Next Article in Journal
Mucoadhesive Chitosan Delivery System with Chelidonii Herba Lyophilized Extract as a Promising Strategy for Vaginitis Treatment
Previous Article in Journal
The Integration of qSOFA with Clinical Variables and Serum Biomarkers Improves the Prognostic Value of qSOFA Alone in Patients with Suspected or Confirmed Sepsis at ED Admission
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Viral Loads in Ocular Fluids of Acute Retinal Necrosis Eyes Infected by Varicella-Zoster Virus Treated with Intravenous Acyclovir Treatment

1
Department of Ophthalmology, National Defense Medical College, Tokorozawa, Saitama 359-8513, Japan
2
Laboratory for Retinal Regeneration, RIKEN Center for Biosystems Dynamics Research, Kobe, Hyogo 650-0047, Japan
3
Department of Ophthalmology, The University of Tokyo, Bunkyo, Tokyo 113-8654, Japan
*
Author to whom correspondence should be addressed.
J. Clin. Med. 2020, 9(4), 1204; https://doi.org/10.3390/jcm9041204
Submission received: 30 March 2020 / Revised: 14 April 2020 / Accepted: 16 April 2020 / Published: 22 April 2020
(This article belongs to the Section Ophthalmology)

Abstract

Acute retinal necrosis (ARN) is a rare viral endophthalmitis, and human herpesvirus is the principal pathogen. Early diagnosis and treatment are critical to avoid visual impairment by ARN, and pars plana vitrectomy (PPV) is required in advanced cases. In this study, we evaluated the transition of viral load in ocular fluids of ARN eyes with varicella-zoster virus (VZV) after intravenous acyclovir treatment. Fourteen eyes of 13 patients were analyzed retrospectively. All patients received intravenous acyclovir treatment, and eventually, all eyes underwent PPV. A polymerase chain reaction (PCR) test showed a 100% detection rate in all aqueous humor samples collected before the treatment (Pre-AH), as well as aqueous humor (Post-AH) and vitreous fluid samples (VF), collected during PPV conducted after the treatment. Within eight days or less of acyclovir treatment, viral loads both in AH and VF did not decrease significantly. Furthermore, the viral load of Pre-AH had a strong correlation with that of VH. These data suggest that in ARN eyes with VZV infection, the AH sample for the PCR test was reliable to confirm the pathogen. We propose that short-term treatment of intravenous acyclovir may be insufficient for reducing intraocular viral load, and the Pre-AH sample could be a predictor of viral activity in the eyes after acyclovir treatment.

1. Introduction

Acute retinal necrosis (ARN) is a rare infectious viral endophthalmitis that causes necrotizing retinitis and results in devastating visual outcome if not accurately diagnosed and treated [1]. At present, members of the human herpesvirus (HHV) family such as herpes simplex virus (HSV) type 1, type 2, and varicella-zoster virus (VZV) are recognized as the principal pathogens of ARN [2,3]. Furthermore, both immunocompetent and immunosuppressed individuals irrespective of gender and age may develop ARN caused by HHV infection [4,5,6].
Early diagnosis and treatment for ARN are of great importance to avoid irreversible tissue damage and visual impairment in the affected eyes [1]. Laboratory methods including tests for antibodies in serum and ocular fluids, viral culture, retinal biopsy, and immunocytochemistry could be helpful in the diagnosis of ARN, although routine use of these tests has been hampered by poor sensitivity or specificity, limited availability of these tests, and excessive risk for the patients [6].
Quantitative real-time polymerase chain reaction (qPCR) has greatly advanced the diagnosis of viral retinitis by detecting the viral deoxyribonucleic acid (DNA) and accurately estimating the number of viral genome copies in ocular fluids such as aqueous humor (AH) and vitreous fluid (VF) [7,8]. To date, numerous studies have reported the results of qPCR test using AH and VF samples for the detection and identification of pathogenic viruses in ARN eyes [1,6,9,10,11]. We previously developed a combination PCR system consisting of multiplex qualitative PCR and qPCR and showed the usefulness of this system to detect HHV genomes in ocular fluids of eyes with uveitis [12]. Regarding the detection rates of pathogenic viruses, the qPCR test of ocular fluids showed positive rates of 79–100% for HSV or VZV in cases of suspected ARN [6]. Therefore, performing diagnostic pars plana vitrectomy (PPV) to collect ocular specimens for PCR test has been accepted as an adjunctive diagnostic procedure to guide optimum treatment for ARN [13].
Early antiviral drug therapy, including the treatment of intravenous acyclovir or oral valacyclovir (a prodrug of acyclovir), is the standard treatment for ARN [6]. Previous studies reported that the durations to reach maximum drug concentrations after the initial dose of intravenous acyclovir and an oral dose of valacyclovir were approximately one hour and two hours, respectively [14,15]. On the other hand, the anti-herpetic activity of acyclovir is by inhibition of duplication of herpes-specified DNA polymerase [6]; in other words, the efficacy of acyclovir is not by eliminating cells infected by HHVs, although the proliferation of HHVs is inhibited. To the best of our knowledge, there are only a few studies reporting viral loads in ocular fluids of ARN eyes before and after antiviral drug therapy [10,16,17,18]. Currently, the kinetics of viral load in ARN eyes that require diagnostic and therapeutic PPV after initiation of systemic antiviral treatment is not fully known.
The purposes of our study were to (1) compare the detection rates of pathogenic viruses by the combination PCR system using AH samples collected before the initiation of intravenous acyclovir treatment (Pre-AH), and aqueous humor (Post-AH), and vitreous fluid samples (VF) collected during PPV after the acyclovir treatment in eyes with suspected ARN, and (2) evaluate the changes of viral load in AH and VF samples before and after the acyclovir treatment in ARN eyes infected by VZV.

2. Methods

2.1. Subjects

This retrospective observational study was performed at the National Defense Medical College Hospital and The University of Tokyo Hospital in Japan, which are tertiary centers with specialty outpatient clinics for uveitis. The study period was from May 1, 2007, to November 1, 2017, and a consecutive series of 18 eyes of 17 patients diagnosed with ARN were enrolled. The final pathogenic viruses in the eyes confirmed by the combination PCR system using ocular fluids were VZV (17 of 18 cases, 94.4%) and cytomegalovirus (CMV, 1 of 18 cases, 5.6%). In the enrolled cases, 14 patients were treated with intravenous acyclovir (1500 mg three times/day, daily), two patients were treated initially with oral valaciclovir (3000 mg three times/day, daily), and one patient whose disease was initially suspected as bacterial endophthalmitis was treated with intravenous vancomycin hydrochloride (1000 mg twice/day, one day) and ceftazidime (2000 mg twice/day, one day) before undergoing diagnostic and therapeutic PPV (Table 1). The study protocol was approved by the Ethics Committees of National Defense Medical College (No. 2021 and No. 2022) and The University of Tokyo (No. 11531), and the procedures conformed to the tenets of the Declaration of Helsinki. Informed consent was obtained from all patients in this study.

2.2. Collection of Aqueous Humor and Vitreous Fluid Samples

Pre-AH samples were collected from 11 eyes with suspected ARN (Table 1). VF samples were obtained from 14 eyes. Among them, paired samples of Pre-AH and VF were collected from seven eyes, and paired samples of Post-AH and VF were collected from three eyes. An aliquot of 0.1 mL of AH was aspirated using a 30 G needle. Non-diluted VF sample was collected during diagnostic and therapeutic PPV. The AH and VF samples were transferred into sterile tubes and stored at −80 °C until processing. No complication associated with the sampling of AH and VF occurred.
In patients No. 1 to No. 4 (4 eyes of 17 patients, 22.2%), Post-AH and VF samples were not collected, because at the time of PPV, the pathogenic viruses had already been identified by the combination PCR system using Pre-AH sample. In patients No. 5 to No. 11, VF sampling was necessary, because at the time of PPV, the pathogenic viruses had not been identified by the PCR test using Pre-AH sample.

2.3. Comparisons of Virus Detection Rates and Viral Loads in Ocular Fluids

In this study, ARN eyes infected by CMV (No. 9) and ARN eyes caused by VZV infection treated with oral valaciclovir (No. 6 and No. 8) or antibacterial drugs (No. 15) were excluded from further analyses, in order to reduce the biases caused by medications and pathogenic viruses when comparing virus detection rates and viral loads. In those comparisons, we only examined the virus detection rates of the combination PCR system and evaluated the viral loads in ocular fluids in ARN eyes infected by VZV treated with intravenous acyclovir (14 eyes of 13 patients).

2.4. Qualitative Multiplex Polymerase Chain Reaction

Genomic DNAs of HHVs in the AH and VF samples were measured using two independent PCR assays (the combination PCR system): (1) a qualitative multiplex PCR and (2) a qPCR [12]. DNA was extracted from the samples using an E21 virus minikit (Qiagen, Valencia, CA, USA) installed on a robotic workstation for automated purification of nucleic acids (BioRobot E21, Qiagen). The multiplex PCR was designed to qualitatively measure the genomic DNAs of eight human herpes viruses, including HSV type 1, HSV type 2, VZV, Epstein–Barr virus, CMV, HHV type 6, HHV type 7, and HHV type 8. The PCR was performed using a LightCycler (Roche, Switzerland).
The primers of the viruses and the PCR conditions were described in previous reports [19,20,21,22,23,24,25]. Sequences of primers and probes for HSV type 1 to HHV type 8 are shown in Table 2. Specific primers for the viruses were used with AccuPrime Taq (Invitrogen, Carlsbad, CA, USA) and subjected to 40 cycles of PCR amplification. Hybridization probes were then mixed with the PCR products. When the genomic DNAs of HHVs were detected by the multiplex PCR, the samples were further analyzed by qPCR only for the HHVs. Representative results of a VZV-positive case (Patient No. 11) detected by the combination PCR system using the VF sample are shown in Figure 1.

2.5. Quantitative Real-Time Polymerase Chain Reaction

The qPCR was performed using AmpliTaq Gold and the Real-Time PCR 7300 system (ABI, Foster City, CA). The sequences of the primers and probes are shown in Table 3. The primers and PCR conditions have been reported previously [26,27,28,29,30,31,32]. All the reaction mixtures were subjected to 45 cycles of PCR amplification. The viral copy number in the sample was considered to be significant when more than 50 copies/tube (5.0 × 103/mL) were observed [21]. To ensure that no contamination of the PCR preparation occurred, DNA amplification and analysis of the amplified products were carried out in separate laboratories. If a patient was found to be positive by only one of the PCR methods (for example, positive by the multiplex PCR and negative by the qPCR), the sample was assessed as PCR negative [21].

2.6. Statistical Analysis

Statistical analyses were performed using the statistic add-in software for Excel (BellCurve for Excel®, SSRI Co., Ltd., Tokyo, Japan, and XLSTAT®, Addinsoft company, Paris, France). Data are expressed as mean ± standard deviation (median). Two-tailed Fisher’s exact test (for n < 4) was used to compare independent categorical variables. Two-tailed Kruskal–Wallis test was used for nonparametric comparisons of multiple groups. One-tailed Mann–Whitney U test was used for the nonparametric comparison of unpaired groups. Two-tailed Spearman’s rank correlation was used to assess the nonparametric correlation of paired groups. A p level of less than 0.05 was considered to be statistically significant.

3. Results

3.1. Clinical Characteristics and Viral Loads of Ocular Fluids in ARN Patients with VZV Infection

The clinical characteristics and viral loads of ocular fluids in ARN patients with VZV infection (14 eyes of 13 patients) are summarized in Table 4. The ARN patients with VZV infection were divided into four groups according to the type of ocular fluid sample tested as follows: (1) Pre-AH sample only, (2) Pre-AH and VF samples, (3) VF sample only, and (4) Post-AH and VF samples. Regarding the classification, there was no overlap of patients among four groups. There was no significant difference in age, gender, and detection rates of pathogenic viruses by the combination PCR system. The detection rate was 100% in all four groups.

3.2. Comparisons of Viral Loads in Ocular Fluids before and after Initiation of Intravenous Acyclovir Treatment

The viral loads of VZV in Pre-AH, Post-AH, and VF calculated from the combination PCR system are summarized in Figure 2. There was no significant difference in the viral loads between Pre-AH group (Total), and the Post-AH group (Figure 2A). To examine the influence of duration of intravenous acyclovir treatment on viral load in AH, the Pre-AH patients were divided into two subgroups as follows: (1) patients who underwent PPV within three days after collection of Pre-AH (Pre-AH within three days), and (2) patients who underwent PPV more than three days after collection of Pre-AH (Pre-AH over three days). There was no significant difference in viral load between the groups of Post-AH and Pre-AH within three days (Figure 2B) or Pre-AH over three days (Figure 2C), or between the groups of Pre-AH within three days and Pre-AH over three days (Figure 2D).
To examine the influence of duration of intravenous acyclovir treatment on viral load in VF, the VF patients were classified into two subgroups as follows: (1) patients who underwent PPV within three days after the initiation of the treatment (VF within three days) and (2) patients who underwent PPV after more than three days of the treatment (VF over three days). There was no significant difference in viral load between the two groups (Figure 2E).
The clinical characteristics of the Post-AH group, the subgroups of Pre-AH and the VF group are summarized in Table S1. There were no significant differences in age, gender, and laterality between the groups of Pre-AH (Total) and Post-AH, Pre-AH within three days and Post-AH, Pre-AH over three days and Post-AH, Pre-AH within three days and Pre-AH over three days, or VF within three days and VF over three days.

3.3. Comparisons and Correlations of Viral Loads in Ocular Fluids of the Same Patients before and after Initiation of Intravenous Acyclovir Treatment

The viral load of VZV in Pre-AH, Post-AH, and VF collected from the same patients before and after initiation of intravenous acyclovir treatment are shown in Figure 3. There was no significant difference in viral loads between the groups of Pre-AH and VF. On the other hand, the viral load in VF was significantly and markedly (approximately 45 times) higher than that in Post-AH (Figure 3B-(b)).
The correlation of viral loads between the groups of VF and Pre-AH or Post-AH is shown in Figure 3. The viral loads in Pre-AH samples correlated extremely strongly (p = 2.22 × 10−16) with those in VF samples (Figure 3A-(c)). On the other hand, there was no significant correlation between the viral loads in VF and Post-AH samples (Figure 3B-(c)).
The clinical characteristics of the paired sample groups with VF and Pre-AH or Post-AH are summarized in Table S2.

4. Discussion

ARN was reported for the first time by Urayama et al. [33] in 1971 as a syndrome of acute panuveitis with retinal periarteritis. At present, ARN is recognized as a rare infectious viral uveitis syndrome that manifests as a form of necrotizing retinitis and may have devastating visual outcome if not accurately diagnosed and treated [1]. PCR test is a useful method for early diagnosis and treatment to identify pathogenic viruses in ARN eyes [6]. In the present study, we aimed to investigate the usefulness of AH as a sample of PCR test for suspected ARN eyes, and to evaluate the transition of viral loads in ocular fluids before and after initiation of systemic antiviral treatment in real-world clinical practice. We obtained several noteworthy findings as follows: (1) All the ocular fluid samples, including the Pre-AH and Post-AH samples yielded a high detection rate (100%) of pathogenic viruses by the combination PCR system, regardless of the differences in the type of ocular fluid, collection time, and systemic antiviral treatment. (2) In cases of ARN with VZV infection, the viral loads both in the AH and VF did not decrease over a short period after intravenous acyclovir treatment. (3) The viral load in the Pre-AH strongly correlated with that in the VF and may be a predictor of intraocular viral activity after short-term treatment of intravenous acyclovir.
Intravenous treatment with acyclovir for 10 days [5,34,35,36] and the use of oral antiviral drugs (e.g., famciclovir or valacyclovir) for five weeks to 24 weeks [37,38] has been accepted as a standard treatment for ARN patients in the acute phase. Acyclovir is an acyclic purine nucleoside analog that is converted to acyclovir monophosphate by virus-encoded thymidine kinase, which yields high concentrations of acyclovir triphosphate, inhibiting viral DNA synthesis through competitive inhibition of viral DNA polymerase [6,39]. Therefore, the therapeutic efficacy of acyclovir is not the elimination of infected cells or HHVs but the inhibition of HHV proliferation. In our study, the viral loads in AH and VF samples were not reduced over time after the initiation of intravenous acyclovir treatment in ARN eyes with VZV infection (Figure 2). In the literature, the changes in viral loads over time in ocular fluids of ARN eyes have been reported [11,18,40]. Bernheim et al. [18] demonstrated that the viral load in the AH of ARN eyes with VZV infection was constant during 27.8 ± 24.9 days after initiation of intravenous acyclovir treatment and intravitreal injections of antiviral drugs, suggesting that the conventional 10-day intravenous acyclovir treatment may be insufficient in patients who do not show a rapid response. In addition, Abe et al. [41] reported that the viral loads in AH and VF samples before systemic antivirus treatments correlated negatively with the final visual acuity in ARN eyes with VZV infection. Therefore, therapeutic strategies that effectively reduce intraocular viral load should be considered in ARN eyes with VZV infection.
Adjunctive treatments for ARN have been performed as follows: (1) early PPV with or without silicone oil before rhegmatogenous retinal detachment (RRD), (2) laser retinopexy around areas of necrosis to prevent RRD, (3) systemic and/or local corticosteroids, (4) systemic antiplatelet agents, and (5) intravitreal antiviral drugs [6]. In particular, several studies have reported the benefits of early PPV in term of reducing the onset risk of RRD [36,42,43], although the contradictory result was also reported [44]. As for the effects of vitrectomy, diagnostic and therapeutic PPV for suspected ARN has dual roles. First, larger volumes of vitreous fluids can be collected as diagnostic specimens for cell culture, cytology, PCR and other tests. Second, the procedure directly removes dense vitreous opacities containing substantial pathogenic viruses [10]. Furthermore, the PCR test using ocular fluid samples reliably and rapidly confirms causative viruses with a low rate of adverse events in cases of suspected ARN [6,45]. Therefore, we propose that early diagnostic and therapeutic PPV using microincision surgery with a wide-viewing system [46,47] combined with antivirus drug therapy would be the preferred minimally invasive approach to treat ARN eyes by excluding heavy pathogenic viruses, when clinical symptoms are unclear and response to antivirus drug therapy is inadequate.
Aqueous humor tapping is more easily performed and has a low risk of complications compared to vitreous fluid biopsy [10,18,48]. Previous studies have reported no significant difference between AH and VF samples in the detection rate of ARN-causing pathogenic viruses by PCR test [16,17]. On the other hand, questionnaire-based research conducted by the British Ophthalmological Surveillance Unit reported that vitreous fluid biopsy was significantly more likely to yield viral DNA on a PCR test compared with the aqueous humor tap (92.6% vs. 46.2%) in ARN cases [10]. In our study, both AH and VF samples yielded a 100% detection rate by the combination PCR system. As a possible reason for the contradictory result, since all the patients in our study finally underwent diagnostic and therapeutic PPV, they were presumably relatively severe cases having high viral loads in ocular fluids and hence were more easily detected, whereas the subjects in the previous study were reported as general ARN cases with incomplete samplings of AH (13 of 45 patients) and VF (27 of 45 patients) [10].
In our study, the causative virus was promptly confirmed by the combination PCR system using Pre-AH samples in four cases (22.2%) of suspected ARN, and we were able to initiate effective treatment with systemic antiviral drugs for VZV before performing therapeutic PPV (Table 1). Appropriate selection of effective antiviral drugs is essential because the efficacies of antiviral agents vary depending on the ARN-causing pathogenic viruses such as HSV type 1, HSV type 2, VZV and CMV [3,6]. Regarding the load of the pathogenic virus, our results using the paired samples showed that the viral load in the VF was significantly and approximately 45 times higher than that in the AH samples of ARN eyes with VZV infection after the initiation of intravenous acyclovir treatment (Figure 3). From the practical point of view, the sampling of AH for PCR test during PPV is feasible and safer than that of VF in ARN eyes because AH tapping is minimally invasive with very rare adverse events [18,48]. Therefore, we speculate that the AH sample collected at the time when ARN is suspected or during PPV, is an ideal sample for a PCR test to promptly decide the optimal antiviral treatment.
A PCR test using AH and VF samples is in principal used as a definitive diagnostic method to confirm pathogenic viruses of ARN [6,11,12,16,17,18,45]. Early diagnosis and treatment of ARN are crucial to avoid irreversible tissue damage and visual impairment [1]. To date, an important question remains unanswered: What should be the optimal cutoff viral load used in qPCR test of ocular fluids? In previous studies, the cutoff viral loads used in the qPCR test ranged from 3.8 × 105 to higher than 1.0 × 107 copies/ml in ARN eyes with HSV infection [40,49], and from 2.0 × 102 to higher than 4.8 × 106 copies/ml in ARN eyes with VZV infection [11,18]. In the present study, we set the cutoff value to be higher than 5.0 × 103 copies/ml for the combination PCR system [12]. The cutoff value should be sufficiently high to exclude a false-positive result. Yet, ARN is a critically severe disease with a poor visual outcome, and therefore treatment should be initiated if a viral load suggesting presumptive ARN is detected. A previous study indicates that a viral load higher than 2.0 × 102 copies/mL is clinically significant [18]. Therefore, the cutoff values of viral loads in qPCR tests vary widely [18]. In the future, large-scale multicenter studies are necessary to establish the optimal cutoff values of viral load for different pathogenic HHVs when qPCR test is used to analyze ocular fluids from ARN eyes.
Currently, the PCR test is a reliable method to confirm the pathogens of ARN. However, the high detection sensitivity of PCR test could lead to a false-positive result in some cases. As for other diagnostic methods, Goldmann–Witmer coefficient (GWC) analysis that compares the level of antibody (IgG) production in the intraocular fluid to that in serum measured by enzyme-linked immune sorbent assay, is also used for diagnosing pathogens in infectious uveitis [50,51,52]. Abe et al. [50] showed that the detectability of viral pathogens by GWC analysis was equal to that by PCR test using AH and VF samples in retinitis with VZV infection. In addition, Takase at al [52] proposed diagnostic criteria based on six items of early-stage ocular findings (1a to 1f), five items of clinical courses (2a to 2e), and the result of PCR test or GWC analysis using intraocular fluids. In their study, diagnostic criteria using only ocular findings and clinical courses showed an extremely high rate of correct diagnosis with a sensitivity of 0.89 and specificity of 1.00, which was the same as that of the diagnostic criteria consisting of ocular findings, clinical courses and results of the virologic test [52]. Therefore, comprehensive diagnosis based on the results of GWC analysis and the diagnostic criteria will be required to ensure proper treatment for unclassifiable acute endophthalmitis, if the dissociation between clinical features and result of PCR test is suspected.
The present study has several limitations due to the retrospective design, which means that the treatments of eyes with suspected ARN were selected by individual physicians. The patients with suspected ARN studied were enrolled in only two core university hospitals with specialty outpatient clinics for uveitis, and there are some concerns as follows: (1) The protocols of systemic antiviral treatments and diagnostic and therapeutic PPV were not predetermined, even though the treatments and the PPV procedures for suspected RRD were performed according to the standard protocols for ARN [53]. (2) Compared with previous reports [1,5,9,12,16,17,36,54], the clinical characteristics of the enrolled patients were inclined towards patients with ARN caused by VZV infection (17 of 18 cases, 94.4%). (3) There was a small number of ARN cases with VZV infection. Therefore, the assessment of the efficacy of intravenous acyclovir treatment in reducing the viral load of ocular fluids was inadequate. (4) The viral load detected by qPCR test does not absolutely imply the presence of active infectious virus particles, because the amplified viral DNA sequences may represent remnants of viral DNA previously inhibited by antiviral drugs, and may also include nonproductive (abortive) particles [18]. (5) In this study, we only used the combination PCR system to confirm the pathogen in the ARN eyes studied. Other appropriate methods, such as GWC analysis [50,51,52], were not used for diagnosing the pathogens of ARN. (6) Other clinical parameters such as visual acuity, disease duration from onset to complete regression of ARN, the incidence of RRD [34,36,55], the involvement of the fellow eye [56,57], inflammatory activities in the anterior segment [58] and vitreous body [59], and sites of retinal necrosis [60] were not examined in our study, because the clinical findings of anterior and posterior segments were obscure due to the opacities in the anterior chamber and vitreous body. (7) The enrolled patients referred from other facilities to our university hospitals were presumably relatively severe cases. Therefore, it is conceivable that suspected ARN cases with mild clinical findings were potentially excluded in our study.
The strengths of this study are as follows: (1) The efficacy of intravenous acyclovir treatment in reducing viral loads of ocular fluids in ARN eyes with VZV infection was examined under relatively low biases of medications and pathogenic viruses as well as therapeutic interventions because other adjunctive treatments including laser retinopexy, administrations of systemic corticosteroids, antiplatelet agents and intravitreal antiviral drugs were not used in all the enrolled patients. (2) All the enrolled patients underwent diagnostic and therapeutic PPV. Therefore, there was no selection bias depending on the severity of clinical diagnosis based on clinical features in the evaluation of the efficacy of intravenous acyclovir treatment on viral load in ocular fluids. (3) Treatments of eyes with suspected ARN were given under conditions of real-world clinical practice, and the viral loads in the eyes were obtained from the clinical data of eyes with suspected ARN receiving standard treatments in the real-world clinical setting.

5. Conclusions

In cases of suspected ARN, aqueous humor specimen for PCR test is a reliable and safe sample with low risk of adverse events, which aids in confirming pathogenic viruses and ruling out other masquerading ocular diseases. In ARN eyes with VZV infection requiring subsequent PPV, intravenous acyclovir treatment alone may be inadequate for reducing intraocular viral load in the short term. In cases of suspected ARN, we propose that early diagnostic and therapeutic PPV combined with antivirus drug therapy would be the preferred approach for direct removal of pathogenic viruses.

Supplementary Materials

The following are available online at https://www.mdpi.com/2077-0383/9/4/1204/s1, Table S1: Clinical characteristics of ARN patients with VZV infection classified into 5 groups according to type of ocular fluid sample and duration of intravenous acyclovir treatment. Table S2: Clinical characteristics of ARN patients with VZV infection divided into 2 groups according to type of paired sample in ocular fluid.

Author Contributions

Manuscript preparation: T.S. and M.T.; Data collection and measurement: T.S., W.Y., A.T., H.S., S.S., T.K. and M.T.; Analysis and interpretation: T.S. and M.T. All authors have read and agreed to the published version of the manuscript.

Funding

The funding source had no involvement in study design; in the collection, analysis, and interpretation of data; in writing of the report; and in the decision to submit the paper for publication. The corresponding author had full access to all the data in the study and had final responsibility for the decision to submit for publication.

Acknowledgments

This study was supported by Grant-in-Aid for Scientific Research C from the Japan Society for the Promotion of Science (16K11337), Novartis Research Grant, Alcon Research Grant, Research Grant from Daiwa Securities Health Foundation, and Grant-in-Aid from National Defense Medical College, Japan for Advanced Medical Development.

Conflicts of Interest

The authors declare no competing interests.

References

  1. Flaxel, C.J.; Yeh, S.; Lauer, A.K. Combination systemic and intravitreal antiviral therapy in the management of acute retinal necrosis syndrome (an American Ophthalmological Society thesis). Trans. Am. Ophthalmol. Soc. 2013, 111, 133–144. [Google Scholar] [PubMed]
  2. Kanoff, J.; Sobrin, L. New diagnosis and treatment paradigms in acute retinal necrosis. Int. Ophthalmol. Clin. 2011, 51, 25–31. [Google Scholar] [CrossRef] [PubMed]
  3. Wong, R.W.; Jumper, J.M.; McDonald, H.R.; Johnson, R.N.; Fu, A.; Lujan, B.J.; Cunningham, E.T., Jr. Emerging concepts in the management of acute retinal necrosis. Br. J. Ophthalmol. 2013, 97, 545–552. [Google Scholar] [CrossRef] [PubMed]
  4. Van Gelder, R.N.; Willig, J.L.; Holland, G.N.; Kaplan, H.J. Herpes simplex virus type 2 as a cause of acute retinal necrosis syndrome in young patients. Ophthalmology 2001, 108, 869–876. [Google Scholar] [CrossRef]
  5. Lau, C.H.; Missotten, T.; Salzmann, J.; Lightman, S.L. Acute retinal necrosis features, management, and outcomes. Ophthalmology 2007, 114, 756–762. [Google Scholar] [CrossRef]
  6. Schoenberger, S.D.; Kim, S.J.; Thorne, J.E.; Mruthyunjaya, P.; Yeh, S.; Bakri, S.J.; Ehlers, J.P. Diagnosis and treatment of acute retinal necrosis: A report by the American Academy of Ophthalmology. Ophthalmology 2017, 124, 382–392. [Google Scholar] [CrossRef]
  7. Kessler, H.H.; Mühlbauer, G.; Rinner, B.; Stelzl, E.; Berger, A.; Dörr, H.-W.; Santner, B.; Marth, E.; Rabenau, H. Detection of herpes simplex virus DNA by real-time PCR. J. Clin. Microbiol. 2000, 38, 2638–2642. [Google Scholar] [CrossRef]
  8. Dworkin, L.L.; Gibler, T.M.; Van Gelder, R.N. Real-time quantitative polymerase chain reaction diagnosis of infectious posterior uveitis. Arch. Ophthalmol. 2002, 120, 1534–1539. [Google Scholar] [CrossRef]
  9. Gargiulo, F.; De Francesco, M.A.; Nascimbeni, G.; Turano, R.; Perandin, F.; Gandolfo, E.; Manca, N. Polymerase chain reaction as a rapid diagnostic tool for therapy of acute retinal necrosis syndrome. J. Med. Virol. 2003, 69, 397–400. [Google Scholar] [CrossRef]
  10. Cochrane, T.F.; Silvestri, G.; McDowell, C.; Foot, B.; McAvoy, C.E. Acute retinal necrosis in the United Kingdom: Results of a prospective surveillance study. Eye (Lond.) 2012, 26, 370–377. [Google Scholar] [CrossRef]
  11. Asano, S.; Yoshikawa, T.; Kimura, H.; Enomoto, Y.; Ohashi, M.; Terasaki, H.; Nishiyama, Y. Monitoring herpesviruses DNA in three cases of acute retinal necrosis by real-time PCR. J. Clin. Virol. 2004, 29, 207–210. [Google Scholar] [CrossRef]
  12. Sugita, S.; Shimizu, N.; Watanabe, K.; Mizukami, M.; Morio, T.; Sugamoto, Y.; Mochizuki, M. Use of multiplex PCR and real-time PCR to detect human herpes virus genome in ocular fluids of patients with uveitis. Br. J. Ophthalmol. 2008, 92, 928–932. [Google Scholar] [CrossRef] [PubMed]
  13. Jeroudi, A.; Yeh, S. Diagnostic vitrectomy for infectious uveitis. Int. Ophthalmol. Clin. 2014, 54, 173–197. [Google Scholar] [CrossRef] [PubMed]
  14. Soul-Lawton, J.; Seaber, E.; On, N.; Wootton, R.; Rolan, P.; Posner, J. Absolute bioavailability and metabolic disposition of valaciclovir, the L-valyl ester of acyclovir, following oral administration to humans. Antimicrob. Agents Chemother. 1995, 39, 2759–2764. [Google Scholar] [CrossRef] [PubMed]
  15. Höglund, M.; Ljungman, P.; Weller, S. Comparable aciclovir exposures produced by oral valaciclovir and intravenous aciclovir in immunocompromised cancer patients. J. Antimicrob. Chemother. 2001, 47, 855–861. [Google Scholar] [CrossRef]
  16. Ganatra, J.B.; Chandler, D.; Santos, C.; Kuppermann, B.; Margolis, T.P. Viral causes of the acute retinal necrosis syndrome. Am. J. Ophthalmol. 2000, 129, 166–172. [Google Scholar] [CrossRef]
  17. Sims, J.L.; Yeoh, J.; Stawell, R.J. Acute retinal necrosis: A case series with clinical features and treatment outcomes. Clin. Exp. Ophthalmol. 2009, 37, 473–477. [Google Scholar] [CrossRef]
  18. Bernheim, D.; Germi, R.; Labetoulle, M.; Romanet, J.; Morand, P.; Chiquet, C. Time profile of viral DNA in aqueous humor samples of patients treated for varicella-zoster virus acute retinal necrosis by use of quantitative real-time PCR. J. Clin. Microbiol. 2013, 51, 2160–2166. [Google Scholar] [CrossRef]
  19. Burrows, J.; Nitsche, A.; Bayly, B.; Walker, E.; Higgins, G.; Kok, T. Detection and subtyping of Herpes simplex virus in clinical samples by LightCycler PCR, enzyme immunoassay and cell culture. BMC Microbiol. 2002, 2, 12. [Google Scholar] [CrossRef]
  20. Espy, M.J.; Teo, R.; Ross, T.K.; Svien, K.A.; Wold, A.D.; Uhl, J.R.; Smith, T.F. Diagnosis of varicella-zoster virus infections in the clinical laboratory by LightCycler PCR. J. Clin. Microbiol. 2000, 38, 3187–3189. [Google Scholar] [CrossRef]
  21. Sugita, S.; Iwanaga, Y.; Kawaguchi, T.; Futagami, Y.; Horie, S.; Usui, T.; Yamamoto, S.; Sugamoto, Y.; Mochizuki, M.; Shimizu, N.; et al. Detection of herpesvirus genome by multiplex polymerase chain reaction (PCR) and real-time PCR in ocular fluids of patients with acute retinal necrosis. Nippon Ganka Gakkai Zasshi 2008, 112, 30–38. [Google Scholar]
  22. Schaade, L.; Kockelkorn, P.; Ritter, K.; Kleines, M. Detection of cytomegalovirus DNA in human specimens by LightCycler PCR. J. Clin. Microbiol. 2000, 38, 4006–4009. [Google Scholar] [CrossRef] [PubMed]
  23. Ohyashiki, J.; Suzuki, A.; Aritaki, K.; Nagate, A.; Shoji, N.; Ohyashiki, K.; Ojima, T.; Abe, K.; Yamamoto, K. Use of real-time PCR to monitor human herpesvirus 6 reactivation after allogeneic bone marrow transplantation. Int. J. Mol. Med. 2000, 6, 427–459. [Google Scholar] [CrossRef] [PubMed]
  24. Zerr, D.M.; Huang, M.-L.; Corey, L.; Erickson, M.; Parker, H.L.; Frenkel, L.M. Sensitive method for detection of human herpesviruses 6 and 7 in saliva collected in field studies. J. Clin. Microbiol. 2000, 38, 1981–1983. [Google Scholar] [CrossRef] [PubMed]
  25. Chang, Y.; Cesarman, E.; Pessin, M.S.; Lee, F.; Culpepper, J.; Knowles, D.M.; Moore, P.S. Identification of herpesvirus-like DNA sequences in AIDS-associated Kaposi’s sarcoma. Science 1994, 266, 1865–1869. [Google Scholar] [CrossRef]
  26. Corey, L.; Huang, M.L.; Selke, S.; Wald, A. Differentiation of herpes simplex virus types 1 and 2 in clinical samples by a real-time taqman PCR assay. J. Med. Virol. 2005, 76, 350–355. [Google Scholar] [CrossRef]
  27. Kido, S.; Sugita, S.; Horie, S.; Miyanaga, M.; Miyata, K.; Shimizu, N.; Morio, T.; Mochizuki, M. Association of varicella zoster virus load in the aqueous humor with clinical manifestations of anterior uveitis in herpes zoster ophthalmicus and zoster sine herpete. Br. J. Ophthalmol. 2008, 92, 505–508. [Google Scholar] [CrossRef]
  28. Tanaka, N.; Kimura, H.; Iida, K.; Saito, Y.; Tsuge, I.; Yoshimi, A.; Matsuyama, T.; Morishima, T. Quantitative analysis of cytomegalovirus load using a real-time PCR assay. J. Med. Virol. 2000, 60, 455–462. [Google Scholar] [CrossRef]
  29. Kimura, H.; Morita, M.; Yabuta, Y.; Kuzushima, K.; Kato, K.; Kojima, S.; Matsuyama, T.; Morishima, T. Quantitative analysis of Epstein-Barr virus load by using a real-time PCR assay. J. Clin. Microbiol. 1999, 37, 132–136. [Google Scholar] [CrossRef]
  30. Gautheret-Dejean, A.; Manichanh, C.; Thien-Ah-Koon, F.; Fillet, A.-M.; Mangeney, N.; Vidaud, M.; Dhedin, N.; Vernant, J.P.; Agut, H. Development of a real-time polymerase chain reaction assay for the diagnosis of human herpesvirus-6 infection and application to bone marrow transplant patients. J. Virol. Methods 2002, 100, 27–35. [Google Scholar] [CrossRef]
  31. Hara, S.; Kimura, H.; Hoshino, Y.; Tanaka, N.; Nishikawa, K.; Ihira, M.; Yoshikawa, T.; Morishima, T. Detection of herpesvirus DNA in the serum of immunocompetent children. Microbiol. Immunol. 2002, 46, 177–180. [Google Scholar] [CrossRef] [PubMed]
  32. Polstra, A.M.; van den Burg, R.; Goudsmit, J.; Cornelissen, M. Human herpesvirus 8 load in matched serum and plasma samples of patients with AIDS-associated Kaposi’s sarcoma. J. Clin. Microbiol. 2003, 41, 5488–5491. [Google Scholar] [CrossRef] [PubMed][Green Version]
  33. Urayama, A. Unilateral acute uveitis with retinal periarteritis and detachment. Rinsho Ganka. Jpn. J. Clin. Ophthalmol. 1971, 25, 607–619. [Google Scholar]
  34. Blumenkranz, M.S.; Culbertson, W.W.; Clarkson, J.G.; Dix, R. Treatment of the acute retinal necrosis syndrome with intravenous acyclovir. Ophthalmology 1986, 93, 296–300. [Google Scholar] [CrossRef]
  35. Duker, J.S.; Blumenkranz, M.S. Diagnosis and management of the acute retinal necrosis (ARN) syndrome. Surv. Ophthalmol. 1991, 35, 327–343. [Google Scholar] [CrossRef]
  36. Hillenkamp, J.; Nölle, B.; Bruns, C.; Rautenberg, P.; Fickenscher, H.; Roider, J. Acute retinal necrosis: Clinical features, early vitrectomy, and outcomes. Ophthalmology 2009, 116, 1971–1975. [Google Scholar] [CrossRef]
  37. Emerson, G.G.; Smith, J.R.; Wilson, D.J.; Rosenbaum, J.T.; Flaxel, C.J. Primary treatment of acute retinal necrosis with oral antiviral therapy. Ophthalmology 2006, 113, 2259–2261. [Google Scholar] [CrossRef]
  38. Aizman, A.; Johnson, M.W.; Elner, S.G. Treatment of acute retinal necrosis syndrome with oral antiviral medications. Ophthalmology 2007, 114, 307–312. [Google Scholar] [CrossRef]
  39. Weller, S.; Blum, M.R.; Doucette, M.; Burnette, T.; Cederberg, D.M.; de Miranda, P.; Smiley, M.L. Pharmacokinetics of the acyclovir pro-drug valaciclovir after escalating single-and multiple-dose administration to normal volunteers. Clin. Pharmacol. Ther. 1993, 54, 595–605. [Google Scholar] [CrossRef]
  40. Cottet, L.; Kaiser, L.; Hirsch, H.; Baglivo, E. HSV2 acute retinal necrosis: Diagnosis and monitoring with quantitative polymerase chain reaction. Int. Ophthalmol. 2009, 29, 199–201. [Google Scholar] [CrossRef]
  41. Abe, T.; Sato, M.; Tamai, M. Correlation of varicella-zoster virus copies and final visual acuities of acute retinal necrosis syndrome. Graefes. Arch. Clin. Exp. Ophthalmol. 1998, 236, 747–752. [Google Scholar] [CrossRef] [PubMed]
  42. Ishida, T.; Sugamoto, Y.; Sugita, S.; Mochizuki, M. Prophylactic vitrectomy for acute retinal necrosis. Jpn. J. Ophthalmol. 2009, 53, 486–489. [Google Scholar] [CrossRef] [PubMed]
  43. Luo, Y.H.; Duan, X.C.; Chen, B.H.; Tang, L.S.; Guo, X.J. Efficacy and necessity of prophylactic vitrectomy for acute retinal necrosis syndrome. Int. J. Ophthalmol. 2012, 5, 482–487. [Google Scholar] [PubMed]
  44. Iwahashi-Shima, C.; Azumi, A.; Ohguro, N.; Okada, A.A.; Kaburaki, T.; Goto, H.; Sonoda, K.H.; Namba, K.; Mizuki, N.; Mochizuki, M. Acute retinal necrosis: Factors associated with anatomic and visual outcomes. Jpn. J. Ophthalmol. 2013, 57, 98–103. [Google Scholar] [CrossRef] [PubMed]
  45. Sugita, S.; Ogawa, M.; Shimizu, N.; Morio, T.; Ohguro, N.; Nakai, K.; Maruyama, K.; Nagata, K.; Takeda, A.; Usui, Y.; et al. Use of a comprehensive polymerase chain reaction system for diagnosis of ocular infectious diseases. Ophthalmology 2013, 120, 1761–1768. [Google Scholar] [CrossRef]
  46. Chalam, K.V.; Shah, V.A. Optics of wide-angle panoramic viewing system-assisted vitreous surgery. Surv. Ophthalmol. 2004, 49, 437–445. [Google Scholar] [CrossRef]
  47. Androudi, S.; Praidou, A.; Symeonidis, C.; Tsironi, E.; Iaccheri, B.; Fiore, T.; Tsinopoulos, I.; Brazitikos, P. Safety and efficacy of small incision, sutureless pars plana vitrectomy for patients with posterior segment complications secondary to uveitis. Acta Ophthalmol. 2012, 90, 409–410. [Google Scholar] [CrossRef]
  48. Van der Lelij, A.; Rothova, A. Diagnostic anterior chamber paracentesis in uveitis: A safe procedure? Br. J. Ophthalmol. 1997, 81, 976–979. [Google Scholar] [CrossRef]
  49. Arimura, E.; Deai, T.; Maruyama, K.; Uno, N.; Yamamoto, H.; Matsumoto, C.; Shimomura, Y. Herpes simplex virus-2 quantification by real-time polymerase chain reaction in acute retinal necrosis. Jpn. J. Ophthalmol. 2005, 49, 64–65. [Google Scholar] [CrossRef]
  50. Abe, T.; Tsuchida, K.; Tamai, M. A comparative study of the polymerase chain reaction and local antibody production in acute retinal necrosis syndrome and cytomegalovirus retinitis. Graefes. Arch. Clin. Exp. Ophthalmol. 1996, 234, 419–424. [Google Scholar] [CrossRef]
  51. De Groot-Mijnes, J.D.; Rothova, A.; Van Loon, A.M.; Schuller, M.; Ten Dam-Van Loon, N.H.; De Boer, J.H.; Schuurman, R.; Weersink, A.J. Polymerase chain reaction and Goldmann-Witmer coefficient analysis are complimentary for the diagnosis of infectious uveitis. Am. J. Ophthalmol. 2006, 141, 313–318. [Google Scholar] [CrossRef] [PubMed]
  52. Takase, H.; Okada, A.A.; Goto, H.; Mizuki, N.; Namba, K.; Ohguro, N.; Sonoda, K.H.; Tomita, M.; Keino, H.; Kezuka, T.; et al. Development and validation of new diagnostic criteria for acute retinal necrosis. Jpn. J. Ophthalmol. 2015, 59, 14–20. [Google Scholar] [CrossRef] [PubMed]
  53. Shantha, J.G.; Weissman, H.M.; Debiec, M.R.; Albini, T.A.; Yeh, S. Advances in the management of acute retinal necrosis. Int. Ophthalmol. Clin. 2015, 55, 1–13. [Google Scholar] [CrossRef] [PubMed]
  54. Tran, T.H.; Rozenberg, F.; Cassoux, N.; Rao, N.A.; LeHoang, P.; Bodaghi, B. Polymerase chain reaction analysis of aqueous humour samples in necrotising retinitis. Br. J. Ophthalmol. 2003, 87, 79–83. [Google Scholar] [CrossRef]
  55. Meghpara, B.; Sulkowski, G.; Kesen, M.R.; Tessler, H.H.; Goldstein, D.A. Long-term follow-up of acute retinal necrosis. Retina 2010, 30, 795–800. [Google Scholar] [CrossRef]
  56. Palay, D.A.; Sternberg, P., Jr.; Davis, J.; Lewis, H.; Holland, G.N.; Mieler, W.F.; Douglas, A.J.; Drews, C. Decrease in the risk of bilateral acute retinal necrosis by acyclovir therapy. Am. J. Ophthalmol. 1991, 112, 250–255. [Google Scholar] [CrossRef]
  57. Tibbetts, M.D.; Shah, C.P.; Young, L.H.; Duker, J.S.; Maguire, J.I.; Morley, M.G. Treatment of acute retinal necrosis. Ophthalmology 2010, 117, 818–824. [Google Scholar] [CrossRef]
  58. Jabs, D.A.; Nussenblatt, R.B.; Rosenbaum, J.T. Standardization of uveitis nomenclature for reporting clinical data. Results of the First International Workshop. Am. J. Ophthalmol. 2005, 140, 509–516. [Google Scholar]
  59. Nussenblatt, R.B.; Palestine, A.G.; Chan, C.C.; Roberge, F. Standardization of vitreal inflammatory activity in intermediate and posterior uveitis. Ophthalmology 1985, 92, 467–471. [Google Scholar] [CrossRef]
  60. Holland, G.N.; Buhles, W.C., Jr.; Mastre, B.; Kaplan, H.J. A controlled retrospective study of ganciclovir treatment for cytomegalovirus retinopathy. Use of a standardized system for the assessment of disease outcome. UCLA CMV Retinopathy. Study Group Arch. Ophthalmol. 1989, 107, 1759–1766. [Google Scholar] [CrossRef]
Figure 1. Representative results of a VZV-positive vitreous fluid sample (No. 11) analyzed using the combination PCR system. (A) Representative result of VZV-positive VF sample by qualitative multiplex PCR. After DNA extraction from the VF sample, multiplex PCR was performed to screen for viruses using LightCycler capillaries. At 60 °C, a significant positive curve was detected, indicating the detection of VZV-DNA in the sample. At the same time, other HHVs such as HSV type 1, type 2, and CMV were confirmed to be negative for this sample. (B) Representative result of the same VZV-positive VF sample analyzed by quantitative real-time PCR (qPCR). The VZV genome copy number in the sample was calculated. The VF sample and control DNA (1.0 × 106, 104, 102, and 101 copies/mL) by the qPCR were tested, and a standard curve using the results of control DNA was generated. Values were considered to be significant when more than 1.0 × 103 copies/ml in the sample were observed. In the qPCR assay, we conducted with positive controls, negative control (water), and sample in the duplicate well assay. Representative single curves of each positive control and sample are present in the graph. PCR: polymerase chain reaction, VF: vitreous fluid, VZV: varicella-zoster virus.
Figure 1. Representative results of a VZV-positive vitreous fluid sample (No. 11) analyzed using the combination PCR system. (A) Representative result of VZV-positive VF sample by qualitative multiplex PCR. After DNA extraction from the VF sample, multiplex PCR was performed to screen for viruses using LightCycler capillaries. At 60 °C, a significant positive curve was detected, indicating the detection of VZV-DNA in the sample. At the same time, other HHVs such as HSV type 1, type 2, and CMV were confirmed to be negative for this sample. (B) Representative result of the same VZV-positive VF sample analyzed by quantitative real-time PCR (qPCR). The VZV genome copy number in the sample was calculated. The VF sample and control DNA (1.0 × 106, 104, 102, and 101 copies/mL) by the qPCR were tested, and a standard curve using the results of control DNA was generated. Values were considered to be significant when more than 1.0 × 103 copies/ml in the sample were observed. In the qPCR assay, we conducted with positive controls, negative control (water), and sample in the duplicate well assay. Representative single curves of each positive control and sample are present in the graph. PCR: polymerase chain reaction, VF: vitreous fluid, VZV: varicella-zoster virus.
Jcm 09 01204 g001
Figure 2. Comparisons of viral loads in ocular fluids before and after initiation of intravenous acyclovir treatment. Comparisons of viral loads between (A) Pre-AH (Total) and Post-AH (2 days), (B) Pre-AH (≤ 3 days) and Post-AH (2 days), (C) Pre-AH (> 3 days) and Post-AH (2 days), (D) Pre-AH (≤ 3 days) and Pre-AH (> 3 days) and (E) VF (≤ 3 days) and VF (> 3 days) are shown. The box plot represents the median, 25/75 percentiles, and 10/90 percentiles. Total: all of Pre-AH samples collected before PPV, 2 days: sample collected two days after initiation of the treatment, ≤ 3 days: sample collected within three days after initiation of the treatment, > 3 days: sample collected more than 3 days after initiation of the treatment. The number of samples in each group: Pre-AH (Total); eight eyes, Pre-AH (≤ 3 days); three eyes, Pre-AH (> 3 days); five eyes, Post-AH; three eyes, VF (≤ 3 days); seven eyes, VF (> 3 days); three eyes. Post-AH: aqueous humor collected during PPV conducted after the treatment. Pre-AH: aqueous humor samples collected before intravenous acyclovir treatment, PPV: pars plana vitrectomy, VF: vitreous fluid samples collected during PPV conducted after the treatment.
Figure 2. Comparisons of viral loads in ocular fluids before and after initiation of intravenous acyclovir treatment. Comparisons of viral loads between (A) Pre-AH (Total) and Post-AH (2 days), (B) Pre-AH (≤ 3 days) and Post-AH (2 days), (C) Pre-AH (> 3 days) and Post-AH (2 days), (D) Pre-AH (≤ 3 days) and Pre-AH (> 3 days) and (E) VF (≤ 3 days) and VF (> 3 days) are shown. The box plot represents the median, 25/75 percentiles, and 10/90 percentiles. Total: all of Pre-AH samples collected before PPV, 2 days: sample collected two days after initiation of the treatment, ≤ 3 days: sample collected within three days after initiation of the treatment, > 3 days: sample collected more than 3 days after initiation of the treatment. The number of samples in each group: Pre-AH (Total); eight eyes, Pre-AH (≤ 3 days); three eyes, Pre-AH (> 3 days); five eyes, Post-AH; three eyes, VF (≤ 3 days); seven eyes, VF (> 3 days); three eyes. Post-AH: aqueous humor collected during PPV conducted after the treatment. Pre-AH: aqueous humor samples collected before intravenous acyclovir treatment, PPV: pars plana vitrectomy, VF: vitreous fluid samples collected during PPV conducted after the treatment.
Jcm 09 01204 g002
Figure 3. Comparison and correlation of viral loads in ocular fluids of the same patients before and after intravenous acyclovir treatment. (A) Paired samples of Pre-AH and VF in ARN patients with VZV infection. (B) Paired samples of Post-AH and VF in ARN patients with VZV infection. R2: coefficient of determination, rs: Spearman’s rank correlation coefficient, ≒: approximately equal, *: p < 0.05.
Figure 3. Comparison and correlation of viral loads in ocular fluids of the same patients before and after intravenous acyclovir treatment. (A) Paired samples of Pre-AH and VF in ARN patients with VZV infection. (B) Paired samples of Post-AH and VF in ARN patients with VZV infection. R2: coefficient of determination, rs: Spearman’s rank correlation coefficient, ≒: approximately equal, *: p < 0.05.
Jcm 09 01204 g003
Table 1. Clinical summary of patients with suspected ARN and viral loads of ocular fluids.
Table 1. Clinical summary of patients with suspected ARN and viral loads of ocular fluids.
Pt. No.AgeGenderLateralityFinal DiagnosisBefore Antivirus TreatmentDrugTreatment PeriodDuring Surgery
SamplePathogenViral LoadSamplePathogenViral LoadSamplePathogenViral Load
140FLVZVAqueous humorVZV1.73 × 106Aciclovir i.v.4 days
245MRVZVAqueous humorVZV8.87 × 106Aciclovir i.v.6 days
375MRVZVAqueous humorVZV3.00 × 107Aciclovir i.v.8 days
450MRVZVAqueous humorVZV6.00 × 107Aciclovir i.v.3 days
564MLVZVAqueous humorVZV5.23 × 106Aciclovir i.v.7 days Vitreous fluidVZV4.30 × 107
647FLVZVAqueous humorVZV1.23 × 107Valaciclovir oral1 day Vitreous fluidVZV1.64 × 108
781MLVZVAqueous humorVZV1.43 × 108Aciclovir i.v.1 day Vitreous fluidVZV3.59 × 108
853MRVZVAqueous humorVZV1.53 × 108Valaciclovir oral5 days Vitreous fluidVZV1.03 × 109
967MLCMVAqueous humorCMV1.74 × 107Aciclovir i.v.1 day Vitreous fluidCMV6.10 × 107
1064MLVZVAqueous humorVZV2.47 × 104Aciclovir i.v.3 days Vitreous fluidVZV1.26 × 105
1145FLVZVAqueous humorVZV4.62 × 104Aciclovir i.v.8 days Vitreous fluidVZV2.05 × 107
1286FLVZV Aciclovir i.v.1 day Vitreous fluidVZV1.06 × 106
13 *75FRVZV Aciclovir i.v.1 day Vitreous fluidVZV3.50 × 107
14 *75FLVZV Aciclovir i.v.5 days Vitreous fluidVZV4.40 × 107
1583FLVZV Vancomycin/Ceftazidime i.v.0 day Vitreous fluidVZV2.41 × 108
1641MLVZV Aciclovir i.v.2 dayAqueous humor VZV1.89 × 107Vitreous fluidVZV2.40 × 109
1777FRVZV Aciclovir i.v.2 dayAqueous humor VZV1.80 × 107Vitreous fluidVZV7.80 × 108
1850MRVZV Aciclovir i.v.2 dayAqueous humor VZV5.02 × 107Vitreous fluidVZV7.47 × 108
Eighteen eyes of 17 patients with suspected ARN were enrolled. The eyes of No. 13 and No 14 belonged to the same patient. In four cases (22.2%) of suspected ARN (upper rows with gray background), the pathogenic virus (VZV) was promptly confirmed by the combination PCR system using aqueous humor samples collected before systemic antiviral treatments, and optimal antiviral treatments were initiated before therapeutic PPV. Viral load is given in units of copies/mL. The PCR test was regarded positive in specimens with more than 5.0 × 103 copies/mL, and the detected virus was confirmed as a pathogen. ARN: acute retinal necrosis, CMV: cytomegalovirus, i.v.: intravenous drip, PCR: polymerase chain reaction, PPV: pars plana vitrectomy, VZV: varicella-zoster virus, * Eyes of the same patient.
Table 2. Sequences of primers and probes for detecting human herpes viruses using qualitative multiplex PCR.
Table 2. Sequences of primers and probes for detecting human herpes viruses using qualitative multiplex PCR.
Herpes VirusPrimer SequenceProbe SequenceAmplicationReferences
HSV-1 and HSV-2 *F: GCTCGAGTGCGAAAAAACGTTC3′FITC: GCGCACCAGATCCACGCCCTTGATGAGCpolymerase[19]
R: TGCGGTTGATAAACGCGCAGTLcRed604-5′: CTTGCCCCCGCAGATGACGCC
varicella zoster virusF: TGTCCTAGAGGAGGTTTTATCTG3′FITC: GGGAAATCGAGAAACCACCCTATCCGACgene 29[20]
R: CATCGTCTGTAAAGACTTAACCAGLcRed640-5′: AAGTTCGCGGTATAATTGTCAGT
Epstein–Barr virusF: CGCATAATGGCGGACCTAG3′FITC: AAAGATAGCAGCAGCGCAGCBamH1[21]
R: CAAACAAGCCCACTCCCCLcRed640-5′: AACCATAGACCCGCTTCCTG
cytomegalovirusF: TACCCCTATCGCGTGTGTTC3′FITC: TCGTCGTAGCTACGCTTACATCMV glycoprotein [22]
R: ATAGGAGGCGCCACGTATTCLcRed705-5′: ACACCACTTATCTGCTGGGCAGC
HHV type 6F: ACCCGAGAGATGATTTTGCG3′FITC: TAAGTAACCGTTTCGTCCCA101K gene region[23]
R: GCAGAAGACAGCAGCGAGATLcRed705-5′: GGGTCATTTATGTTATAGA
HHV type 7F: GAAAAATCCGCCATAATAGC3′FITC: GCCATAAGAAACAGGTACAGACATTGTCAU57[24]
R: ATGGAACACCTATTAACGGCLcRed705-5′: TTGTGAAATGTGTTGCG
HHV type 8F: AGCCGAAAGGATTCCACCAT3′FITC: CCGGATGATGTAAATATGGCGGAACEB BDLF1 ORF26[25]
R: TCCGTGTTGTCTACGTCCAGLcRed705-5′: TGATCTATATACCACCAATGTGTCATTTATG
The qualitative multiplex PCR for HSV detects both HSV type 1 and type 2 DNA in the same reaction. * The optimized polymerase primer pair is common for HSV type 1 and type 2. On the other hand, the polymerase probe pair completely matches the genomic sequence of HSV type 2, but there are two base mismatches between the sequences of the probe pair and HSV type 1 genome. Therefore, the Tm of HSV type 1 is 15 °C higher than that of HSV type 2, and the difference in Tm provides a fine distinction between HSV type 1 and type 2. F: forward primer, HHV: human herpesvirus, HSV: herpes simplex virus, R: reverse primer.
Table 3. Sequences of primers and probes in human herpes viruses using quantitative real-time PCR.
Table 3. Sequences of primers and probes in human herpes viruses using quantitative real-time PCR.
Herpes VirusPrimer SequenceProbe SequenceAmplicationReferences
HSV type1F: CGCATCAAGACCACCTCCTCJOE-TGGCAACGCGGCCCAAC-TAMRAgB[26]
R: GCTCGCACCACGCGA
HSV type2F: CGCATCAAGACCACCTCCTCFAM-CGGCGATGCGCCCCAG-TAMRAgB
R: GCTCGCACCACGCGA
varicella zoster virusF: AACTTTTACATCCAGCCTGGCGFAM-TGTCTTTCACGGAGGCAAACACGT-TAMRAORF29[27]
R: GAAAACCCAAACCGTTCTCGAG
Epstein–Barr virusF: CGGAAGCCCTCTGGACTTCFAM-TGTACACGCACGAGAAATGCGCC-TAMRABALF5[28]
R: CCCTGTTTATCCGATGGAATG
cytomegalovirusF: CATGAAGGTCTTTGCCCAGTACFAM-TGGCCCGTAGGTCATCCACACTAGG-TAMRAIE-1[29]
R: GGCCAAAGTGTAGGCTACAATAG
HHV type 6F: GACAATCACATGCCTGGATAATGFAM-AGCAGCTGGCGAAAAGTGCTGTGC-TAMRAU65-U66[30]
R: TGTAAGCGTGTGGTAATGTACTAA
HHV type 7F: CGGAAGTCACTGGAGTAATGACAAFAM-CTCGCAGATTGCTTGTTGGCCATG-TAMRAU37[31]
R: CCAATCCTTCCGAAACCGAT
HHV type 8F: CCTCTGGTCCCCATTCATTGFAM-CCGGCGTCAGACATTCTCACAACC-TAMRAORF65[32]
R: CGTTTCCGTCGTGGATGAG
The quantitative real-time PCR for HSV is a multiplexing PCR that detects both HSV type 1 and type 2 DNA in the same reaction. The optimized gB primer pairs amplify both HSV type 1 and type 2 with equal efficiency, but the two type-specific probes are labeled with different fluorescent dyes. HSV type 1 probe is labeled with JOE at the 5′-end and with TAMRA at the 3′-end. HSV type 2 probe is labeled with FAM at the 5′-end and with TAMRA at the 3′-end. FAM: carboxyfluorescein, TAMRA: tetramethylrhodamine.
Table 4. Clinical characteristics of ARN patients with VZV infection classified into four groups according to type of ocular fluid sample.
Table 4. Clinical characteristics of ARN patients with VZV infection classified into four groups according to type of ocular fluid sample.
SpecimenPre-AHPre-AH and VFVFPost-AH and VFp Value
N4433Among 4 goups
Age (year)52.5 ± 15.5 (47.5)63.5 ± 14.7 (64.0)80.5 ± 7.78 (80.5)56.0 ± 18.7 (50.0)0.277
Gender (M/F)3/13/10/22/10.531
Laterality (R/L)3/10/41/22/10.531
Detection N (%)4 (100)4 (100)3 (100)3 (100)
ARN patients with VZV infection were divided into four groups according to the type of ocular fluid sample. There was no overlap of patients among the four groups. Data are expressed as means ± standard deviations (median). Post-AH: aqueous humor samples collected during PPV after intravenous acyclovir treatment, Pre-AH: aqueous humor samples collected before the treatment, VF: vitreous fluid samples collected during PPV after the treatment. F: female, L: left, M: male, N: number, R: right.

Share and Cite

MDPI and ACS Style

Sato, T.; Yamamoto, W.; Tanaka, A.; Shimazaki, H.; Sugita, S.; Kaburaki, T.; Takeuchi, M. Viral Loads in Ocular Fluids of Acute Retinal Necrosis Eyes Infected by Varicella-Zoster Virus Treated with Intravenous Acyclovir Treatment. J. Clin. Med. 2020, 9, 1204. https://doi.org/10.3390/jcm9041204

AMA Style

Sato T, Yamamoto W, Tanaka A, Shimazaki H, Sugita S, Kaburaki T, Takeuchi M. Viral Loads in Ocular Fluids of Acute Retinal Necrosis Eyes Infected by Varicella-Zoster Virus Treated with Intravenous Acyclovir Treatment. Journal of Clinical Medicine. 2020; 9(4):1204. https://doi.org/10.3390/jcm9041204

Chicago/Turabian Style

Sato, Tomohito, Wataru Yamamoto, Atsushi Tanaka, Haruna Shimazaki, Sunao Sugita, Toshikatsu Kaburaki, and Masaru Takeuchi. 2020. "Viral Loads in Ocular Fluids of Acute Retinal Necrosis Eyes Infected by Varicella-Zoster Virus Treated with Intravenous Acyclovir Treatment" Journal of Clinical Medicine 9, no. 4: 1204. https://doi.org/10.3390/jcm9041204

APA Style

Sato, T., Yamamoto, W., Tanaka, A., Shimazaki, H., Sugita, S., Kaburaki, T., & Takeuchi, M. (2020). Viral Loads in Ocular Fluids of Acute Retinal Necrosis Eyes Infected by Varicella-Zoster Virus Treated with Intravenous Acyclovir Treatment. Journal of Clinical Medicine, 9(4), 1204. https://doi.org/10.3390/jcm9041204

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop