Validation of Molecular Markers of Barley Net Blotch Resistance Loci on Chromosome 3H for Marker-Assisted Selection

Abstract

The most widespread and harmful disease of barley is net form of net blotch caused by the ascomycete Pyrenophora teres f. teres Drechsler (Ptt). A cost effective and environmentally sustainable strategy for barley protection against Ptt is to develop barley cultivars possessing genetic resistance. In previous GWA analysis, we identified SNP-markers associated with a resistance locus on chromosome 3H in the interval of 45.82–54.53 cM. These SNPs have been described previously in the literature to be located within the same region of chromosome 3H. The aim of the study was to validate QTL markers controlling resistance to Ptt on chromosome 3H in this region by KASP genotyping in four F₂ populations of crosses between the resistant cultivars, Morex, Fox, and Zolo, and the accession, Local k-21578, with the susceptible barley cv. Gesine and in a doubled haploid (DH) population of Canadian Lake Shore (CLS)/Harrington. Eleven of fifteen studied markers showed high efficacy (97.5–100%) for co-segregation with resistance to Ptt in the DH population, CLS/Harrington. Three of these markers located at 54.53 cM and one at 51.27 cM were effective in two F₂ populations of crosses of Morex and Fox with susceptible cv. Gesine. These markers are also located close to each other on the physical map (442,203,921–443,119,491 bp). Apparently, in cultivars, CLS, Morex, and Fox, resistance to Ptt is determined by the same locus. Markers JHI-Hv50k-2016-166392 (47.1 cM, 112,536,071 bp), Clone ID 3255462_1 (51.63 cM, 363,531,898 bp), and Clone ID 3255462_2 (51.63 cM, 363,531,871 bp) showed high efficacy in the DH population and in the F₂ population, Local k-21578/Gesine. Apparently, at least two loci controlling Ptt resistance exist in the chromosome region of 47.0–54.3 cM: one at 46.0–48.44 cM and another at 51.27–54.8 cM. These regions were found to harbor several genes involved in important plant functions, including disease response and signaling pathways. Allele-specific PCR markers were developed based on the KASP assay data and tested on six resistant, two moderately resistant, and two susceptible barley genotypes. Four markers were found to be effective to differentiate susceptible and resistant barley genotypes. The KASP and allele-specific PCR markers associated with Ptt resistance on chromosome 3H will be useful for pyramiding resistance QTLs in barley marker-assisted selection.

1. Introduction

The most widespread and harmful disease of barley is net blotch caused by the ascomycete, Pyrenophora teres Drechsler. It occurs in all major barley-growing regions and yield losses on susceptible cultivars can reach up to 40% [1] The main hosts of Pyrenophora teres are barley (Hordeum vulare) and some wild Hordeum species; however, reports of infected wheat (Triticum aestivum) have increased in recent years [2,3,4,5,6]. Based on lesion type, this species was divided into the two forms, i.e., Pyrenophora teres f. teres Drechsler and P. teres f. maculate [1,7]. The two forms are very similar in their morphology but distinguishable based on foliar symptoms [7]. P. teres f. teres (Ptt) produces brown longitudinal and transverse striations, which appear as net-like lesions, after which the disease is named. P. teres f. maculate (Ptm) symptoms appear as brown-spotted lesions [8].

Ptt is the dominant form on the European territory of Russia; however, Ptm was found in the southern part (Krasnodar region) in 2011 [9] but is still not prevalent in this region. Annual surveys at the state cultivar testing plots in the northwest of Russia indicate that all barley cultivars registered in the State Register of Breeding Achievements are susceptible to net blotch [10]. The disease occurs epiphytotic in different agroclimatic zones of the European part of Russia once every three to four years [11].

Pyrenophora teres reproduces sexually, which leads to a high genetic variability and a high number of pathotypes within populations [12,13,14,15,16,17,18,19,20]. Many of the resistance QTLs identified so far are pathotype/race specific. Hence, identification of suitable resistance sources is an on-going task. A cost effective and environmentally sustainable strategy for barley protection against Ptt is to develop barley cultivars possessing genetic resistance. A high level of genetic protection of cereal crops against diseases is achieved by cultivating resistant cultivars that are genetically diverse. In this regard, the study of barley genetic resources for resistance to Ptt is an important task to provide breeders with donors of resistance. A prime approach to find new resistance genes and QTLs to Ptt were bi-parental-mapping procedures: more than 50 QTLs have been identified on all barley chromosomes providing resistance at seedling and adult plant stages [11,21,22,23,24,25,26,27,28,29,30,31,32,33,34,35]. Recently, genome-wide association studies (GWAS) have emerged, which are based on the identification of SNPs associated with the desired trait. GWAS has significantly expanded the genetic diversity of resistance donors to Ptt. The first studies of mapping barley resistance genes to Ptt by using GWAS were published in 2017. At present, the results of GWAS for Ptt resistance have identified more than 60 major genes and QTLs in barley collections consisting of several hundred to one and a half thousand individuals (7139 in total) [33,36,37,38,39,40,41,42,43]. In all studies using GWAS, the highest number of QTLs determining resistance to Ptt was found on chromosomes 3H and 6H (reviewed in [44]. Chromosome 3H harbors the major gene, Pt1, which was first described by Mode and Schaller [45] and later designated Rpt1 [46]. Cultivar Canadian Lake Shore was reported to possess two major resistance loci, Pt3 (Rpt3) on chromosome 2H and Pt2 (Rpt1) on chromosome 3H [45,46,47]. In previous studies, GWAS revealed a locus on chromosome 3H at 46.29–54.3 cM 390–443 Mbp (here and below, the genetic positions are aligned to the physical map of Masher 2021, MorexV3 genome [48]) significantly associated with resistance towards Ptt [41]. Additionally, in a bi-parental doubled haploid (DH) population generated from a cross between resistant cultivar, Canadian Lake Shore (CLS), and susceptible cultivar, Harrington, we identified a major QTL on chromosome 3H in the same region (46.18–53.26 cM, 364–392 Mbp) conferring resistance to Ptt [35]. This chromosome region was previously reported to be associated with net blotch resistance by Koladia et al. [33] (52.6–54.8 cM, 442–450 Mbp), Vatter et al. [37] (51.6 cM, physical position—NA), Wonneberger et al. [36] (−52.01–54.5 cM, 442–444 Mbp), and Rozanova et al. [40] (50.9–54.8 cM, 442 Mbp).

To date, marker-assisted selection (MAS) has been widely used in cereal crop breeding for resistance to obligate biotrophic pathogens, such as stem rust, brown and yellow rust, and powdery mildew [49,50,51,52]. Despite the achievements in the identification and mapping of resistance QTL to hemibiotrophic pathogens, the real use of the identified genes in practical breeding of cereal crops is hampered by the lack of reliable molecular markers (MM).

The use of high-density chips allows large-scale studies and, with GWAS, the identification of candidate SNPs. To validate a small number of SNPs, it is not economical to reuse multiplex technologies that generate from a hundred to over a million SNPs per cycle [53]. Kompetitive Allele Specific PCR (KASP) is one of the uniplex SNP-genotyping platforms that has evolved to be a global benchmark technology [53,54,55,56,57]. KASP is a homogeneous, fluorescence-based variant of polymerase chain reaction genotyping. It is based on allele-specific elongation of the oligonucleotide and transfer of fluorescence resonance energy for signal generation. It is cost-effective in applications and requires a small to moderate numbers of QTL markers [53].

The aim of the study was to validate QTL markers associated with resistance to Ptt on chromosome 3H in the region of 45.82–54.53 cM previously reported in the literature. In order to achieve this, known SNP markers were converted into KASP assays and validated in four segregating F₂ populations from crosses of varieties resistant and susceptible to Ptt and in a DH population (CLS/Harrington).

2. Materials and Methods

2.1. Plant Material

Four segregating populations from crosses of susceptible cultivar, Gesine, with Ptt-resistant cultivars, Morex (comprising of 95 F₂ plants), Fox (82 F₂ plants), Zolo (84 F₂ plants), and line Local (Ecuador) k-21578 (99 F₂ plants), were included in KASP genotyping. Resistance of these four cultivars was controlled by the locus on chromosome 3H in interval 46.29–54.3 cM, based on GWAS data [41]. Additionally, a DH population derived from a cross of the resistant cv. CLS and the susceptible cultivar, Harrington, in which the gene qPttCLS was previously mapped on chromosome 3H [35] was included as the control for KASP genotyping.

The parents of the crosses presented above were used to optimize PCR conditions. Additionally, two moderate resistant accessions, Local Turkey 7689 and S-328 Mexico 28671, and the resistant variety, Harbin k-19282, were included. In these accessions, the Ptt resistance locus on chromosome 3H at the same interval was identified via GWAS.

2.2. Pathogen Isolates and Culture Conditions

Ten additional Ptt single conidia isolates of different geographical origin were used to characterize the resistance of barley accessions (

Table 1. Origin of P. teres f. teres isolates.

Isolate	Origin	Barley Cultivar	Year
F18	Belarus, Zhodino	Fest	2017
S18	Russia, Krasnodar	Sprinter	2017
B18	Russia, Leningrad region	Tausen’	2016
V13	Russia, Leningrad region	Suzdalets	2015
Pr2	Russia, Far East region	Primorskij 207	2015
Germ7	Germany, Quedlinburg	unknown	2011
Czech11.1	Czech Republic, Lysice	unknown	2011
Can11	Canada, Alberta	Harrington	2010
SA7	South Africa, Bredasdorp	unknown	2017
Mor1	Morocco, Brachoua of Zaer region	Amalou	2017

).

Isolate F18 is avirulent on Morex, Fox, Zolo, and line Local (Ecuador) k-21578 and was used to study the co-segregation of resistance and molecular markers in the F₂ and DH populations.

Ptt isolates were grown on modified Chapek medium containing KCL—0.5 g, KH₂PO₄—0.5 g, MgSO₄—0.5 g, urea—1.2 g, lactose—20 g, agar-agar—20 g per 1 L of distilled water. Isolates were cultivated at room temperature under artificial light (exposure 3000 lx) at 16 h of light/8 h of dark for 10 days.

2.3. Fungal Preparation, Inoculation of Seedlings, and Disease Assessment

The Ptt cultures were flooded with distilled water containing 0.01% TWEEN 20 and conidia were harvested by adding sterile water to the Petri dish and scraping conidia with a sterile spatula. The conidia suspension was filtered through gauze. Conidia were counted with a hemocytometer, and the concentration was adjusted to 5000 conidia/mL for inoculation.

To evaluate the resistance of barley accessions to different Ptt isolates and for the analysis of segregation in F₂ populations, three seeds per accession or F₂ plant were grown in plastic containers (18 × 13 × 6 cm) for two to three weeks at 16–18 °C with alternating 12 h periods of light/darkness (exposure 5000 lx). Studies of resistance in barley accessions to each isolate were set up in three replications (three plants in each). When the second leaf was fully developed (BBCH 12–13), plants were spray-inoculated with the conidia suspension (approximately 0.3 mL/pot). Plants were then covered with plastic foil for 48 h to ensure 100% humidity. After incubation, plants were grown for 10–12 days at 20–22 °C and 70% humidity until symptoms were clearly visible.

Infection response type was assessed on the second leaf of each plant following the 10-point scale of Tekauz [58] in which a score of 1–4.9 corresponds to resistance and a score of 5–10 corresponds to susceptibility. Cultivars, Harrington and Gesine, were used as susceptible checks.

For KASP genotyping, 20 resistant and 20 susceptible plants of each F₂ and DH population were selected.

2.4. Development of KASP Markers

Positions of chosen markers were determined using the source BARLEYMAP (http://floresta.eead.csic.es/barleymap accessed on 16 February 2022) [59] where markers were assigned to their physical position on the current version of the MorexV3 genome [48] and their genetic position on POPSEQ_2017 map [60,61]. In total, thirteen polymorphic SNPs on chromosome 3H around the target areas in intervals 52.0–54.3 cM and 45.0–47.07 cM and three DArT-seq markers associated with net blotch resistance were selected. The localization in the genome of the identified SNPs was determined using the Ensembl Plants database (http://plants.ensembl.org/, accessed on 16 February 2022). When a marker was detected within a gene, the product encoded by this gene was determined using the UniProtKB database (https://www.uniprot.org/, accessed on 16 February 2022).

After the candidate SNPs were identified, the nucleotide sequences flanking the SNPs (50 bp on each side) were exported from the Essembl Plants database. Sequences containing candidate SNPs were used for the KASP assay primer design. Further KASP genotyping was performed by LGC Genomic (UK).

2.5. Testing the Diagnostic Value of SNP-Markers

The diagnostic value of tested co-segregating markers (%) was calculated using the following equation:

$$Diagnosticvalue=\frac{numberoflinesshowingcorrecttestresults}{totalnumberoftestresults}$$

2.6. Development of PCR Markers

For the development of a PCR marker based on the chosen SNPs, primers with an allele-specific nucleotide at the 3’end were constructed. The sequences flanking SNPs (500 bp on each side) were exported from the Ensembl Plants database. The UGENE program was used to design the primers [62].

PCR reactions were performed in a 25 μL-volume-containing reaction buffer with 2.5 mM MgCl₂, 0.2 mM of each dNTP, 15 pmol forward primer, 15 pmol reverse primer, 1 unit of Taq polymerase, and 40 ng of genomic DNA. PCR was carried out using the following cycling profiles: 4 min at 94 °C; 31 cycles of 45 s at 94 °C, 1 min at annealing temperature (64–68 °C, optimized for each marker), and 1 min at 72 °C, with a final extension step of 5 min at 72 °C. PCR products were separated by electrophoresis in 1.5% agarose gel.

3. Results

3.1. Resistance of Barley Cultivars and Accessions to Ptt Isolates

The resistance of accessions, previously resistant to two Ptt isolates and field conditions at three locations [41], including the resistant parents of the F₂ and DH populations were evaluated against eight Ptt isolates of different origin (

Table 2. Mean infection responses for ten barley genotypes after inoculation with P. teres f. teres isolates of different origin.

N	Barley Genotypes	Infection Responses (IRs) to Isolates
		F 18	S 18	B 18	V 13	Pr2	Germ 7	Cz 11.1	Can11	SA 7	Mor 1	Mean
1.	Gesine (susceptible) Germany	9	9	10	9	10	9	10	10	10	9	9.6
2.	Harrington, TR 306 (susceptible) Canada	10	9.8	10	7	10	7	9.3	9.7	8.8	7.8	8.9
3.	Local Turkey k-7689	7	8	8	5.8	3.7	4	5.3	5.8	4.5	6.2	5.8
4.	S-328 Mexico k-28671	9	7	8	7	6	6.5	3.8	7	7	7	6.8
5.	Morex (C.I.15773) k-26959	1.7	3.8	1	2	3	2	4	2	2	4	2.6
6.	Fox (C.I.9190, NFC 883) k-19182	1.7	2	1	2.1	2.8	2.8	2.5	6	5.5	3	2.9
7.	Zolo k-18552	1.5	3	1	1.4	3.7	6	1.7	3	2	7	3.1
8.	Local Ecuador k-21578	1	3	1	8	3	7	3.5	2.7	1.5	8.7	3.9
9.	Harbin (C.I. 4929) k-19282	4	5.3	2.1	2.1	4.3	7	1.8	2.5	2.3	3.5	3.5
10.	Canadian Lake Shore, (C.I. 2750) k-25282	1	2.5	3.3	3.3	3.2	5.5	1.3	2.3	2.3	2.5	2.7

Infection response type was assessed on the 10-point scale of Tekauz [58] IRs below five were considered resistant (R) IRs 5.0–6.9—moderately resistant (MR) and IRs seven and above were considered susceptible (S).

). Cv. Gesine and Harrington were included as susceptible parents of F₂ and DH populations. Cv. Morex was resistant to all studied isolates. Cv. CLS and Fox were susceptible to one isolate, cv. Zolo, and Harbin to two isolates, and barley accession Local k-21538 (Ecuador) to three isolates. Barley accession Local Turkey k-7689 was resistant to three isolates, moderately resistant to three isolates, and susceptible to four isolates. This data testify to the race-specific resistance of the studied cultivars and accessions. Accession S-328 Mexico k-28671 was susceptible to all but one of the isolates (Cz11.1).

3.2. Segregation Analysis

Infection response for parental lines to Ptt isolate F18 are shown in Figure 1. The frequency distributions observed in the DH and F₂ populations after inoculation with isolate F18 are shown in

Table 3. Frequency distribution of infection responses (IRs) in the CLS/Harrington DH population and F₂ populations from crosses of resistant and susceptible barley genotypes.

DH or F2 Population	IRs of Parents		Number of Resistant (R) and Susceptible (S) Plants		Genetic Ratio	Chi Square
	P1	P2	R	S
DH CLS/Harrington	1.0	10	20	21	1:1	0.02
F2 Morex/Gesine	1.7	10	71	24	3:1	0.003
F2 Fox/Gesine	1.7	9.0	46	36	3:1 9:7	15.62 0.000
F2 Zolo/Gesine	1.5	9.0	58	26	3:1	1.59
F2 k-21578/Gesine	1	9.0	66	33	3:1	3.67

IRs 1–4.9—resistant, 5.0–6.9—moderately resistant, 7–10—susceptible. P5% = 3.84 at 1 df.

and in Supplementary Figures S1–S5. The segregation ratios detected for the DH population, CLS/Harrington, and F₂ populations of Morex/Gesine, Zolo/Gesine, and k-21578/Gesine showed segregation ratios, which fit to a 1R:1S segregation in the DH population and a 3:1 in the F₂ populations. A two complementary gene model was found to be significant based on Chi-squared analysis in the segregating F₂ population of Fox/Gesine (Table 3).

3.3. KASP Genotyping Results

The sequences containing SNPs were converted for KASP genotyping (

Table 4. SNPs on chromosome 3H, converted into KASP-markers.

SNP	Position		Sequence Containing SNP
	cM	bp
JHI-Hv50k-2016-164734	45.82	48,713,634	CTTTATGAGATCAACTGCTTCCTGCAGAAGTTTAGCCTTTCCCATAAGAT[C/T]CACCATACAGCCATAATGCTCGTGCTTGGGTTCAATCCTGTATTCCTGGA
JHI-Hv50k-2016-165152	45.82	61,409,056	TGACATTGAGCTGCTTTGCTTTGGTTCATCTCCGTTCTTCTTTTCTTTTA[C/G]TTTGAGCGGCAGCAGCACTGATGATGATGACGACGACGATGATGGACGGG
JHI-Hv50k-2016-166356	47.31	102,070,302	CCTCTTTACCAAGGATTCGTGTCTTTTTTGTTTAACCTTGTGAGTTCTGA[T/C]TGACTACTAAAAAGATCCGTGCCTGGTATCTTTCATGAAATAGCCCCATT
JHI-Hv50k-2016-166392	47.1	112,536,071	AAGACGGTTGGGTCTCCGGCTCTCCGACGCACACACGCCGCGCCGTCCAG[T/C]TGGTGGTTTCGTTGCTTTTTCTTTGAACTGCCCACCTTGTATAATCAATC
SCRI_RS_160464	51.56	255,019,281	CTTGTAGTCGGTCGGTGTGTGGGAAGTTGGGATGAGAATGAACAAAAAGG[T/A]AAAAAGAAGAAATGAAAAGGATGAAAAAAGTTGGTGAAAAAGCTTGCACT
JHI-Hv50k-2016-173670	51.56	285,191,294	TTGCACTTGTGAAACTATTTGAATGTCTAAATGGGCTAACGAATGTTGCC[T/C]TTGCGAACCATGGTAGCAGAAGTCCATGACAAGGATACCTAAAATTTCAG
JHI-Hv50k-2016-174303	51.56	301,082,623	AGACTGTTCTTTGCCAGATGTTGATTATCTCTACTCTCCACATGACAACT[G/A]TCATCCAAAACAACAACAGGTACAGGGAACCCCATAACAGGTTTACGGTT
JHI-Hv50k-2016-179690	51.63	389,686,103	GCGTGACCTCGGTAAAAAAACTTAGCCCGTCTGAAATTTTGCTTGAATCA[G/A]TACTTTCGCACTGAGTTAGATCTTCATTATACTTTCGACAATAGATTGTG
JHI-Hv50k-2016-183207	52.46	442,203,921	TTGCCACCAAAAGTGCTCTTGAGTTGACATGTTTATATATTGTTCTCGCC[A/T]ACTTGCTCCAGCATTTGCATAATAATCTGTAAACAGCTCGGACACTTCTT
JHI-Hv50k-2016-183351	54.53	442,550,473	TCTTGACGCCGGGAACCAGCATGAGAAGATATTTGAATGATGACATTTGC[T/C]TCTGGGATATCAATGGAATTATCACCCACCTATGCATTAATAGCAGAGAT
JHI-Hv50k-2016-202195	98.65	553,150,117	GGAAAGAAGATTGCTGCTTTCGTTCCCAATGATGGTTGCCTGAACTTCAT[C/T]GAGGAAAATGTATGTTCCCCATCTTGTACTTCTCAAATGTATGTTCTACA
JHI-Hv50k-2016-183463	54.53	443,119,491	TATCCATGGACCTGAAAGTGCCAAATTGTATAAGCCATATCATGTTTTTT[T/C]AGTACAAGCCAGATCATGCTTACAATGCTCACTTTATTCTTTCAAACATA
JHI-Hv50k-2016-183478	54.53	44,311,006	GCTAACTTTGTCACCAGCTGTGGTTCTTCTGATGTGTTTGTTTCTACCA[C/A]ATTTGTGTCTGTTAGTACTGGAACTTCAGAACTTTGAGGTTCGTTAGTTG
Clone ID 3272635	51.27	391,906,604	CATCAAGAAGGCTGAGTCAAAGCCACGGGAGCCTAAGAAGAGGGTATAAC[C/G]TGCAGCTGGTGTTATATTGAGGTCCTTATAACCTTCACCTTGCATGCTCT
Clone ID 3255462_1	51.63	363,531,898	GAAATTGGACATGTCAATCCGACCAAGAGATTCAGGAGAAATCCTCTCTA[G/A]GAAACCAAAATCAGATATAAGGATCTTTGCAGCGCGTTCATCCCATGCAT
Clone ID 3255462_2	51.63	363,531,871	AGATTCAGGAGAAATCCTCTCTAGGAAACCAAAATCAGATATAAGGATCT[T/C]TGCAGCGCGTTCATCCCATGCATGGGCAGGAATGCCGGATAATTCCAGGC

). Developed KASP markers were tested on one DH and four F₂ populations to determine which markers showed the highest association with Ptt resistance. The results were plotted on a Cartesian plot where the x-axis shows the FAM signal fluorescence value for each sample associated with the first allele, and the y-axis shows the HEX signal fluorescence value associated with the second allele [53].

Eleven of fifteen SNPs examined in the DH population, CLS/Harrington, seven in the F₂ population, Local k-21578/Gesine, and five in F₂ populations, Fox/Gesine, Morex/Gesine, and Zolo/Gesine contained alternative allelic variants of extreme values of resistance to Ptt in the homozygous state (

Table 5. KASP-genotyping results in DH and F₂ progeny genotypes.

		Position			Number of Plants
N	SNP	Genetic Position (cM)	Physical Position (bp)	Allele	Resistant	Susceptible
DH population Canadian Lake Shore/Harrington
1	JHI-Hv50k-2016-179690	51.63	389,686,103	GG	20	0
				AG	0	0
				AA	0	21
2	Clone ID 3272635	51.27	391,906,604	GG	19	0
				CG	0	0
				CC	1	20
3	JHI-Hv50k-2016-183463	54.53	443,119,491	CC	1	21
				CT	0	0
				TT	19	0
4	JHI-Hv50k-2016-183478	54.53	443,111,006	CC	19	0
				CA	0	0
				AA	1	21
5	JHI-Hv50k-2016-183207	52.46	442,203,921	TT	19	0
				TA	0	0
				AA	1	21
6	JHI-Hv50k-2016-164734	45.82	48,713,634	CC	20	0
				CT	0	0
				TT	0	21
7	JHI-Hv50k-2016-165152	45.82	61,409,056	CC	20	0
				CG	0	0
				GG	0	21
8	JHI-Hv50k-2016-166392	47.1	112,536,071	CC	0	21
				TC	0	0
				TT	20	0
9	JHI-Hv50k-2016-183351	54.53	442,550,473	CC	1	21
				CT	0	0
				TT	19	0
10	Clone ID 3255462_1	51.63	363,531,898	GG	19	0
				AG	0	0
				AA	1	21
11	Clone ID 3255462_2	51.63	363,531,871	CC	1	21
				CT	0	0
				TT	19	0
Population F2 Fox/Gesine
12	Clone ID 3272635	51.27	391,906,604	GG	9	2
				CG	10	4
				CC	0	11
13	JHI-Hv50k-2016-183463	54.53	443,119,491	CC	0	12
				CT	7	4
				TT	9	2
14	JHI-Hv50k-2016-183478	54.53	443,111,006	CC	10	2
				CA	9	4
				AA	0	12
15	JHI-Hv50k-2016-183207	52.46	442,203,921	TT	10	1
				TA	8	4
				AA	0	12
16	JHI-Hv50k-2016-183351	54.53	442,550,473	CC	0	12
				CT	9	4
				TT	10	2
Population F2 Morex/Gesine
17	Clone ID 3272635	51.27	391,906,604	GG	6	1
				CG	11	4
				CC	2	19
18	JHI-Hv50k-2016-183463	54.53	443,119,491	CC	2	18
				CT	11	6
				TT	6	0
19	JHI-Hv50k-2016-183478	54.53	443,111,006	CC	6	0
				CA	11	6
				AA	2	19
20	JHI-Hv50k-2016-183207	52.46	442,203,921	TT	6	0
				TA	11	5
				AA	2	20
Population F2 Zolo/Gesine
21	Clone ID 3272635	51.27	391,906,604	GG	9	2
				CG	10	4
				CC	0	11
22	JHI-Hv50k-2016-183463	54.53	443,119,491	CC	0	12
				CT	7	4
				TT	9	2
23	JHI-Hv50k-2016-183478	54.53	443,111,006	CC	10	2
				CA	9	4
				AA	0	12
24	JHI-Hv50k-2016-183207	52.46	442,203,921	TT	10	1
				TA	8	4
				AA	0	12
25	JHI-Hv50k-2016-183351	54.53	442,550,473	CC	0	12
				CT	9	4
				TT	10	2
Population F2 Local k-21578/Gesine
26	JHI-Hv50k-2016-179690	51.63	389,686,103	GG	18	0
				AG	1	8
				AA	1	9
27	JHI-Hv50k-2016-183463	54.53	443,119,491	CC	1	11
				CT	10	7
				TT	9	0
28	JHI-Hv50k-2016-183478	54.53	443,111,006	CC	9	0
				CA	10	7
				AA	1	11
29	JHI-Hv50k-2016-183207	52.46	442,203,921	TT	9	0
				TA	10	7
				AA	1	11
30	JHI-Hv50k-2016-166392	47.1	112,536,071	CC	1	10
				TC	1	8
				TT	18	0
31	JHI-Hv50k-2016-183351	54.53	442,550,473	CC	1	11
				CT	10	7
				TT	9	0

). All results of KASP-genotyping in DH and F₂ barley populations are presented in Supplementary Table S1.

Diagnostic efficiency of SNP markers of Ptt resistance QTL on chromosome 3H is shown in Figure 2. Eleven of the twelve listed markers co-segregated with resistance in the DH population, CLS/Harrington, with high efficiency (97.5–100%). In the Morex/Gesine and Fox/Gesine F₂ populations, the co-segregation efficiency of markers, JHI-Hv50k-2016-183351, JHI-Hv50k-2016-183463, JHI-Hv50k-2016-183478, Clone ID 3272635, and JHI-Hv50k-2016-183207 with resistance to Ptt, was 81–86%. In the k-21578/Gesine F₂ population, highly efficient co-segregation with resistance was obtained for the markers, JHI-Hv50k-2016-166392, Clone ID 3255462_1, and Clone ID 3255462_2 (94%). No marker exceeded 80% efficiency in the co-segregation analysis with resistance in the Zolo/Gesine F₂ population. While for the varieties, Morex, Fox, and Zolo, heterozygous plants exhibited a parental response-resistance type, which indicates dominant resistance. In the Local k-21578/Gesine population, the mean score of the resistant parent was 2.5; the response of the heterozygous plants corresponded to susceptibility type (mean score 7.31). This indicates recessive resistance in the barley accession Local k-21578 to isolate F18.

3.4. Allele-Specific PCR Markers Test

Allele-specific PCR markers were developed based on the KASP assay data (Table S2). To optimize PCR conditions, the annealing temperature (from 60 °C to 68 °C) was varied with four primers and DNA of 10 barley varieties, presented in Table S3. The presence of the amplification product in DNA of the cv. CLS and absence of amplification in the susceptible cv. Harrington and Gesine were the benchmarks. Of the six markers studied, four met the control values: Clone ID 3272635, JHI-Hv50k-2016-183463, JHI-Hv50k-2016-183351, and JHI-Hv50k-2016-183478 (Figure 3, Supplementary Figures S6–S9). For markers JHI-Hv50k-2016-183478 and JHI-Hv50k-2016-183351, there were no amplification products from Morex DNA, and for markers JHI-Hv50k-2016-183463 and Clone ID 3272635, there were no amplicons in Local (Ecuador) k-21578 DNA samples. Amplification products for all studied markers were found for the accession S-328 Mexico, which was susceptible to most isolates tested in the present study.

4. Discussion

Eleven out of fifteen studied markers showed high efficacy (97.5−100%) for co-segregation with resistance in the DH population CLS/Harrington, including the markers Clone ID 3255462 and 3272635 previously identified in this DH population for the qPttCLS locus in interval 51.27–51.63 cM [35]. Three markers at 54.53 cM (JHI-Hv50k-2016-183463, JHI-Hv50k-2016-183478, and JHI-Hv50k-2016-183351) and one at 51.27 cM (Clone ID 3272635) were effective in the DH population and in two F₂ populations from crosses from Morex and Fox with susceptible cv. Gesine. Moreover, these markers are closely located to each other on the physical map [48]. The distance between the outermost markers is 915 kb between 442,203,921 and 443,119,491 bp on chromosome 3H. However, the distance between neighboring markers is 500 kb or less. We assume that they belong to the same genomic region. Results indicate that resistance to Ptt in cvs. CLS, Morex, and Fox is determined by the same locus. The studied cultivars and accessions show race-specific resistance to Ptt (Table 2). In GWA studies, the resistance of certain SNP haplotypes of these barley genotypes was associated with a locus on chromosome 3H [26,41]. At the same time, there were differences in the responses of these barley genotypes to inoculation with Ptt isolates of different origin. The data in Table 2 does not contradict the conclusion that resistance to Ptt in cvs. CLS, Morex, and Fox is determined by the same locus because IR to all studied isolates was approximately the same: cv. Morex was resistant to all Ptt isolates, cv. CLS and Fox were resistant to all isolates except one. Infection response of cv. CLS to isolate Germ 7 and cv. Fox to isolate SA 7 was 5.5 (MR). Local Ecuador k-21578 was susceptible to isolate V 13 to which all other cultivars were resistant; also, it was susceptible to isolate Mor 1 to which Fox and Morex were resistant (Table 2). Three SNP-markers co-segregated with resistance in the cross with the barley accession Local Ecuador k-21578 with high efficiency (94%) (Figure 2). These markers were not effective for crosses with Morex and Fox. Apparently, different QTLs on chromosome 3H controlled resistance of Local Ecuador k-21578 and CLS, Fox, and Morex.

Several other GWA studies have reported resistance loci in this genome region (

Table 6. Summary of QTL associated with resistance to Ptt on chromosome 3H in the target interval.

QTL	Genetic Position (cM) *	Physical Position (bp) **	Markers	Literature	Note
Rpt-3H-4	46.0	NA	Bmag0828-Bmac0067	[63]	OUH602/Harrington RIL
	45.82	NA	11_20356	[38]	GWAS Isolate LDN
	45.82	48,713,634	JHI-Hv50 k-2016-164734	[41]	GWAS
	47.1–47.31	102,070,302 112,536,071	JHI-Hv50 k-2016-166356 JHI-Hv50 k-2016-166392	[41]	GWAS
QTLUH-3H	45–51	NA	HVM33	[64]	DH Uschi/HHOR3073 Adult
QRptts-3HL	47.61	NA	12_30721	[38]	GWAS Isolate 15A
	54.53	442,550,473	JHI-Hv50 k-2016-183351	[41]	GWAS
qPttCLS	51.27–51.63	398,203,862–435,526,243	3255462, 3257991, 3272635, 4190028	[35]	DH CLS/Harrington DArTseq markers
NBP_QRPtt3-2	52.01–54.53	NA 443,115,672 443,551,729	11_10728 SCRI_RS_152172 SCRI_RS_186102	[36]	GWAS
	51.2–52.46	189,518,077 184,635,059 442,203,921	JHI-Hv50k-2016-169338, SCRI_RS_186341, JHI-Hv50k-2016-183207	[40]	GWAS A2.6.0
QPt.3H-3	51.63	NA	i_11_10966	[37]	Wild barley NAM population HEB-25
	52.01	442,185,927	SCRI_RS_221644	[33]	RIL CIho 5791/Tifang F6
	51.56	255,019,281 285,191,294 301,082,623	SCRI_RS_160464 JHI-Hv50 k-2016-173670 JHI-Hv50 k-2016-174303	[41]	GWAS

*—Marker position based on POPseq map by Mascher et al. [60], **—Marker position based on physical map MorexV3 (released in 2021) [48].

). The data in Table 6 indicate that there are probably three Ptt resistance loci in the intervals: 45.82–47.61 cM [38,41,63,64], 51.27–52.46 cM [33,35,37,40,41], and 54.53 cM [36,41].

In the first GWA study on Ptt resistance, Richards et al. (2017) mapped resistance QTL QRptts-3HL towards the isolates LDN (45.82 cM) and 15A (47.61 cM) from North Dakota and California, respectively. Novakazi et al. (2019) [41] found a Ptt resistance QTL in the same position—45.82 cM. In a bi-parental DH population of Ushi/HHOR3073 a QTL named QTLUH-3H in interval 45–51 cM was determined by König et al. (2013) [64], conferring adult plant resistance. Yun et al. (2006) [63] found QTL Rpt-3H-4 in the same position (46.0 cM) in the H. vulgare subsp. spontaneum accession OUH602 (Table 6).

Three markers (11_10728, SCRI_RS_152172, and SCRI_RS_186102) of QTL NBP_QRptt3-2 (52.76–53.26 cM) were significantly associated with seedling and adult plant Ptt resistance in a collection of Nordic barley germplasm [36] (Table 6). Apparently, the same QTL on chromosome 3H at POPSEQ position 54.53 cM was significantly associated with seedling and adult plant resistance to isolate NFNB 50 [41]. In a QTL-mapping study in a bi-parental population, a QTL in interval 51.56–52.46 was determined in different genetic backgrounds in a RIL population of CIho5791/Tifang (52.01 cM) by Koladia et al. [33] and in a DH population of CLS/Harrington (51.27–51.63 cM) by Dinglasan et al. (2019) [35]. Novakazi et al. (2019) [41] and Rozanova et al. (2019) [40] identified in GWA studies, QTL associated with seedling resistance to different Ptt isolates in the same position (51.2–51.56 cM) in a worldwide barley collection of landraces and commercial cultivars from the centers of diversity and in Siberian barley germplasm, respectively [40,41]. QPt.3H-3 was determine by Vatter et al. (2017) [37] in a nested association mapping population also at position 51.63 cM.

Markers, JHI-Hv50k-2016-166392, Clone ID 3255462_1, and Clone ID 3255462_2, in the interval between 47.1–51.63 cM showed high efficacy in the DH population, CLS/Harrington, and in the F₂ population, Local (Ecuador) k-21578/Gesine. In the present study, at least two loci controlling Ptt resistance were determined in the chromosome region spanning from 47.0–54.3 cM: one in chromosome fragment 46.0–48.44 cM (markers JHI_Hv50k-2016-164734, JHI_Hv50k-2016-165152, and JHI_Hv50k-2016-166392) and another in fragment 51.27–54.8 cM (markers JHI_Hv50k-2016-174303, JHI_Hv50k-2016-179690, Clon ID 3272635, Clon ID 3255462_1, and Clon ID 3255462_2) (Figure 2 and Figure 4).

The studied cultivars and barley accession Local (Ecuador) k-21578 express race-specific resistance; thus, the identified markers are of interest in pyramiding QTL with isolate-specific resistance.

Some SNPs were located in protein-coding regions of genes. SNP JHI-Hv50k-2016-183207 was in a gene-encoding, receptor-like protein kinase that participates in abiotic stress response in plants [65] (

Table 7. Significant SNPs associated with Ptt resistance and descriptions of genes located in the target interval on chromosome 3H.

SNP	Physical Map (bp)	Gene	Type of Mutation	Amino Acid Submission	Polymorphism		Protein Product *
					Resistant	Susceptible
JHI-Hv50k-2016-164734	48,713,634	HORVU.MOREX.r3.3HG0236970	E	C/T	CC	TT	Pentatricopeptide repeat-containing protein
JHI-Hv50k-2016-165152	61,409,056	HORVU.MOREX.r3.3HG0238960	D	G/C	CC	GG	DUF581 family protein
JHI-Hv50k-2016-166392	112,536,071	HORVU.MOREX.r3.3HG0246080	U	C/T	TT	CC	plant/protein (protein of unknown function, DUF538)
	301,082,623	HORVU.MOREX.r3.3HG0265210	E	G/A	AA	GG	Tudor/PWWP/MBT superfamily protein
Clone ID 3255462_2	363,531,871	BART1_0-u20880		T/C	TT	CC	Nontranslating CDS
Clone ID 3255462_1	363,531,898	BART1_0-u20880		A/G	GG	AA	Nontranslating CDS
JHI-Hv50k-2016-179690	389,686,103	HORVU.MOREX.r3.3HG0274650	I	A/G	GG	AA	DUF1645 family protein
Clone ID 3272635	391,906,604	HORVU.MOREX.r3.3HG0275090	I	G/C	GG	CC	SWI/SNF-related matrix-associated actin-dependent regulator of chromatin subfamily A-like protein 1
JHI-Hv50k-2016-183207	442,203,921	HORVU.MOREX.r3.3HG0281340	D	A/T	TT	AA	Receptor-like protein kinase
JHI-Hv50k-2016-183351	442,550,473	HORVU.MOREX.r3.3HG0281430	E	C/T	TT	CC	DNA repair helicase
JHI-Hv50k-2016-183478	443,111,006	HORVU.MOREX.r3.3HG0281530	E	C/A	CC	AA	DUF1645 family protein
JHI-Hv50k-2016-183463	443,119,491	HORVU.MOREX.r3.3HG0281540	I	T/C	TT	CC	RING/U-box superfamily protein

Date of access to database 1 February 2022; Intron—I, Exon—E, Downstream—D, Upstream—U, *—data from Barleymap.

). SNP JHI-Hv50k-2016-183351 was located in a gene encoding DNA repair helicase which can provide stress tolerance to plants [66]. SNPs, JHI-Hv50k-2016-183478 and JHI-Hv50k-2016-179690, were located in a gene-encoding DUF1645 family protein. This protein was first identified to enhance drought tolerance in transgenic rice and Arabidopsis [67]. Later, data indicated that genes encoding DUF1645 domain-containing proteins perform a conserved function in regulating stress-tolerance [68]. Located within 150 kb of marker JHI-Hv50k-2016-179690 are genes encoding receptor-like kinase and serine/threonine protein phosphatase and ethylene-responsive subfamily genes that are involved in plant defense responses [69,70]. Ethylene-responsive subfamily genes mainly work to mediate pathogen- and disease-related stimuli by activating multiple signaling pathways, such as jasmonic acid, ethylene, and salicylic acid pathways [71]. This genome region can be considered promising for further studies.

SNP JHI-Hv50k-2016-183463 was located in a gene-encoding RING/U-box superfamily protein. Sharma et al. [72] reported that this protein is involved in plant response to stress. Genes located within 150 kb of the identified markers were identified as encoding kinase family proteins involved in plant immunity against fungal infection [73] (Supplementary Table S4).

Clone ID 3255462_2 (363 531 871 bp) and Clone ID 3255462_1 (363 531 898 bp) are closely linked markers. These SNPs were selected from DArT marker sequences [35]. According to the Ensembl Plants database, both SNPs are located in gene BART1_0-u20880 (non-translating CDS). Genes located within 150 kb from these SNPs encode products relevant to retrotransposons. The regulation of retrotransposon expression in plants is not fully understood. Most of these active plant elements characterized to date are largely dormant during normal development but can be induced by biotic and/or abiotic stresses, including pathogen defense [74].

The other six markers are sufficiently separated that they belong to different genomic loci.

The marker JHI-Hv50k-2016-164734 was located downstream of the gene HORVU.MOREX.r3.3HG0236970 encoding pentatricopeptide repeat-containing protein (PPR). It is one of the largest protein families in embryophytes. A typical PPR protein is targeted to mitochondria or chloroplasts, binds one or several organellar transcripts, and influences their expression by altering RNA sequence, turnover, processing, or translation [75]. Nearby, less than 2 kb away from this marker is a gene-encoding serine carboxypeptidase-like protein (SCPL) (Supplementary Table S3). The SCPL family plays a vital role in stress response, growth, development and pathogen defense [76].

The marker JHI-Hv50k-2016-165152 is located in the gene HORVU.MOREX.r3.3HG0238960 encoding DUF581 family protein. DUF581 is a zf-FCS type zinc finger or FCS-like zinc finger (FLZ). It was found that it is highly conserved in sequence and structure and involved in protein–protein interactions [77]. Nearby, at 150 kb, there is another gene encoding the DUF581 family protein, as well as a gene encoding the LURP-one-like protein, which mediates resistance by coordinated transcriptional upregulation of plant defense genes [78].

The marker JHI-Hv50k-2016-166392 is located upstream of the gene HORVU.MOREX.r3.3HG0246080, which encodes DUF538. This protein belongs to a super family that includes a number of plant proteins, but their role is not yet clear. Analysis of genes located within 150 kb revealed no genes involved in the response to stress.

The marker JHI-Hv50k-2016-174303 is located in the exon of gene HORVU.MOREX.r3.3HG0265210, encoding a Tudor/PWWP/MBT superfamily protein. These are conserved proteins found both in embryophytes and in their unicellular ancestors. It was suggested that they have been transmitted through evolution as conserved linear arrangements (‘cassettes’) [79]. Genes-encoding, leucine-rich repeat protein kinase family proteins are located in the regions closest to this locus. Plant receptor-like kinases (RLKs) are an important class of proteins acting in plant defense responses. RLKs have been identified to be involved in broad-spectrum, elicitor-initiated defense responses and as dominant resistance (R) genes in race-specific pathogen defense. Most defense-related RLKs are of the leucine-rich repeat (LRR) subclass [80].

SNP Clone ID 3272635 is in the intron of the HORVU.MOREX.r3.3HG0275090 gene encoding the SWI/SNF-related, matrix-associated, actin-dependent regulator of chromatin subfamily A-like protein involved in DNA replication [81] and is involved in the heat stress response in Arabidopsis [82].

5. Conclusions

Diagnostic efficiency of SNP markers for resistance QTL towards Ptt on chromosome 3H in the interval 45.82–54.53 cM was determined by KASP genotyping. Eleven markers showed high efficacy (97.5–100%) for co-segregation with resistance to Ptt in the DH population, CLS/Harrington. Three markers closely located to each other on the genetic and physical map were effective in two F₂ populations of crosses between cvs. Morex and Fox with susceptible cv. Gesine. Apparently, in cultivars CLS, Morex, and Fox, resistance to Ptt is determined by the same locus. Three markers showed high efficacy in the DH population and in the F₂ population, Local (Ecuador) k-21578/Gesine. Data suggests, at least two loci controlling Ptt resistance exist in the 47.0–54.3 cM chromosome region: one between 46.0 and 48.44 cM, and another between 51.27 and 54.8 cM. These regions were found to contain several genes involved in important plant functions, including disease response and signaling pathways.

The effectiveness of KASP genotyping for the validation of SNP markers related to Ptt barley resistance has been shown. Four allele-specific PCR markers were developed based on the KASP assay data and found to be effective to differentiate susceptible and resistant barley genotypes. The KASP and allele-specific PCR markers associated with Ptt resistance on chromosome 3H will be useful for pyramiding resistance QTLs in marker-assisted selection in barley-breeding programs.