotypic diversity in Oryza sativa landraces of Côte d’Ivoire. Euphytica 2008, 160, 389–400. [Google Scholar] [CrossRef] [Scilit]
- Seetharam, K.; Thirumeni, S.; Paramasvum, K. Estimation of genetic diversity in rice (Oryza sativa L.) genotypes using SSR markers and morphological characters. Afr. J. Biotechnol. 2009, 8, 2050–2059. [Google Scholar]
- Dai, Z.; Lu, Q.; Luan, X.; Ouyang, L.; Guo, J.; Liang, J.; Zhu, H.; Wang, W.; Wang, S.; Zeng, R.; et al. Development of a platform for breeding by design of CMS restorer lines based on an SSSL library in rice (Oryza sativa L.). Breed. Sci. 2016, 66, 768–775. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Chen, R.; Feng, Z.; Zhang, X.; Song, Z.; Cai, D. A New Way of Rice Breeding: Polyploid Rice Breeding. Plants 2021, 10, 422. [Google Scholar] [CrossRef] [Scilit]
- Awad-Allah, M.M.A.; Elekhtyar, N.M.; El-Abd, M.A.-E.-M.; Abdelkader, M.F.M.; Mahmoud, M.H.; Mohamed, A.H.; El-Diasty, M.Z.; Said, M.M.; Shamseldin, S.A.M.; Abdein, M.A. Development of New Restorer Lines Carrying Some Restoring Fertility Genes with Flowering, Yield and Grains Quality Characteristics in Rice (Oryza sativa L.). Genes 2022, 13, 458. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Qian, Q.; Guo, L.; Smith, S.M.; Li, J. Breeding high-yield superior quality hybrid super rice by rational design. Natl. Sci. Rev. 2016, 3, 283–294. [Google Scholar] [CrossRef] [Scilit]
- Li, P.; Zhou, H.; Yang, H.; Xia, D.; Liu, R.; Sun, P.; Wang, Q.; Gao, G.; Zhang, Q.; Wang, G.; et al. Genome-Wide Association Studies Reveal the Genetic Basis of Fertility Restoration of CMS-WA and CMS-HL in xian/indica and aus Accessions of Rice (Oryza sativa L.). Rice 2020, 13, 1–12. [Google Scholar] [CrossRef] [Scilit]
- Gao, C. Genome engineering for crop improvement and future agriculture. Cell 2021, 184, 1621–1635. [Google Scholar] [CrossRef] [Scilit]
- Chen, K.; Wang, Y.; Zhang, R.; Zhang, H.; Gao, C. CRISPR/Cas genome editing and precision plant breeding in agriculture. Annu. Rev. Plant Biol. 2019, 70, 667–697. [Google Scholar] [CrossRef] [Scilit]
- Kumlehn, J.; Pietralla, J.; Hensel, G.; Pacher, M.; Puchta, H. The CRISPR/Cas revolution continues: From efficient gene editing for crop breeding to plant synthetic biology. J. Integr. Plant Biol. 2018, 60, 1127–1153. [Google Scholar] [CrossRef] [Scilit]
- Yu, H.; Lin, T.; Meng, X.; Du, H.; Zhang, J.; Liu, G.; Chen, M.; Jing, Y.; Kou, L.; Li, X.; et al. A route to de novo domestication of wild allotetraploid rice. Cell 2021, 184, 1156–1170. [Google Scholar] [CrossRef] [Scilit]
- Cheng, F.; Wu, J.; Cai, X.; Liang, J.; Freeling, M.; Wang, X. Gene retention, fractionation and subgenome differences in polyploid plants. Nat. Plants 2018, 4, 258–268. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Sattler, M.; Carvalho, C.; Clarindo, W. The polyploidy and its key role in plant breeding. Planta 2016, 243, 281–296. [Google Scholar] [CrossRef] [Scilit] [PubMed]






| S. No. | Primer Name | Chromosomal Location | Annealing Temp °C | Primer Sequence (5′–3′) | Fluorescence | Product Size | Nature of Polymorphism |
|---|---|---|---|---|---|---|---|
| 1 | RM-219 | 9 | 55 | F:cgtcggatgatgtaaagcct R:catatcggcattcgcctg | FAM | 194–215 | Polymorphic |
| 2 | RM-236 | 7 | 55 | F:cttacagagaaacggcatcg R:gctggtttgtttcaggttcg | VIC | 151–166 | Polymorphic |
| 3 | RM-274 | 5 | 55 | F:cctcgcttatgagagcttcg R:cttctccatcactcccatgg | V1C | 149–162 | Polymorphic |
| 4 | RM-253 | 6 | 55 | F:tccttcaagagtgcaaaacc R:gcattgtcatgtcgaagcc | PET | 133–142 | Polymorphic |
| 5 | RM-424 | 2 | 55 | F:tttgtggctcaccagttgag R:tggcgcattcatgtcatc | NED | 240–280 | Polymorphic |
| 6 | RM-567 | 4 | 55 | F:atcagggaaatcctgaaggg R:ggaaggagcaatcaccactg | PET | 248–260 | Polymorphic |
| 7 | RM-258 | 10 | 55 | F:tgctgtatgtagctcgcacc R:tggcctttaaagctgtcgc | FAM | 128–146 | Polymorphic |
| 8 | RM-481 | 7 | 55 | F:tagctagccgattgaatggc R: ctccacctcctatgttgttg | FAM | 146–165 | Polymorphic |
| 9 | RM-493 | 1 | 55 | F: tagctccaacaggatcgacc R:gtacgtaaacgcggaaggtg | VIC | 210–264 | Polymorphic |
| Sr. No | Variety Name | Origin | Average Yield tons/ha 2019 | Average Yield tons/ha 2020 | % Increase/Decrease With Check Variety 2019 | % Increase/Decrease With Check Variety 2020 |
|---|---|---|---|---|---|---|
| 1 | HP1 | China | 12.75 | 10.63 | +43.90% | +30.91% |
| 2 | HP2 | China | 12 | 10.83 | +35.44% | +33.37% |
| 3 | HP3 | China | 12.15 | 10.85 | +37.13% | +33.62% |
| 4 | HP4 | China | 9.98 | 10.10 | +12.64% | +24.38% |
| 5 | HP5 | China | 10.6 | 9.85 | +19.63% | +21.30% |
| 6 | HP6 | China | 10.22 | 10.5 | +15.34 | +29.31% |
| 7 | HLR006 | China | 8.14 | 8.10 | −8.12% | −0.24% |
| 8 | WR1906 | China | 9.81 | 10.2 | +10.72 | +25.61% |
| 9 | Guard53 | China | 9.91 | 10.25 | +11.85% | +26.23% |
| 10 | D121 | China | 10.40 | 10.35 | +17.38 | +27.46% |
| 11 | KSK133 | Pakistan | 8.86 | 8.12 | - | - |
| Adaptability Trials in the Year 2020 | |||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Sr. No | Variety | Length (mm) | Width (mm) | L/W ratio (mm) | Thickness (mm) | Stickiness | Curling % | Bursting % | C.G.L. (mm) | Brown Rice (gm) | Milled Rice (gm) | Head Rice Recovery % | Yield Kg/hac |
| 1 | HP1 | 7.01 | 2.04 | 3.44 | 1.82 | sticky | 2 | 6 | 10.2 | 81 | 77.3 | 53.8 | 8709 |
| 2 | HP2 | 6.73 | 2.06 | 3.27 | 1.74 | sticky | 5 | 16 | 9.8 | 80 | 75 | 53.3 | 8833 |
| 3 | HP3 | 6.8 | 2.11 | 3.22 | 1.76 | sticky | 2 | 4 | 10.3 | 84.4 | 79.4 | 61.2 | 9338 |
| 4 | D-121 | 6.72 | 1.98 | 3.4 | 1.75 | sticky | 4 | 7 | 10.8 | 80 | 73.3 | 56.4 | 9171 |
| 5 | Guard-53 | 6.9 | 2.08 | 3.32 | 1.77 | sticky | 3 | 8 | 10.3 | 81.6 | 74.5 | 62.3 | 8395 |
| Adaptability trials in the year 2021 | |||||||||||||
| Sr. No | Variety | Length (mm) | Width (mm) | L/W ratio (mm) | Thickness (mm) | Stickiness | Curling % | Bursting % | C.G.L. (mm) | Brown rice (gm) | Milled rice (gm) | Head rice recovery % | Yield Kg/hac |
| 1 | HP1 | 7.3 | 2.13 | 3.43 | 1.81 | sticky | 4 | 12 | 12.9 | 82.03 | 76.6 | 51.67 | 7863 |
| 2 | HP2 | 6.94 | 2.09 | 3.32 | 1.76 | sticky | 5 | 4 | 11.1 | 81 | 74.56 | 60 | 7288 |
| 3 | HP3 | 6.6 | 1.75 | 3.77 | 1.78 | sticky | 25 | 11 | 10.2 | 80.13 | 74.66 | 64.67 | 7387 |
| 4 | D-121 | 6.96 | 2.01 | 3.46 | 1.78 | sticky | 4 | 12 | 11.5 | 81.63 | 74.86 | 51 | 7518 |
| 5 | Guard-53 | 6.66 | 2.02 | 3.30 | 1.77 | sticky | 8 | 4 | 9.7 | 82.86 | 76.46 | 65.30 | 7341 |
| (1) | |||||||||||||
| Traits | PC | 2020 | 2021 | ||||
|---|---|---|---|---|---|---|---|
| Eigenvalue | Variation% | Cumulative % | Eigenvalue | Variation% | Cumulative % | ||
| Length | PC1 | 2.48 | 22.63 | 22.62 | 3.18 | 22.78 | 22.78 |
| Width | PC2 | 2.13 | 19.45 | 42.07 | 2.60 | 18.58 | 41.36 |
| Thickness | PC3 | 1.49 | 13.56 | 55.63 | 1.92 | 13.72 | 55.08 |
| L/W ratio | PC4 | 1.29 | 11.79 | 67.43 | 1.57 | 11.23 | 66.32 |
| Curling % | PC5 | 0.96 | 8.77 | 76.21 | 1.18 | 8.45 | 74.77 |
| Bursting % | PC6 | 0.71 | 6.46 | 82.67 | 1.03 | 7.38 | 82.16 |
| C.G.L (mm) | PC7 | 0.57 | 5.24 | 87.92 | 0.90 | 6.44 | 88.60 |
| Brown rice% | PC8 | 0.47 | 4.29 | 92.21 | 0.66 | 4.77 | 93.38 |
| Milled rice% | PC9 | 0.39 | 3.63 | 95.85 | 0.51 | 3.69 | 97.08 |
| Head rice% | PC10 | 0.26 | 2.42 | 98.27 | 0.40 | 2.88 | 99.97 |
| Yield/ha | PC11 | 0.18 | 1.72 | 100 | 0.003 | 0.026 | 100 |
| Variables | Length (mm) | Width (mm) | L/W Ratio | Thickness (mm) | Curling (%) | Bursting (%) | C.G. L (mm) | Brown Rice (%) | Milled Rice (%) | Head Rice (%) | Yield/ha |
|---|---|---|---|---|---|---|---|---|---|---|---|
| Length (mm) | 1.00 | ||||||||||
| Width (mm) | 0.0961 | 1.00 | |||||||||
| L/W Ratio | 0.5159 * | 0.2458 * | 1.00 | ||||||||
| Thickness (mm) | 0.3907 * | −0.2190 * | −0.2532 * | 1.00 | |||||||
| Curling (%) | −0.1223 | −0.0416 | 0.1757 | −0.3379 * | 1.00 | ||||||
| Bursting (%) | −0.1830 | −0.1154 | −0.1700 | −0.0676 | 0.3539 * | 1.00 | |||||
| C.G. L (mm) | 0.5027 * | 0.0173 | 0.2155 * | 0.4059 * | −0.2315 * | −0.1600 | 1.00 | ||||
| Brown Rice (%) | −0.0942 | −0.1156 | −0.0335 | 0.0936 | 0.0885 | 0.1505 | −0.1284 | 1.00 | |||
| Milled Rice (%) | −0.0687 | −0.2450 * | −0.1475 | 0.1706 | 0.0446 | −0.0940 | −0.0961 | 0.6637 * | 1.00 | ||
| Head Rice (%) | −0.2902 * | −0.1262 | −0.1737 | −0.0459 | −0.0626 | −0.1414 | −0.1488 | 0.4243 * | 0.4807 * | 1.00 | |
| Yield/ha | 0.0122 | −0.0263 | −0.2354 * | 0.3091 * | −0.0846 | −0.0175 | 0.1135 | 0.1474 | 0.1423 | −0.0296 | 1.00 |
| Variables | Length (mm) | Width (mm) | L/W Ratio | Thickness (mm) | Curling (%) | Bursting (%) | C.G. L (mm) | Brown Rice (%) | Milled Rice (%) | Head Rice (%) | Yield/ha |
|---|---|---|---|---|---|---|---|---|---|---|---|
| Length (mm) | 1.00 | ||||||||||
| Width (mm) | −0.6068 * | 1.00 | |||||||||
| L/W Ratio | −0.3201 * | 0.3054 * | 1.00 | ||||||||
| Thickness (mm) | −0.3201 * | 0.3051 * | 1.0000 * | 1.00 | |||||||
| Curling (%) | 0.0586 | 0.1062 | −0.1481 | −0.1482 | 1.00 | ||||||
| Bursting (%) | −0.0227 | 0.1679 * | −0.1625 | −0.1626 | 0.4136 * | 1.00 | |||||
| C.G. L (mm) | 0.0576 | −0.1179 | 0.0670 | 0.0670 | 0.1951 * | −0.8077 * | 1.00 | ||||
| Brown Rice (%) | 0.1666 | 0.0248 | −0.1328 | −0.1328 | 0.5975 * | 0.1447 | 0.2168 * | 1.00 | |||
| Milled Rice (%) | −0.1234 | 0.1154 | 0.1646 | 0.1646 | −0.1375 | −0.2631 * | 0.1943 * | −0.1055 | 1.00 | ||
| Head Rice (%) | 0.0471 | −0.0213 | −0.0600 | −0.0600 | −0.0176 | −0.1663 | 0.1665 | −0.0196 | 0.4282 * | 1.00 | |
| Yield/ha | −0.0831 | 0.0222 | 0.0193 | 0.0193 | 0.1981* | 0.2262* | −0.1145 | 0.0637 | −0.1348 | −0.0656 | 1.00 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Ashfaq, M.; Zhu, R.; Ali, M.; Xu, Z.; Rasheed, A.; Jamil, M.; Shakir, A.; Wu, X. Adaptation and High Yield Performance of Honglian Type Hybrid Rice in Pakistan with Desirable Agricultural Traits. Agriculture 2023, 13, 242. https://doi.org/10.3390/agriculture13020242
Ashfaq M, Zhu R, Ali M, Xu Z, Rasheed A, Jamil M, Shakir A, Wu X. Adaptation and High Yield Performance of Honglian Type Hybrid Rice in Pakistan with Desirable Agricultural Traits. Agriculture. 2023; 13(2):242. https://doi.org/10.3390/agriculture13020242
Chicago/Turabian StyleAshfaq, Muhammad, Renshan Zhu, Muhammad Ali, Zhiyong Xu, Abdul Rasheed, Muhammad Jamil, Adnan Shakir, and Xianting Wu. 2023. "Adaptation and High Yield Performance of Honglian Type Hybrid Rice in Pakistan with Desirable Agricultural Traits" Agriculture 13, no. 2: 242. https://doi.org/10.3390/agriculture13020242
APA StyleAshfaq, M., Zhu, R., Ali, M., Xu, Z., Rasheed, A., Jamil, M., Shakir, A., & Wu, X. (2023). Adaptation and High Yield Performance of Honglian Type Hybrid Rice in Pakistan with Desirable Agricultural Traits. Agriculture, 13(2), 242. https://doi.org/10.3390/agriculture13020242

