Next Article in Journal
Systematic Review of the Role of Biomarkers in Predicting Anastomotic Leakage Following Gastroesophageal Cancer Surgery
Previous Article in Journal
Exploring a New Natural Treating Agent for Primary Hypertension: Recent Findings and Forthcoming Perspectives
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

High Prevalence of Antibiotic Resistance in Iranian Helicobacter pylori Isolates: Importance of Functional and Mutational Analysis of Resistance Genes and Virulence Genotyping

1
Foodborne and Waterborne Diseases Research Center, Research Institute for Gastroenterology and Liver Diseases, Shahid Beheshti University of Medical Sciences, Tehran 1985717411, Iran
2
Gastroenterology and Liver Diseases Research Center, Research Institute for Gastroenterology and Liver Diseases, Shahid Beheshti University of Medical Sciences, Tehran 1985717411, Iran
3
Basic and Molecular Epidemiology of Gastrointestinal Disorders Research Center, Research Institute for Gastroenterology and Liver Diseases, Shahid Beheshti University of Medical Sciences, Tehran 1985717411, Iran
4
School of Medicine & School of Pharmacy and Pharmaceutical Sciences, Trinity College Dublin, Dublin 2, Ireland
5
Bacteriology, University of Paris-Descartes, Cochin Hospital, 75006 Paris, France
6
Division of Gastroenterology and Hepatology, Department of Internal Medicine, Tokai University School of Medicine, 143 Shimokasuya, Isehara, Kanagawa 259-1193, Japan
*
Author to whom correspondence should be addressed.
J. Clin. Med. 2019, 8(11), 2004; https://doi.org/10.3390/jcm8112004
Submission received: 2 October 2019 / Revised: 11 November 2019 / Accepted: 14 November 2019 / Published: 17 November 2019
(This article belongs to the Section Infectious Diseases)

Abstract

The high prevalence of antibiotic resistance in Helicobacter pylori has become a great challenge in Iran. The genetic mutations that contribute to the resistance have yet to be precisely identified. This study aimed to investigate the prevalence of antibiotic resistance and virulence markers in Iranian H. pylori isolates and to analyze if there is any association between resistance and genotype. Antibiotic susceptibility patterns of 68 H. pylori isolates were investigated against metronidazole, clarithromycin, amoxicillin, rifampicin, ciprofloxacin, levofloxacin, and tetracycline by the agar dilution method. The frxA, rdxA, gyrA, gyrB, and 23S rRNA genes of the isolates were sequenced. The virulence genotypes were also determined using PCR. Metronidazole resistance was present in 82.4% of the isolates, followed by clarithromycin (33.8%), ciprofloxacin (33.8%), rifampicin (32.4%), amoxicillin (30.9%), levofloxacin (27.9%), and tetracycline (4.4%). Overall, 75% of the isolates were resistant to at least two antibiotics tested and considered as a multidrug resistance (MDR) phenotype. Most of the metronidazole-resistant isolates carried frameshift mutations in both frxA and rdxA genes, and premature termination occurred in positions Q5Stop and Q50Stop, respectively. Amino acid substitutions M191I, G208E, and V199A were predominantly found in gyrA gene of fluoroquinolone-resistant isolates. A2143G and C2195T mutations of 23S rRNA were found in four clarithromycin-resistant isolates. Interestingly, significant associations were found between resistance to metronidazole (MNZ) and cagA-, sabA-, and dupA-positive genotypes, with p = 0.0002, p = 0.0001, and p = 0.0001, respectively. Furthermore, a significant association was found between oipA “on” status and resistance to amoxicillin (AMX) (p = 0.02). The prevalence of H. pylori antibiotic resistance is high in our region, particularly that of metronidazole, clarithromycin, ciprofloxacin, and MDR. Simultaneous screening of virulence and resistance genotypes can help clinicians to choose the appropriate therapeutic regime against H. pylori infection.

1. Introduction

Helicobacter pylori (H. pylori) is known as the most common human pathogen infecting more than half of the world’s population [1,2]. Early eradication-based therapies have been proven to regress the H. pylori-associated diseases [3,4]. However, the efficacy of eradication treatments has been extremely compromised primarily because of increased resistance to antimicrobial agents in many countries [5,6,7,8].
Today, first-line standard triple therapy is the most widely used eradication treatment for H. pylori infection, which typically comprises two of three antibiotics including amoxicillin, clarithromycin, and metronidazole in combination with one proton pump inhibitor (PPI) [3,9]. However, the uses of levofloxacin or ciprofloxacin in fluoroquinolone containing triple therapy and bismuth-based quadruple therapy have also been suggested as second-line therapies after the failure of the clarithromycin-containing regimens [10,11,12]. Furthermore, tetracycline and rifampicin are among the common antibiotics that have been used in several rescue therapies recommended in the eradication of H. pylori infection [13,14,15].
Previous studies have demonstrated that numerous point mutations resulting from genetic plasticity within the chromosomal genes are the main antibiotic resistance mechanism among H. pylori strains in various geographic regions [5,6,16,17,18]. Primary resistance to clarithromycin has been mainly associated with point mutations in the peptidyl transferase region encoded in domain V of 23S rRNA. Most of these mutations include nucleotide substitutions involving an adenine to guanine transition at positions 2142 and 2143 and, to a lesser extent, an adenine to cytosine transversion at position 2142 [8,10,19]. However, several other mutations associated with clarithromycin resistant isolates seem to be emerging [20,21]. The mechanisms of metronidazole resistance in H. pylori are frequently attributed to inactivating mutations in rdxA and frxA genes [22,23]. On the other hand, mutational changes leading to various amino acid substitutions that confer fluoroquinolone resistance have been located in different positions of the quinolone-resistant determining region (QRDR) of gyrA and gyrB genes [19,24].
Apart from the aforementioned mechanisms of resistance developed by H. pylori strains to the major antibiotics used in the treatment of infection, other factors such as the virulence genotype status of bacteria have been reported to affect drug resistance [25,26,27,28,29]. However, the exact underlying mechanisms involved in the crosstalk of H. pylori virulence and antimicrobial resistance remained to be clarified.
Hence, the focus of the present study was to evaluate the antibiotic susceptibility patterns and underlying resistance mechanisms of H. pylori strains isolated from Iranian patients with different gastric diseases. Furthermore, we determined the presence of genetic mutations that are associated with antibiotic resistance. We also examined the possible association between resistance profiles and a panel of virulence genotypes.

2. Materials and Methods

2.1. Patients and H. pylori Isolates

Antral biopsies were collected for culture from 160 patients who underwent upper gastroduodenal endoscopy at Taleghani Hospital in Tehran from February 2016 to August 2017. Patients were excluded if they were taking eradication therapy for H. pylori, PPIs, or H2-receptor blockers, and any antibiotics used for other infections within two weeks prior to enrolment. The study protocol was approved by the Ethical Review Committee of the Research Institute for Gastroenterology and Liver Diseases at Shahid Beheshti University of Medical Sciences (Project No. IR.SBMU.RIGLD.REC.1395.878). All experiments were performed in accordance with relevant guidelines and regulations recommended by the institution and informed consents were obtained from all subjects and/or their legal guardians prior to sample collection.
The biopsy specimens were smeared on Brucella agar (Merck, Darmstadt, Germany) plates containing 7% horse blood (v/v), 10% fetal calf serum (FCS), Campylobacter supplement (Skirrow, Quelab, Montreal, Quebec, Canada), and amphotericin B (2.5 mg/L). The inoculated plates were incubated at 37 °C in a CO2 incubator under microaerophilic atmosphere containing approximately 5% O2, 10% CO2, and 85% N2 for 3–7 days. The H. pylori was identified by colony and microscopic morphology, positive catalase, oxidase, and urease tests, and confirmed by molecular assays [30,31,32].

2.2. Antibiotic Susceptibility Testing

The antibiotic susceptibility of the H. pylori strains was assessed by the agar dilution method against a panel of seven antibiotics purchased from Sigma-Aldrich (St. Louis, MO, USA), including metronidazole (MNZ), clarithromycin (CLR), amoxicillin (AMX), rifampicin (RIF), ciprofloxacin (CIP), levofloxacin (LEV), and tetracycline (TCN). The range of antibiotic concentrations was as follows: 0.25–256 mg/L for MNZ, 0.06 to 64 mg/L for CLR, 0.03 to 4 mg/L for AMX, 0.03 to 32 mg/L for RIF and LEV, 0.06 to 32 mg/L for CIP, and 0.06 to 16 mg/L for TCN. H. pylori inoculums were prepared from 72 h old cultures that were suspended in sterile saline and adjusted to a density equal to No. 3 McFarland standard. The bacterial suspensions were inoculated directly onto Mueller–Hinton blood agar (Merck, Darmstadt, Germany) plates supplemented with 10% defibrinated horse blood containing antibiotic dilutions, and were incubated under microaerophilic conditions, as over-mentioned. After 72 hours of incubation, the minimal inhibition concentrations (MICs) were determined as the lowest concentration of antibiotic that completely inhibited the growth of the inoculums. The resistance breakpoints were used as described by the last guideline of European Committee on Antimicrobial Susceptibility Testing (EUCAST version 8.0, http://www.eucast.org/). Strains were considered to be resistant for MICs of >8 mg/L for MNZ; >0.125 mg/L for AMX; and >1 mg/L for RIF, CIP, LEV, and TCN. Clarithromycin MICs were interpreted based on CLSI breakpoints (≤0.25 mg/L, susceptible; 0.5 mg/L, intermediate; ≥1.0 mg/L, resistant) [33]. H. pylori strains with resistance to at least two antimicrobial agents were considered as isolates with the multidrug resistance (MDR) phenotype [34]. A clinical isolate of H. pylori with previously identified MIC values served as a quality control strain in all susceptibility tests [35].

2.3. Genomic DNA Extraction

Subcultures of the single colonies were prepared, and confluent cultures from each colony were used for DNA extraction using QIAamp DNA extraction kit (QIAgen®, Hilden, Germany), following the manufacturer’s directions. The DNA samples were stored at −20 °C until used for gene amplification.

2.4. Mutation Analysis of the Resistance Genes

To detect specific mutations in the frxA, rdxA, gyrA, gyrB, and 23S rRNA genes, a PCR-based sequencing approach was carried out for a selected number of H. pylori isolates, including the susceptible and resistant strains. The oligonucleotide primers are shown in Table 1. The PCR products were sequenced on both strands by the Sanger sequencing method using an automated sequencer (Macrogen, Seoul, Korea). All complete and partial DNA sequences were edited by Chromas Lite version 2.5.1 (Technelysium Pty Ltd, Australia). Comparative sequence analysis between resistant and sensitive strains was carried out using BioEdit software version 7.2.5 [36]. The DNA and deduced amino acid sequences were aligned and coordinated to H. pylori 26695 (GenBank: CP003904.1) as a reference sequence.

2.5. Detection of Virulence Markers

The presence of virulence factors including cagA, cagL, and vacA alleles (s1/s2 and m1/m2), as well as babA2, sabA, and dupA genes, were assessed by PCR [37,38]. The diversity of the cagA C-terminal variable region, the functional (on/off) status of oipA gene, and the intactness of the cagPAI locus was also analyzed by the PCR-sequencing method [30,39,40]. H. pylori J99 (CCUG 47164) and a no-template reaction were used as positive and negative controls in all amplifications, respectively. The sequences of oligonucleotide primers are presented in Table 1.

2.6. Nucleotide Sequence Accession Numbers

The sequences obtained from this study were submitted to NCBI under the following GenBank accession numbers: domain V 23S rRNA, MH040926-MH040949; gyrA, MH054262-MH054292; gyrB, MH054293-MH054319; frxA, MH054320-MH054346; rdxA, MH054347-MH054374.

2.7. Statistical Analysis

The SPSS Statistics for Windows (version 21.0, IBM Corp, Armonk, NY, USA) was used to perform all statistical analyses. Chi-square and Fisher’s exact tests were used to determine the statistical significance of differences between categorical variables. A p-value of less than 0.05 was considered as statistically significant.

3. Results

3.1. Characteristics of Patients

Totally, 68 (42.5%) H. pylori isolates were cultured from antral biopsies of the patients included in the study. The H. pylori infected patients consisted of 31 (45.6%) men and 37 (54.4%) women, with an average age of 46.5 ± 8.3 years old (range 23–75 years). Endoscopic diagnosis showed that 43 patients had chronic gastritis (CG), 18 had peptic ulcer disease (PUD), and 7 had intestinal metaplasia (IM).

3.2. Prevalence of Antibiotic Resistance

Overall, the metronidazole resistant detection rate was 82.4% (56/68), and the lowest resistance rate was observed against tetracycline in 3/68 (4.4%) isolates. Resistance to clarithromycin, rifampicin, and amoxicillin was observed in 23/68 (33.8%), 22/68 (32.4%), and 21/68 (30.9%) of isolates, respectively. Five (7.4%) isolates were found as intermediate to clarithromycin. H. pylori resistance to ciprofloxacin and levofloxacin was detected in 23/68 (33.8%) and 19/68 (27.9%) of isolates, respectively. Only one isolate was found to be susceptible to all antibiotics examined. The rate of resistance to metronidazole, clarithromycin, amoxicillin, and levofloxacin was higher in patients with PUD and IM than with CG patients. Inversely, the rate of resistance to rifampicin was higher in CG patients than with PUD and IM. There were no important differences in the rate of resistance to ciprofloxacin and tetracycline between CG and with PUD and IM patients. All patients with IM were resistant to metronidazole. The MIC range, MIC50/MIC90, prevalence of resistance, and distribution of MIC values for the H. pylori strains are shown in Table 2 and Table 3.

3.3. Rate of MDR Phenotype

Single-drug resistance (SDR) was observed in 16/68 (23.5%) isolates, in which resistance to metronidazole was the most frequent SDR phenotype (9/16, 56.2%). Totally, 51/68 (75%) isolates showed multidrug resistance (MDR) phenotype, and 17 different MDR profiles were detected. No isolate was resistant to all tested antibiotics. The distribution of the SDR and MDR profiles within various clinical diagnosis groups is shown in Table 4. Almost all of the isolates from patients with IM and most of the PUD isolates showed an MDR phenotype. Resistance to MNZ + RIF was the most common double-drug resistance profile (6/20, 30%). Resistance to MNZ was found in all isolates with triple-drug and quadruple-drug resistance profiles. Resistance to TCN was only found in isolates with quadruple-drug resistance profiles.

3.4. Genetic Variations of frxA and rdxA Genes

Totally, 27 of the frxA and 28 of the rdxA genes obtained from all isolates were sequenced and analyzed, as shown in Table 5. Fourteen (51.8%) isolates exhibiting resistance to metronidazole predominantly carried insertions and/or deletions resulting in translational frameshift mutations in the FrxA. One isolate was found to have a stop codon at position Q5Stop, resulting in premature termination codon (PTC), while missense mutations were found in 11/27 (40.7%) isolates. In addition, about one-third (10/28, 35.7%) of the isolates were found to have frameshift mutations in the rdxA gene. Nonsense mutations resulting in PTC were identified in 3/28 (10.7%) isolates owing to codon substitutions at position Q50Stop of RdxA. Missense mutations were distributed among 5 susceptible and 10 resistant isolates of the rdxA genes. One resistant strain had no mutation in both genes. The peptide sequence alignments for the frxA and rdxA genes from metronidazole-susceptible and -resistant isolates in comparison with the reference strain are presented in Supplementary Figures S1 and S2, respectively.

3.5. Amino Acid Variations at the QRDR Region of gyrA and gyrB Genes

As shown in Table 6 and Supplementary Figures S3 and S4, selective regions in the QRDR of gyrA and gyrB genes were sequenced among 31 and 27 H. pylori isolates, respectively. Totally, 16 different amino acid substitutions were detected in gyrA subunit among all isolates. Three different amino acid variants including S63P, R140K, and A183V were detected to be exclusively present in gyrA of the fluoroquinolone-resistant isolates, whereas six different substitutions of A97V, D143E, A207T, G208K, I212S, and E214K were found to be present in the susceptible isolates only. In addition, seven other mutations were observed at D86N, D86G, V150A, M191I, V199A, G208A, and G208E in both fluoroquinolone-susceptible and -resistant isolates. The most frequent substitutions in gyrA of the fluoroquinolone-resistant isolates were M191I (14/23, 60.9%), G208E (13/25, 52%), and V199A (5/9, 55.5%), respectively. The M191I-G208E substitution was found to be the most common double mutation (8/12, 66.7%) within five resistant and three susceptible isolates, while the M191I-V199A-G208E was found as the most frequent triple substitutions (3/9, 33.3%) from two susceptible and one resistant isolates. The quadruple substitution was detected in gyrA of three resistant and three susceptible isolates.
As for the gyrB subunit, two different amino acid variants including D481E and R484K were detected among seven isolates. The D481E substitution was found to be present in both fluoroquinolone-susceptible and -resistant isolates, whereas R484K was exclusively present in resistant isolates. As shown in Table 6 and Supplementary Figure S4, two fluoroquinolone-susceptible isolates had the single D481E mutations, while five resistant isolates presented the double D481E-R484K only. No mutation of gyrB was found in 11 fluoroquinolone-resistant and 9 susceptible isolates.

3.6. Genetic Variations of the 23S rRNA Gene

The domain V of the 23S rRNA gene was sequenced in 24 H. pylori isolates. As shown in Supplementary Figure S5, this region was highly conserved with minimal nucleotide variations in comparison with H. pylori strain 26695 as the reference genome. Overall, four nucleotide transitions including A2143G and C2195T were identified in clarithromycin-resistant isolates. None of these mutations were observed among the susceptible isolates and no isolates were found to have double mutations of A2143G and C2195T. The distribution of MIC values according to the different mutations in all phenotypically resistant and susceptible isolates is presented in Table 7.

3.7. Association between Virulence Genotypes and Resistance Patterns

The frequency and distribution of strains grouped by virulence genotypes according to each susceptibility pattern are shown in Table 8. cagL-positive genotype was detected in all resistant isolates to CLR, CIP, LEV, RIF, and TCN. All resistant isolates to TCN were found to have the cagA-positive genotype. There was a significant association between the presence of cagA and resistance to MNZ (p = 0.0002). The cagA ABC motif was also found frequently in susceptible isolates, with the exception of metronidazole. The cagA ABCCC motif was detected in all resistant isolates to MNZ, AMX, and CIP. While no significant association was found between cagPAI integrity and antibiotic resistance (p > 0.05), most of the resistant isolates and all isolates resistant to TCN carried an intact cagPAI locus. H. pylori isolates with vacA s1m2 were found more frequently in resistant isolates to all antibiotics tested. Strains with oipA “on” status and babA2, sabA, and dupA positivity were also frequently found in resistant isolates. A significant association was found between oipA “on” status and resistance to AMX (p = 0.02). babA2-positive genotype was detected in all intermediate and resistant isolates to CLR, as well as in all isolates resistant to LEV and TCN. sabA-positive genotype was detected in all resistant isolates to TCN, and this genotype was significantly associated with resistance to MNZ (p = 0.0001). Further, there was a statistically significant association between dupA-positivity and resistance to MNZ (p = 0.0001).

4. Discussion

Eradication of H. pylori infection has been decreasing progressively, mainly because of increased resistance to antimicrobial agents, especially in developing countries [5,6,44,45,46,47]. In Iran, nearly 40–90% of the adult population is infected with H. pylori, which seems to be acquired early in childhood [35,37,48]. There have been few reports on the antibiotic resistance of H. pylori in Iran by performing the agar dilution method as the reference method for this bacterium [35,49,50,51]. Therefore, we carried out this work to determine the phenotypic and molecular characteristics of H. pylori antibiotic resistance, and to evaluate the association between resistance patterns and a wide panel of virulence genotypes. The prevalence of metronidazole resistance was reported to be high among Iranian H. pylori strains and ranged from 40.5% to 78.6% [49,51,52]. The results of this study showed an increased rate of metronidazole resistance (84.4%) as compared with previous reports from Iran [35,49,51]. A very high prevalence of metronidazole resistance has also been reported from other developing countries in Asia, including Bangladesh (77.5%), China (95.4%), India (83.8%), Kuwait (70%), Pakistan (89%), and Vietnam (69.9%) [47,53,54,55,56,57]. The extremely high rate of metronidazole resistance observed in this study might be attributed to the widespread and unauthorized consumption of antimicrobial drugs in Iran. In addition, massive use of metronidazole in the treatment of various infections such as anaerobic bacterial and parasitic infections, as well as for diarrheal, dental, periodontal, and gynecologic diseases, could explain the significantly high rate of metronidazole resistance in many developing countries [5,35,45,47]. Therefore, in agreement with other previous studies, H. pylori treatment regimens containing metronidazole are not useful and should not be chosen as first-line eradication therapy in Iran [5,45,46,47,58].
Previous studies demonstrated that various point mutations in frxA and rdxA genes were linked to metronidazole resistance in H. pylori [23,55,59]. As expected, different types of mutations including insertions, deletions, missense, nonsense, and frameshift mutations were detected among the studied strains. Our results showed that most of the metronidazole-resistant isolates presented frameshift mutations in these genes. Moreover, we found point mutations introducing stop codon at positions Q5Stop and Q50Stop in the frxA and rdxA genes, respectively. Many other nonsense mutations that lead to PTC have also been reported in rdxA and rarely in frxA genes [5,17,22,41,45,60,61]. However, in this study, one of the metronidazole-resistant isolate did not contain any alterations in both the frxA and rdxA genes. As previously suggested, metronidazole resistance in this small subset of isolates may be the result of the presence of additional resistance mechanisms and mutations in other redox enzymes [41,45,62].
Fluoroquinolones were proven to have bacteriostatic activities by trapping DNA gyrase and topoisomerase IV. These drugs are considered as a salvage treatment for H. pylori eradication in second- or third-line therapies after the failure of clarithromycin-based treatment regimens [12,24,63]. However, it has been reported that fluoroquinolone resistance is rapidly expanding around the world [6,7,57]. In a previous study from Iran, the rate of resistance to ciprofloxacin and levofloxacin was reported to be about 27% and 24.3%, respectively [35]. In this study, we found a significant increase of fluoroquinolone resistance, which is of great concern. Nevertheless, studies from Taiwanese and Malaysian populations revealed that gemifloxacin is superior to levofloxacin in antimicrobial activity and may have better drug efficacy than levofloxacin in H. pylori eradication [45,64].
Point mutations in the QRDR of gyrA and gyrB sequences greatly reduce the antimicrobial activity of fluoroquinolones. To date, several mutations have been identified in the gyrA subunit of H. pylori strains from different geographical regions [5,8,42,45,64,65,66,67,68]. None of the most common mutations in gyrA hot spot positions N87K, D91N, and D91G were detected in our isolates. However, 10 novel substitutions including S63P, D143E, A183V, A207T, G208K, G208A, G208E, I212S, E214K, and M191I were identified in the gyrA of either/both fluoroquinolone-resistant or/and -susceptible strains in this study. Among them, mutations M191I, G208E, and V199A were predominantly found in fluoroquinolone-resistant isolates. Moreover, gyrB mutations may rarely occur and have little impact on primary fluoroquinolone resistance [5,8,42,45,65,68]. In this study, only two amino acid changes, D481E and R484K, were identified in gyrB, in which R484K was exclusively present in resistant strains.
Among macrolides, clarithromycin is recognized as a major antibiotic for H. pylori eradication therapy because of its impact on treatment outcomes [20,69]. The rate of clarithromycin resistance is topically much lower than that of metronidazole. However, the rate of primary clarithromycin resistance is undoubtedly on the rise and varies between different geographical regions [7,8,47,57,70]. Unfortunately, the level of clarithromycin resistance in this study increased in comparison with a previous study from 26% to 33.8%, which is of great concern [35].
It has been claimed that the three most frequently reported mutations, including A2143G, A2142G, and A2142C, are responsible for more than 90% of the cases of primary resistance to clarithromycin [71,72]. However, in a recent study by De Francesco et al., this concordance was reduced to only 54.8%, with the A2142C mutation not being detected at all [20]. Moreover, some other mutations have been found to be associated with clarithromycin resistance, although their precise role is not yet clear [73]. In this study, only four mutations including A2143G and C2195T were found in our isolates. In contrast, Khashei et al. reported that A2142G was the most (90%) frequent point mutation among the isolates from southwest of Iran a PCR-RFLP method [74]. In addition, we failed to identify additional mutations such as T2183C and A2223G, which are frequently reported to be the cause of clarithromycin resistance in Eastern countries, rather than in Western countries [75]. Additionally, no point mutation was identified in the sequence of the 23S rRNA gene in four clarithromycin-resistant strains. For those isolates, we can speculate that other resistance mechanisms, such as the presence of an efflux pump, may be implicated in the development of resistance to clarithromycin [76].
It is estimated that the overall resistance rates to amoxicillin and tetracycline are 23.61% and 7.38% in Asian countries, respectively [52]. Similarly, we observed a high rate of resistance to these drugs among the studied isolates (30.9% to amoxicillin and 4.4% to tetracycline), which is a matter of great concern in H. pylori eradication in Iran. However, the level of resistance to these antibiotics was reported to be very low or even absent in most Western countries versus African countries [73,77]. Regarding rifampicin, we also observed a rising rate of resistance from 14.4% to 32.4% in comparison with a previous report [35]. Recently, Regnath et al. reported a considerable increase in resistance to rifampicin from 3.9% to 18.8% between 2002 and 2015 among pediatric patients from southwest Germany [78].
Unfortunately, the emergence of MDR H. pylori strains has become a serious challenge all over the world. In a previous study, the resistance rate to at least two antimicrobial agents was reported in 43% of the H. pylori isolates from Iran [35]. Surprisingly, our finding showed that 75% of the isolates were resistant to at least two antibiotics. The high prevalence of MDR phenotype may be attributed to the exhaustive use of antibiotics across the country. Information about the prevalence of quadruple-drug resistance is limited, and a few reports from India (2.5%), Bulgaria (0.7%), Vietnam (1.9%), and Indonesia (2.6%) are available thus far [5,47,79,80]. However, 16.2% of the isolates in this study showed quadruple-drug resistance, which was lower than the previous study (37.9%) [35]. Moreover, resistance to tetracycline was only observed in the isolates with quadruple-drug resistance. This finding could be explained by the presence of multidrug efflux pumps in these strains [73].
There have been several reports on the relationship between H. pylori virulence markers and antibiotic resistance. Accordingly, patients infected with cagA-positive strains that also carry more virulent vacA alleles have significantly high cure rates and eradication success compared with less virulent strains [26,81,82,83]. It has been hypothesized that the colonization of gastric mucosa by more virulent H. pylori genotypes may induce a higher degree of inflammation and increase blood flow, which in turn can favor better diffusion of the antibiotics [27,83]. Alternatively, another possible explanation may be related to the fact that cagA-positive strains proliferate faster than cagA-negative strains, and would thus be more susceptible to antibiotics [25,81]. Furthermore, Taneike et al. observed that cagA-negative strains may tend to acquire spontaneous drug resistance under selective pressure of antimicrobials [25]. In contrast, we found a significant association between the cagA-positive genotype and resistance to MNZ (p = 0.0002). However, it still remains somewhat controversial because recent reports indicated that these virulent genotypes variously distributed between susceptible and resistant strains [5,28,84,85,86]. CagA protein with a greater number of EPIYA-C repeats are considered to be pathophysiologically more virulent and carcinogenic [87]. Thus, according to the above-mentioned hypothesis, we expected the presence of more virulent types of CagA EPIYA motifs in susceptible isolates than resistant ones. However, as the number of EPIYA types having two or more EPIYA-C repeats was very low, we could not come to such a conclusion.
H. pylori strains that carry an intact and functional cagPAI are more virulent and frequently associated with severe clinical outcomes than those carrying partial or no cagPAI [31,39]. As far as we know, this is the first study that relates the cagPAI integrity with antibiotic resistance. Our results showed that H. pylori isolates harboring intact or partial cagPAI were variably distributed between susceptible and resistant isolates. However, most of the resistant isolates to the antibiotic tested and all isolates resistant to TCN carried an intact cagPAI locus. Similar to other studies performed in Italy (37.2%) [88], North Wales (53%) [89], and Germany (37.4%) [82], vacA s1m2 (51.5%) genotype was the most prevalent vacA mosaicisms in our strains. Although H. pylori strains with vacA s1m2 were detected more frequently in resistant isolates, no significant associations were found (p > 0.05). Moreover, in our study, the majority of resistant isolates had oipA “on” status and were positive for babA2, sabA, and dupA genotypes. However, we found no statistically significant association between these virulence factors and antibiotics resistance (p > 0.05), except for the oipA “on” status and resistance to AMX (p = 0.02), and sabA- and dupA-positivity with resistance to MNZ (p = 0.0001). These results are contradictory and did not strongly support the idea that susceptibility to antibiotics is higher in infections caused by more virulent genotypes. Nevertheless, it is likely that infected patients with resistant and hypervirulent strains are at increased risk of progression to more severe clinical outcomes owing to failure in H. pylori eradication.

5. Conclusions

In conclusion, this study demonstrated that the prevalence of H. pylori antibiotic resistance is worrisome in our country with rising trends over the time. The findings from this study also highlight the relevance of different types of mutations in genes responsible for antibiotic resistance in H. pylori strains. We also provide evidence for the importance of simultaneous screening of the virulence and resistance genotypes in H. pylori strains for guiding clinicians to choose an appropriate combination of drugs. Taken together, because of the alarming increase in the rate of H. pylori antibiotic resistance in our local population, it is reasonable to constantly monitor the antimicrobial susceptibility patterns, and develop effective treatment and preventive strategies at the national level.

Supplementary Materials

The following are available online at https://www.mdpi.com/2077-0383/8/11/2004/s1, Figure S1: Amino acid sequence alignment of FrxA in metronidazole-susceptible and -resistant H. pylori isolates (n = 27) as compared with H. pylori reference strain 26695. The stop codon and premature truncation in peptide translation is indicated with (#); Figure S2: Amino acid sequence alignment of RdxA in metronidazole-susceptible and -resistant H. pylori isolates (n = 28) as compared with H. pylori reference strain 26695. The stop codon and premature truncation in peptide translation is indicated with (#); Figure S3: Amino acid sequence alignment of GyrA in fluoroquinolone-susceptible and -resistant H. pylori isolates (n = 31) as compared with H. pylori reference strain 26695; Figure S4: Amino acid sequence alignment of GyrB in fluoroquinolone-susceptible and -resistant H. pylori isolates (n = 27) as compared with H. pylori reference strain 26695; Figure S5: Nucleotide sequence alignment of 23S rRNA in clarithromycin-susceptible and -resistant H. pylori isolates (n = 24) as compared with H. pylori reference strain 26695.

Author Contributions

N.F. collected the H. pylori strains, and performed the susceptibility testing and molecular assays. A.Y. worked on concept and design of the study, data analysis and interpretation, and writing of manuscript. A.S., H.A.A., S.M.S., J.R., H.S., and M.R.Z. critically revised the paper. All authors approved the final version of the manuscript and the authorship list.

Funding

This study was supported by a grant (no. RIGLD 878) from Research Institute for Gastroenterology and Liver Diseases, Shahid Behehsti University of Medical Sciences, Tehran, Iran.

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. Backert, S.; Neddermann, M.; Maubach, G.; Naumann, M. Pathogenesis of Helicobacter pylori infection. Helicobacter 2016, 21 (Suppl. 1), 19–25. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  2. Rowland, M.; Daly, L.; Vaughan, M.; Higgins, A.; Bourke, B.; Drumm, B. Age-specific incidence of helicobacter pylori. Gastroenterology 2006, 130, 65–72. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  3. Malfertheiner, P.; Megraud, F.; O’Morain, C.A.; Gisbert, J.P.; Kuipers, E.J.; Axon, A.T.; Bazzoli, F.; Gasbarrini, A.; Atherton, J.; Graham, D.Y.; et al. Management of Helicobacter pylori infection-the Maastricht V/Florence Consensus Report. Gut 2017, 66, 6–30. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  4. Wu, C.Y.; Kuo, K.N.; Wu, M.S.; Chen, Y.J.; Wang, C.B.; Lin, J.T. Early Helicobacter pylori eradication decreases risk of gastric cancer in patients with peptic ulcer disease. Gastroenterology 2009, 137, 1641–1648 e1–2. [Google Scholar] [CrossRef] [Scilit]
  5. Miftahussurur, M.; Syam, A.F.; Nusi, I.A.; Makmun, D.; Waskito, L.A.; Zein, L.H.; Akil, F.; Uwan, W.B.; Simanjuntak, D.; Wibawa, I.D.N. Surveillance of Helicobacter pylori Antibiotic Susceptibility in Indonesia: Different Resistance Types among Regions and with Novel Genetic Mutations. PLoS ONE 2016, 11, e0166199. [Google Scholar] [CrossRef] [Scilit]
  6. Ngoyi, O.; Nina, E.; Atipo Ibara, B.I.; Moyen, R.; Apendi, A.; Clausina, P.; Ibara, J.R.; Obengui, O.; Ibara, O.; Bienvenu, R. Molecular detection of Helicobacter pylori and its antimicrobial resistance in Brazzaville, Congo. Helicobacter 2015, 20, 316–320. [Google Scholar] [CrossRef] [Scilit]
  7. Lee, J.W.; Kim, N.; Kim, J.M.; Nam, R.H.; Chang, H.; Kim, J.Y.; Shin, C.M.; Park, Y.S.; Lee, D.H.; Jung, H.C. Prevalence of primary and secondary antimicrobial resistance of Helicobacter pylori in Korea from 2003 through 2012. Helicobacter 2013, 18, 206–214. [Google Scholar] [CrossRef] [Scilit]
  8. Zerbetto De Palma, G.; Mendiondo, N.; Wonaga, A.; Viola, L.; Ibarra, D.; Campitelli, E.; Salim, N.; Corti, R.; Goldman, C.; Catalano, M. Occurrence of Mutations in the Antimicrobial Target Genes Related to Levofloxacin, Clarithromycin, and Amoxicillin Resistance in Helicobacter pylori Isolates from Buenos Aires City. Microb. Drug Resist. 2017, 23, 351–358. [Google Scholar] [CrossRef] [Scilit]
  9. Mahachai, V.; Vilaichone, R.K.; Pittayanon, R.; Rojborwonwitaya, J.; Leelakusolvong, S.; Maneerattanaporn, M.; Chotivitayatarakorn, P.; Treeprasertsuk, S.; Kositchaiwat, C.; Pisespongsa, P.; et al. Helicobacter pylori management in ASEAN: The Bangkok consensus report. J. Gastroenterol. Hepatol. 2018, 33, 37–56. [Google Scholar] [CrossRef] [Scilit]
  10. Mégraud, F. The challenge of Helicobacter pylori resistance to antibiotics: The comeback of bismuth-based quadruple therapy. Ther. Adv. Gastroenterol. 2012, 5, 103–109. [Google Scholar] [CrossRef] [Scilit]
  11. Kuo, C.H.; Hsu, P.I.; Kuo, F.C.; Wang, S.S.; Hu, H.M.; Liu, C.J.; Chuah, S.K.; Chen, Y.H.; Hsieh, M.C.; Wu, D.C.; et al. Comparison of 10 day bismuth quadruple therapy with high-dose metronidazole or levofloxacin for second-line Helicobacter pylori therapy: A randomized controlled trial. J. Antimicrob. Chemother. 2013, 68, 222–228. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  12. Gisbert, J.P.; Romano, M.; Gravina, A.G.; Solis-Munoz, P.; Bermejo, F.; Molina-Infante, J.; Castro-Fernandez, M.; Ortuno, J.; Lucendo, A.J.; Herranz, M.; et al. Helicobacter Pylori second-line rescue therapy with levofloxacin- and bismuth-containing quadruple therapy, after failure of standard triple or non-bismuth quadruple treatments. Aliment. Pharm. 2015, 41, 768–775. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  13. Cianci, R.; Montalto, M.; Pandolfi, F.; Gasbarrini, G.B.; Cammarota, G. Third-line rescue therapy for Helicobacter pylori infection. World J. Gastroenterol. WJG 2006, 12, 2313–2319. [Google Scholar] [CrossRef] [Scilit]
  14. Delchier, J.C.; Malfertheiner, P.; Thieroff-Ekerdt, R. Use of a combination formulation of bismuth, metronidazole and tetracycline with omeprazole as a rescue therapy for eradication of Helicobacter pylori. Aliment. Pharm. 2014, 40, 171–177. [Google Scholar] [CrossRef] [Scilit]
  15. Chen, Q.; Zhang, W.; Fu, Q.; Liang, X.; Liu, W.; Xiao, S.; Lu, H. Rescue Therapy for Helicobacter pylori Eradication: A Randomized Non-Inferiority Trial of Amoxicillin or Tetracycline in Bismuth Quadruple Therapy. Am. J. Gastroenterol. 2016, 111, 1736–1742. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  16. Miftahussurur, M.; Shrestha, P.K.; Subsomwong, P.; Sharma, R.P.; Yamaoka, Y. Emerging Helicobacter pylori levofloxacin resistance and novel genetic mutation in Nepal. BMC Microbiol. 2016, 16, 256. [Google Scholar] [CrossRef] [Scilit]
  17. Alfizah, H.; Norazah, A.; Hamizah, R.; Ramelah, M. Resistotype of Helicobacter pylori isolates: The impact on eradication outcome. J. Med. Microbiol. 2014, 63, 703–709. [Google Scholar] [CrossRef] [Scilit]
  18. Secka, O.; Berg, D.E.; Antonio, M.; Corrah, T.; Tapgun, M.; Walton, R.; Thomas, V.; Galano, J.J.; Sancho, J.; Adegbola, R.A. Antimicrobial susceptibility and resistance patterns among Helicobacter pylori strains from The Gambia, West Africa. Antimicrob. Agents Chemother. 2013, 57, 1231–1237. [Google Scholar] [CrossRef] [Scilit]
  19. Nishizawa, T.; Suzuki, H. Mechanisms of Helicobacter pylori antibiotic resistance and molecular testing. Front. Mol. Biosci. 2014, 1, 19. [Google Scholar] [CrossRef] [Scilit]
  20. De Francesco, V.; Zullo, A.; Giorgio, F.; Saracino, I.; Zaccaro, C.; Hassan, C.; Ierardi, E.; Di Leo, A.; Fiorini, G.; Castelli, V.; et al. Change of point mutations in Helicobacter pylori rRNA associated with clarithromycin resistance in Italy. J. Med. Microbiol. 2014, 63, 453–457. [Google Scholar] [CrossRef] [Scilit]
  21. Rimbara, E.; Noguchi, N.; Kawai, T.; Sasatsu, M. Novel mutation in 23S rRNA that confers low-level resistance to clarithromycin in Helicobacter pylori. Antimicrob. Agents Chemother. 2008, 52, 3465–3466. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  22. Matteo, M.J.; Perez, C.V.; Domingo, M.R.; Olmos, M.; Sanchez, C.; Catalano, M. DNA sequence analysis of rdxA and frxA from paired metronidazole-sensitive and -resistant Helicobacter pylori isolates obtained from patients with heteroresistance. Int. J. Antimicrob. Agents 2006, 27, 152–158. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  23. Masaoka, T.; Suzuki, H.; Kurabayashi, K.; Nomoto, Y.; Nishizawa, T.; Mori, M.; Hibi, T. Could frameshift mutations in the frxA and rdxA genes of Helicobacter pylori be a marker for metronidazole resistance? Aliment. Pharmacol. Ther. Symp. Ser. 2006, 2, 81–87. [Google Scholar] [CrossRef] [Scilit]
  24. Rimbara, E.; Noguchi, N.; Kawai, T.; Sasatsu, M. Fluoroquinolone resistance in Helicobacter pylori: Role of mutations at position 87 and 91 of GyrA on the level of resistance and identification of a resistance conferring mutation in GyrB. Helicobacter 2012, 17, 36–42. [Google Scholar] [CrossRef] [Scilit]
  25. Taneike, I.; Nami, A.; O’Connor, A.; Fitzgerald, N.; Murphy, P.; Qasim, A.; O’Connor, H.; O’Morain, C. Analysis of drug resistance and virulence-factor genotype of Irish Helicobacter pylori strains: Is there any relationship between resistance to metronidazole and cagA status? Aliment. Pharm. 2009, 30, 784–790. [Google Scholar] [CrossRef] [Scilit]
  26. Suzuki, T.; Matsuo, K.; Sawaki, A.; Ito, H.; Hirose, K.; Wakai, K.; Sato, S.; Nakamura, T.; Yamao, K.; Ueda, R.; et al. Systematic review and meta-analysis: Importance of CagA status for successful eradication of Helicobacter pylori infection. Aliment. Pharm. 2006, 24, 273–280. [Google Scholar] [CrossRef] [Scilit]
  27. Agudo, S.; Perez-Perez, G.; Alarcon, T.; Lopez-Brea, M. High prevalence of clarithromycin-resistant Helicobacter pylori strains and risk factors associated with resistance in Madrid, Spain. J. Clin. Microbiol. 2010, 48, 3703–3707. [Google Scholar] [CrossRef] [Scilit]
  28. Fasciana, T.; Cala, C.; Bonura, C.; Di Carlo, E.; Matranga, D.; Scarpulla, G.; Manganaro, M.; Camilleri, S.; Giammanco, A. Resistance to clarithromycin and genotypes in Helicobacter pylori strains isolated in Sicily. J. Med. Microbiol. 2015, 64, 1408–1414. [Google Scholar] [CrossRef] [Scilit]
  29. Brennan, D.E.; Dowd, C.; O’Morain, C.; McNamara, D.; Smith, S.M. Can bacterial virulence factors predict antibiotic resistant Helicobacter pylori infection? World J. Gastroenterol. 2018, 24, 971–981. [Google Scholar] [CrossRef] [Scilit]
  30. Farzi, N.; Yadegar, A.; Aghdaei, H.A.; Yamaoka, Y.; Zali, M.R. Genetic diversity and functional analysis of oipA gene in association with other virulence factors among Helicobacter pylori isolates from Iranian patients with different gastric diseases. Infect. Genet. Evol. J. Mol. Epidemiol. Evol. Genet. Infect. Dis. 2018, 60, 26–34. [Google Scholar] [CrossRef] [Scilit]
  31. Ahmadzadeh, A.; Ghalehnoei, H.; Farzi, N.; Yadegar, A.; Alebouyeh, M.; Aghdaei, H.A.; Molaei, M.; Zali, M.R.; Pour Hossein Gholi, M.A. Association of CagPAI integrity with severeness of Helicobacter pylori infection in patients with gastritis. Pathol. Biol. (Paris) 2015, 63, 252–257. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  32. Yadegar, A.; Mohabati Mobarez, A.; Zali, M.R. Genetic diversity and amino acid sequence polymorphism in Helicobacter pylori CagL hypervariable motif and its association with virulence markers and gastroduodenal diseases. Cancer Med. 2019, 8, 1619–1632. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  33. CLSI. Methods for Antimicrobial Dilution and Disk Susceptibility Testing of Infrequently Isolated or Fastidious Bacteria, 3rd ed.; Document M45; CLSI: Wayne, PA, USA, 2015. [Google Scholar]
  34. Torres, J.; Camorlinga-Ponce, M.; Perez-Perez, G.; Madrazo-De la Garza, A.; Dehesa, M.; Gonzalez-Valencia, G.; Munoz, O. Increasing multidrug resistance in Helicobacter pylori strains isolated from children and adults in Mexico. J. Clin. Microbiol. 2001, 39, 2677–2680. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  35. Shokrzadeh, L.; Alebouyeh, M.; Mirzaei, T.; Farzi, N.; Zali, M.R. Prevalence of multiple drug-resistant Helicobacter pylori strains among patients with different gastric disorders in Iran. Microb. Drug Resist. (Larchmt. NY) 2015, 21, 105–110. [Google Scholar] [CrossRef] [Scilit]
  36. Hall, T.A. BioEdit: A user-friendly biological sequence alignment editor and analysis program for Windows 95/98/NT. Nucl. Acids Symp. Ser. 1999, 41, 95–98. [Google Scholar]
  37. Yadegar, A.; Mobarez, A.M.; Alebouyeh, M.; Mirzaei, T.; Kwok, T.; Zali, M.R. Clinical relevance of cagL gene and virulence genotypes with disease outcomes in a Helicobacter pylori infected population from Iran. World J. Microbiol. Biotechnol. 2014, 30, 2481–2490. [Google Scholar] [CrossRef] [Scilit]
  38. Jung, S.W.; Sugimoto, M.; Shiota, S.; Graham, D.Y.; Yamaoka, Y. The intact dupA cluster is a more reliable Helicobacter pylori virulence marker than dupA alone. Infect. Immun. 2012, 80, 381–387. [Google Scholar] [CrossRef] [Scilit]
  39. Yadegar, A.; Alebouyeh, M.; Zali, M.R. Analysis of the intactness of Helicobacter pylori cag pathogenicity island in Iranian strains by a new PCR-based strategy and its relationship with virulence genotypes and EPIYA motifs. Infect. Genet. Evol. 2015, 35, 19–26. [Google Scholar] [CrossRef] [Scilit]
  40. Yamaoka, Y.; Kwon, D.H.; Graham, D.Y. A M(r) 34,000 proinflammatory outer membrane protein (oipA) of Helicobacter pylori. Proc. Natl. Acad. Sci. USA 2000, 97, 7533–7538. [Google Scholar] [CrossRef] [Scilit]
  41. Han, F.; Liu, S.; Ho, B.; Yan, Z.; Yan, X. Alterations in rdxA and frxA genes and their upstream regions in metronidazole-resistant Helicobacter pylori isolates. Res. Microbiol. 2007, 158, 38–44. [Google Scholar] [CrossRef] [Scilit]
  42. Wang, L.-H.; Cheng, H.; Hu, F.-L.; Li, J. Distribution of gyrA mutations in fluoroquinolone-resistant Helicobacter pylori strains. World J. Gastroenterol. WJG 2010, 16, 2272. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  43. Ho, S.L.; Tan, E.L.; Sam, C.K.; Goh, K.L. Clarithromycin resistance and point mutations in the 23S rRNA gene in Helicobacter pylori isolates from Malaysia. J. Dig. Dis. 2010, 11, 101–105. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  44. Lee, Y.C.; Chiang, T.H.; Chou, C.K.; Tu, Y.K.; Liao, W.C.; Wu, M.S.; Graham, D.Y. Association between Helicobacter pylori eradication and gastric cancer incidence: A systematic review and meta-analysis. Gastroenterology 2016, 150, 1113–1124. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  45. Teh, X.; Khosravi, Y.; Lee, W.C.; Leow, A.H.R.; Loke, M.F.; Vadivelu, J.; Goh, K.L. Functional and molecular surveillance of Helicobacter pylori antibiotic resistance in Kuala Lumpur. PLoS ONE 2014, 9, e101481. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  46. Goh, K.L.; Navaratnam, P. High Helicobacter pylori resistance to metronidazole but zero or low resistance to clarithromycin, levofloxacin, and other antibiotics in Malaysia. Helicobacter 2011, 16, 241–245. [Google Scholar] [CrossRef] [Scilit]
  47. Binh, T.T.; Shiota, S.; Nguyen, L.T.; Ho, D.D.; Hoang, H.H.; Ta, L.; Trinh, D.T.; Fujioka, T.; Yamaoka, Y. The incidence of primary antibiotic resistance of Helicobacter pylori in Vietnam. J. Clin. Gastroenterol. 2013, 47, 233. [Google Scholar] [CrossRef] [Scilit]
  48. Hosseini, E.; Poursina, F.; de Wiele, T.V.; Safaei, H.G.; Adibi, P. Helicobacter pylori in Iran: A systematic review on the association of genotypes and gastroduodenal diseases. J. Res. Med Sci. Off. J. Isfahan Univ. Med. Sci. 2012, 17, 280–292. [Google Scholar]
  49. Talebi Bezmin Abadi, A.; Ghasemzadeh, A.; Taghvaei, T.; Mobarez, A.M. Primary resistance of Helicobacter pylori to levofloxacin and moxifloxacine in Iran. Intern. Emerg. Med. 2012, 7, 447–452. [Google Scholar] [CrossRef] [Scilit]
  50. Kohanteb, J.; Bazargani, A.; Saberi-Firoozi, M.; Mobasser, A. Antimicrobial susceptibility testing of Helicobacter pylori to selected agents by agar dilution method in Shiraz-Iran. Indian J. Med. Microbiol. 2007, 25, 374–377. [Google Scholar]
  51. Shokrzadeh, L.; Jafari, F.; Dabiri, H.; Baghaei, K.; Zojaji, H.; Alizadeh, A.H.; Aslani, M.M.; Zali, M.R. Antibiotic susceptibility profile of Helicobacter pylori isolated from the dyspepsia patients in Tehran, Iran. Saudi J. Gastroenterol. Off. J. Saudi Gastroenterol. Assoc. 2011, 17, 261–264. [Google Scholar]
  52. Ghotaslou, R.; Leylabadlo, H.E.; Asl, Y.M. Prevalence of antibiotic resistance in Helicobacter pylori: A recent literature review. World J. Methodol. 2015, 5, 164–174. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  53. Nahar, S.; Mukhopadhyay, A.K.; Khan, R.; Ahmad, M.M.; Datta, S.; Chattopadhyay, S.; Dhar, S.C.; Sarker, S.A.; Engstrand, L.; Berg, D.E. Antimicrobial susceptibility of Helicobacter pylori strains isolated in Bangladesh. J. Clin. Microbiol. 2004, 42, 4856–4858. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  54. Pandya, H.B.; Agravat, H.H.; Patel, J.S.; Sodagar, N.R. Emerging antimicrobial resistance pattern of Helicobacter pylori in central Gujarat. Indian J. Med. Microbiol. 2014, 32, 408–413. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  55. John Albert, M.; Al-Mekhaizeem, K.; Neil, L.; Dhar, R.; Dhar, P.M.; Al-Ali, M.; Al-Abkal, H.M.; Haridas, S. High prevalence and level of resistance to metronidazole, but lack of resistance to other antimicrobials in Helicobacter pylori, isolated from a multiracial population in Kuwait. Aliment. Pharm. 2006, 24, 1359–1366. [Google Scholar] [CrossRef] [Scilit]
  56. Khan, A.; Farooqui, A.; Manzoor, H.; Akhtar, S.S.; Quraishy, M.S.; Kazmi, S.U. Antibiotic resistance and cagA gene correlation: A looming crisis of Helicobacter pylori. World J. Gastroenterol. 2012, 18, 2245–2252. [Google Scholar] [CrossRef] [Scilit]
  57. Su, P.; Li, Y.; Li, H.; Zhang, J.; Lin, L.; Wang, Q.; Guo, F.; Ji, Z.; Mao, J.; Tang, W.; et al. Antibiotic resistance of Helicobacter pylori isolated in the Southeast Coastal Region of China. Helicobacter 2013, 18, 274–279. [Google Scholar] [CrossRef] [Scilit]
  58. Ahmad, N.; Zakaria, W.R.; Mohamed, R. Analysis of antibiotic susceptibility patterns of Helicobacter pylori isolates from Malaysia. Helicobacter 2011, 16, 47–51. [Google Scholar] [CrossRef] [Scilit]
  59. Gerrits, M.M.; Van der Wouden, E.-J.; Bax, D.A.; Van Zwet, A.A.; Van Vliet, A.H.; de Jong, A.; Kusters, J.G.; Thijs, J.C.; Kuipers, E.J. Role of the rdxA and frxA genes in oxygen-dependent metronidazole resistance of helicobacter pylori. J. Med. Microbiol. 2004, 53, 1123–1128. [Google Scholar] [CrossRef] [Scilit]
  60. Marais, A.; Bilardi, C.; Cantet, F.; Mendz, G.L.; Mégraud, F. Characterization of the genes rdxA and frxA involved in metronidazole resistance in Helicobacter pylori. Res. Microbiol. 2003, 154, 137–144. [Google Scholar] [CrossRef] [Scilit]
  61. Yang, Y.J.; Wu, J.J.; Sheu, B.S.; Kao, A.W.; Huang, A.H. The rdxA gene plays a more major role than frxA gene mutation in high-level metronidazole resistance of Helicobacter pylori in Taiwan. Helicobacter 2004, 9, 400–407. [Google Scholar] [CrossRef] [Scilit]
  62. Chisholm, S.A.; Owen, R.J. Mutations in Helicobacter pylori rdxA gene sequences may not contribute to metronidazole resistance. J. Antimicrob. Chemother. 2003, 51, 995–999. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  63. Goh, K.L.; Manikam, J.; Qua, C.S. High-dose rabeprazole-amoxicillin dual therapy and rabeprazole triple therapy with amoxicillin and levofloxacin for 2 weeks as first and second line rescue therapies for Helicobacter pylori treatment failures. Aliment. Pharm. 2012, 35, 1097–1102. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  64. Chang, W.L.; Kao, C.Y.; Wu, C.T.; Huang, A.H.; Wu, J.J.; Yang, H.B.; Cheng, H.C.; Sheu, B.S. Gemifloxacin can partially overcome quinolone resistance of H. pylori with gyrA mutation in Taiwan. Helicobacter 2012, 17, 210–215. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  65. Trespalacios-Rangel, A.A.; Otero, W.; Arevalo-Galvis, A.; Poutou-Pinales, R.A.; Rimbara, E.; Graham, D.Y. Surveillance of levofloxacin resistance in Helicobacter pylori isolates in Bogota-Colombia (2009-2014). PLoS ONE 2016, 11, e0160007. [Google Scholar] [CrossRef] [Scilit]
  66. Cattoir, V.; Nectoux, J.; Lascols, C.; Deforges, L.; Delchier, J.C.; Megraud, F.; Soussy, C.J.; Cambau, E. Update on fluoroquinolone resistance in Helicobacter pylori: New mutations leading to resistance and first description of a gyrA polymorphism associated with hypersusceptibility. Int. J. Antimicrob. Agents 2007, 29, 389–396. [Google Scholar] [CrossRef] [Scilit]
  67. Garcia, M.; Raymond, J.; Garnier, M.; Cremniter, J.; Burucoa, C. Distribution of spontaneous gyrA mutations in 97 fluoroquinolone-resistant Helicobacter pylori isolates collected in France. Antimicrob. Agents Chemother. 2012, 56, 550–551. [Google Scholar] [CrossRef] [Scilit]
  68. Miyachi, H.; Miki, I.; Aoyama, N.; Shirasaka, D.; Matsumoto, Y.; Toyoda, M.; Mitani, T.; Morita, Y.; Tamura, T.; Kinoshita, S.; et al. Primary levofloxacin resistance and gyrA/B mutations among Helicobacter pylori in Japan. Helicobacter 2006, 11, 243–249. [Google Scholar] [CrossRef] [Scilit]
  69. Mégraud, F. Current recommendations for Helicobacter pylori therapies in a world of evolving resistance. Gut Microbes 2013, 4, 541–548. [Google Scholar] [CrossRef] [Scilit]
  70. Cuadrado-Lavín, A.; Salcines-Caviedes, J.R.; Carrascosa, M.F.; Mellado, P.; Monteagudo, I.; Llorca, J.; Cobo, M.; Campos, M.R.; Ayestarán, B.; Fernández-Pousa, A. Antimicrobial susceptibility of Helicobacter pylori to six antibiotics currently used in Spain. J. Antimicrob. Chemother. 2011, 67, 170–173. [Google Scholar] [CrossRef] [Scilit]
  71. Wueppenhorst, N.; Stueger, H.P.; Kist, M.; Glocker, E. Identification and molecular characterization of triple- and quadruple-resistant Helicobacter pylori clinical isolates in Germany. J. Antimicrob. Chemother. 2009, 63, 648–653. [Google Scholar] [CrossRef] [Scilit]
  72. De Francesco, V.; Margiotta, M.; Zullo, A.; Hassan, C.; Giorgio, F.; Burattini, O.; Stoppino, G.; Cea, U.; Pace, A.; Zotti, M.; et al. Prevalence of primary clarithromycin resistance in Helicobacter pylori strains over a 15 year period in Italy. J. Antimicrob. Chemother. 2007, 59, 783–785. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  73. Thung, I.; Aramin, H.; Vavinskaya, V.; Gupta, S.; Park, J.Y.; Crowe, S.E.; Valasek, M.A. Review article: The global emergence of Helicobacter pylori antibiotic resistance. Aliment. Pharm. 2016, 43, 514–533. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  74. Khashei, R.; Dara, M.; Bazargani, A.; Bagheri Lankarani, K.; Taghavi, A.; Moeini, M.; Dehghani, B.; Sohrabi, M. High rate of A2142G point mutation associated with clarithromycin resistance among Iranian Helicobacter pylori clinical isolates. Apmis Acta Pathol. Microbiol. Immunol. Scand. 2016, 124, 787–793. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  75. Ierardi, E.; Giorgio, F.; Losurdo, G.; Di Leo, A.; Principi, M. How antibiotic resistances could change Helicobacter pylori treatment: A matter of geography? World J. Gastroenterol. WJG 2013, 19, 8168–8180. [Google Scholar] [CrossRef] [Scilit]
  76. Hirata, K.; Suzuki, H.; Nishizawa, T.; Tsugawa, H.; Muraoka, H.; Saito, Y.; Matsuzaki, J.; Hibi, T. Contribution of efflux pumps to clarithromycin resistance in Helicobacter pylori. J. Gastroenterol. Hepatol. 2010, 25 (Suppl. 1), S75–S79. [Google Scholar] [CrossRef] [Scilit]
  77. Jaka, H.; Rhee, J.A.; Östlundh, L.; Smart, L.; Peck, R.; Mueller, A.; Kasang, C.; Mshana, S.E. The magnitude of antibiotic resistance to Helicobacter pylori in Africa and identified mutations which confer resistance to antibiotics: Systematic review and meta-analysis. BMC Infect. Dis. 2018, 18, 193. [Google Scholar] [CrossRef] [Scilit]
  78. Regnath, T.; Raecke, O.; Enninger, A.; Ignatius, R. Increasing metronidazole and rifampicin resistance of Helicobacter pylori isolates obtained from children and adolescents between 2002 and 2015 in southwest Germany. Helicobacter 2017, 22. [Google Scholar] [CrossRef] [Scilit]
  79. Boyanova, L. Prevalence of multidrug-resistant Helicobacter pylori in Bulgaria. J. Med. Microbiol. 2009, 58, 930–935. [Google Scholar] [CrossRef] [Scilit]
  80. Thyagarajan, S.P.; Ray, P.; Das, B.K.; Ayyagari, A.; Khan, A.A.; Dharmalingam, S.; Rao, U.A.; Rajasambandam, P.; Ramathilagam, B.; Bhasin, D.; et al. Geographical difference in antimicrobial resistance pattern of Helicobacter pylori clinical isolates from Indian patients: Multicentric study. J. Gastroenterol. Hepatol. 2003, 18, 1373–1378. [Google Scholar] [CrossRef] [Scilit]
  81. van Doorn, L.J.; Schneeberger, P.M.; Nouhan, N.; Plaisier, A.P.; Quint, W.G.; de Boer, W.A. Importance of Helicobacter pylori cagA and vacA status for the efficacy of antibiotic treatment. Gut 2000, 46, 321–326. [Google Scholar] [CrossRef] [Scilit]
  82. Rudi, J.; Reuther, S.; Sieg, A.; Hoerner, M.; Stremmel, W. Relevance of underlying disease and bacterial vacA and cagA status on the efficacy of Helicobacter pylori eradication. Digestion 2002, 65, 11–15. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  83. Sugimoto, M.; Yamaoka, Y. Virulence factor genotypes of Helicobacter pylori affect cure rates of eradication therapy. Arch. Immunol. Ther. Exp. 2009, 57, 45–56. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  84. Alarcon-Millan, J.; Fernandez-Tilapa, G.; Cortes-Malagon, E.M.; Castanon-Sanchez, C.A.; De Sampedro-Reyes, J.; Cruz-Del Carmen, I.; Betancourt-Linares, R.; Roman-Roman, A. Clarithromycin resistance and prevalence of Helicobacter pylori virulent genotypes in patients from Southern Mexico with chronic gastritis. Infect. Genet. Evol. 2016, 44, 190–198. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  85. Karabiber, H.; Selimoglu, M.A.; Otlu, B.; Yildirim, O.; Ozer, A. Virulence factors and antibiotic resistance in children with Helicobacter pylori gastritis. J. Pediatr. Gastroenterol. Nutr. 2014, 58, 608–612. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  86. Rasheed, F.; Campbell, B.J.; Alfizah, H.; Varro, A.; Zahra, R.; Yamaoka, Y.; Pritchard, D.M. Analysis of clinical isolates of Helicobacter pylori in Pakistan reveals high degrees of pathogenicity and high frequencies of antibiotic resistance. Helicobacter 2014, 19, 387–399. [Google Scholar] [CrossRef] [Scilit]
  87. Sicinschi, L.A.; Correa, P.; Peek, R.M.; Camargo, M.C.; Piazuelo, M.B.; Romero-Gallo, J.; Hobbs, S.S.; Krishna, U.; Delgado, A.; Mera, R.; et al. CagA C-terminal variations in Helicobacter pylori strains from Colombian patients with gastric precancerous lesions. Clin. Microbiol. Infect. 2010, 16, 369–378. [Google Scholar] [CrossRef] [Scilit]
  88. De Francesco, V.; Margiotta, M.; Zullo, A.; Hassan, C.; Valle, N.D.; Burattini, O.; D’Angelo, R.; Stoppino, G.; Cea, U.; Giorgio, F.; et al. Claritromycin resistance and Helicobacter pylori genotypes in Italy. J. Microbiol. (Seoul Korea) 2006, 44, 660–664. [Google Scholar]
  89. Elviss, N.C.; Owen, R.J.; Xerry, J.; Walker, A.M.; Davies, K. Helicobacter pylori antibiotic resistance patterns and genotypes in adult dyspeptic patients from a regional population in North Wales. J. Antimicrob. Chemother. 2004, 54, 435–440. [Google Scholar] [CrossRef] [Scilit]
Table 1. Oligonucleotide primer sequences used for amplification of genes involved in H. pylori antibiotic resistance.
Table 1. Oligonucleotide primer sequences used for amplification of genes involved in H. pylori antibiotic resistance.
Target GenePrimer DesignationOligonucleotide Sequence (5′–3′)Annealing Temperature (°C)PCR Product (bp)Reference
cagA93089
93261
AATACACCAACGCCTCCAAG
TTGTTGCCGCTTTTGCTCTC
57400[37]
cagLCagL-B4
CagL-B5
GCAGAATTCATAACAAGCGGCTTAAAG
ATTAGAATTCATAGCCTATCGTCTCAG
60695[37]
vacA s1/s2VA1-F
VA1-R
ATGGAAATACAACAAACACAC
CTGCTTGAATGCGCCAAAC
57259/286[37]
vacA m1/m2VAG-F
VAG-R
CAATCTGTCCAATCAAGCGAG
GCGTCAAAATAATTCCAAGG
57570/645[37]
babA2Bab7-F
Bab7-R
CCAAACGAAACAAAAAGCGT
GCTTGTGTAAAAGCCGTCGT
52271[37]
sabAF1-HP726-jhp663
R1-HP725-jhp662
TTTTTGTCAGCTACGCGTTC
ACCGAAGTGATAACGGCTTG
55581[37]
oipAOipA-F
OipA-R
CAAGCGCTTAACAGATAGGC
AAGGCGTTTTCTGCTGAAGC
56450[40]
dupADupA-F
DupA-R
ATTCACGCCTAAGACCTCA
CTGAGAAGCCTTATTATCTTGTTGG
52487[38]
frxAfrx1
frx2
TGGATATGGCAGCCGTTTA
GGTTATCAAAAAGCTAACAGCG
52729[41]
rdxArdx1
rdx2
ATGGTAATTGTTTCGTTAGGG
CTCCTTGAACTTTAATTTAG
48758[41]
gyrAgyrAPF
gyrAPR
AGCTTATTCCATGAGCGTGA
TCAGGCCCTTTGACAAATTC
52582[42]
gyrBgyrBPF
gyrBPR
CCCTAACGAAGCCAAAATCA
GGGCGCAAATAACGATAGAA
51465[42]
23S rRNAHp23-1
Hp23-2
CCACAGCGATGTGGTCTCAG
CTCCATAAGAGCCAAAGCCC
54425[43]
Table 2. Distribution of the antibiotic resistance patterns, minimal inhibition concentration (MIC) range, MIC50 values, and MIC90 values for each antibiotic among H. pylori isolates used in this study.
Table 2. Distribution of the antibiotic resistance patterns, minimal inhibition concentration (MIC) range, MIC50 values, and MIC90 values for each antibiotic among H. pylori isolates used in this study.
Antibiotic AgentsMIC RangeMIC50MIC90No. (%) of MIC (mg/L)
SusceptibleResistant
MNZ0.25–128326412 (17.6)56 (82.4)
CLR a0.06–160.125840 (58.8)23 (33.8)
AMX0.03–0.50.060.547 (69.1)21 (30.9)
CIP0.06–320.51645 (66.2)23 (33.8)
LEV0.03–320.25849 (72.1)19 (27.9)
RIF0.03–320.5846 (67.6)22 (32.4)
TCN0.06–40.1250.565 (95.6)3 (4.4)
Abbreviations: MNZ, metronidazole; CLR, clarithromycin; AMX, amoxicillin; CIP, ciprofloxacin; LEV, levofloxacin; RIF, rifampicin; TCN, tetracycline; MIC, minimal inhibition concentrations. a Five (7.3%) H. pylori isolates had intermediate susceptibility against clarithromycin based on CLSI breakpoints (MIC values equal to 0.5 mg/L).
Table 3. Distribution of MIC values for each antibiotic among H. pylori isolates used in this study.
Table 3. Distribution of MIC values for each antibiotic among H. pylori isolates used in this study.
MIC (mg/L)No. (%)
MNZCLRAMXCIPLEVRIFTCN
0.03NANA24 (35.3)NA5 (7.3)5 (7.3)NA
0.06NA25 (36.8)15 (22)3 (4.4)4 (5.9)9 (13.2)17 (25)
0.125NA11 (16.2)8 (11.8)17 (25)10 (14.7)15 (22)32 (47)
0.254 (5.9)4 (5.9)12 (17.6)13 (19.1)15 (22)4 (5.9)7 (10.3)
0.5ND5 (7.3)9 (13.2)5 (7.3)6 (8.8)8 (11.8)5 (7.3)
13 (4.4)5 (7.3)ND7 (10.3)9 (13.2)5 (7.3)4 (5.9)
2ND6 (8.8)ND8 (11.8)7 (10.3)9 (13.2)2 (2.9)
4ND3 (4.4)ND3 (4.4)4 (5.9)2 (2.9)1 (1.5)
85 (7.3)2 (2.9)NA2 (2.9)3 (4.4)5 (7.3)ND
1616 (23.5)7 (10.3)NA9 (13.2)4 (18.2)4 (5.9)ND
3214 (20.6)NDNA1 (1.5)1 (1.5)2 (2.9)NA
6419 (27.9)NDNANANANANA
1287 (10.3)NANANANANANA
256NDNANANANANANA
Abbreviations: MNZ, metronidazole; CLR, clarithromycin; AMX, amoxicillin; CIP, ciprofloxacin; LEV, levofloxacin; RIF, rifampicin; TCN, tetracycline. NA, not applicable; ND, not detected.
Table 4. Distribution of the multidrug resistance profiles in relation to clinical outcomes among H. pylori isolates used in this study.
Table 4. Distribution of the multidrug resistance profiles in relation to clinical outcomes among H. pylori isolates used in this study.
Resistance ProfilesClinical DiagnosisTotal
No. (%)
CG
(n = 42)
PUD
(n = 18)
IM
(n = 7)
Single drugs
CLR2103 (4.5)
AMX1001 (1.5)
RIF2002 (3)
CIP0101 (1.5)
MNZ6219 (13.4)
Double drugs
MNZ + AMX3205 (7.5)
MNZ + RIF4116 (8.9)
CIP + RIF3104 (6)
MNZ + CIP2103 (4.5)
MNZ + LEV1102 (3)
Triple drugs
MNZ + CLR + LEV1214 (6)
MNZ + AMX + RIF3104 (6)
MNZ + CLR + CIP2114 (6)
MNZ + CLR + AMX1012 (3)
MNZ + AMX + CIP/LEV2103 (4.5)
MNZ + RIF + CIP/LEV3003 (4.5)
Quadruple drugs
MNZ + CLR + AMX + LEV2103 (4.5)
MNZ + CLR + AMX + CIP/LEV0011 (1.5)
MNZ + CLR + TCN + LEV1102 (3)
MNZ + TCN + RIF + LEV0011 (1.5)
MNZ + CLR + AMX + CIP1102 (3)
MNZ + CLR + CIP + RIF2002 (3)
Abbreviations: MNZ, metronidazole; CLR, clarithromycin; AMX, amoxicillin; CIP, ciprofloxacin; LEV, levofloxacin; RIF, rifampicin; TCN, tetracycline; CG, chronic gastritis; PUD, peptic ulcer disease; IM, intestinal metaplasia.
Table 5. Number of nucleotide insertion and deletion in frxA and rdxA genes involved in metronidazole resistance among H. pylori isolates used in this study.
Table 5. Number of nucleotide insertion and deletion in frxA and rdxA genes involved in metronidazole resistance among H. pylori isolates used in this study.
StrainsMetronidazole Resistance PhenotypeMIC (mg/L)No. of Nucleotide ins/delMutationsNo. of Nucleotide ins/delMutationSDR/MDRClinical Diagnosis
frxArdxA
OC80Susceptible0.25None aIn-frameNone aIn-frameN cCG
OC112Resistant32ND bND bNone aIn-frameMDRCG
HC114Resistant16Ins (2)/Del (4)FrameshiftNone aIn-frameSDRPUD
HC138Resistant32Del (2)FrameshiftNone aIn-frameMDRPUD
HC168Resistant32Del (1)FrameshiftND bND bMDRPUD
OC179Resistant64ND bND bND bND bSDRCG
OC180Resistant32Del (2)FrameshiftDel (4)FrameshiftMDRIM
OC217Resistant32Del (1)FrameshiftIns (1)FrameshiftMDRCG
OC218Susceptible0.25ND bND bND bND bSDRCG
OC235Resistant32Del (2)FrameshiftIns (9)FrameshiftMDRPUD
OC245Resistant8ND bND bND bND bMDRIM
OC250Susceptible1None aIn-frameNone aIn-frameSDRPUD
OC485Resistant128Del (1)FrameshiftNone aIn-frameMDRCG
OC494Susceptible0.25None aIn-frameNone aIn-frameMDRCG
OC557Resistant64Del (3)FrameshiftNone aIn-frameMDRPUD
OC562Susceptible8None aIn-frameNone aIn-frameSDRCG
OC571Resistant64None aIn-frameNone aIn-frameMDRCG
OC576Resistant64Del (1)FrameshiftQ50StopPTCSDRCG
OC688Resistant16Del (1)FrameshiftQ50StopPTCMDRIM
OC797Resistant16Del (1)FrameshiftNone aIn-frameMDRIM
OC803Resistant16None aIn-frameNone aIn-frameMDRCG
OC810Resistant64None aIn-frameDel (1)FrameshiftMDRCG
OC824Resistant128None aIn-frameQ50StopPTCMDRPUD
OC840Susceptible1None aIn-frameNone aIn-frameSDRPUD
OC852Resistant16ND bND bIns (4)FrameshiftMDRIM
OC897Resistant16None aIn-frameIns (6)/Del (2)FrameshiftSDRPUD
OC912Resistant16Del (1)FrameshiftDel (1)FrameshiftMDRPUD
OC913Resistant128Ins (3)/Del (1)FrameshiftNone aIn-frameMDRPUD
OC937Resistant128ND bND bDel (1)FrameshiftSDRCG
OC939Resistant64Q5StopPTCNone aIn-frameMDRPUD
OC975Resistant64None aIn-frameND bND bMDRIM
OC985Resistant64None aIn-frameDel (1)FrameshiftMDRCG
OC1031Resistant128Ins (2)FrameshiftDel (1)FrameshiftMDRCG
Abbreviations: Ins, nucleotide insertion; Del, nucleotide deletion; PTC, premature termination codon; SDR, single-drug resistance; MDR, multidrug resistance; CG, chronic gastritis; PUD, peptic ulcer disease; IM, intestinal metaplasia. a None, no specific variation detected as compared with genes or amino acids from metronidazole-sensitive H. pylori isolates; b ND, not determined (the obtained sequence was not appropriate for mutational analysis); c N, not resistant to any of the antibiotics tested.
Table 6. Mutations in gyrA and gyrB genes involved in fluoroquinolone resistance among H. pylori isolates used in this study.
Table 6. Mutations in gyrA and gyrB genes involved in fluoroquinolone resistance among H. pylori isolates used in this study.
StrainsResistance Phenotype
CIP/LEV
MIC (mg/L)MutationsSDR/MDRClinical Diagnosis
CIPLEVgyrAgyrB
OC80Susceptible/Susceptible0.50.06M191I, V199A, G208ED481EN cCG
OC112Susceptible/Susceptible0.250.25M191I, G208ENone aMDRCG
HC114Susceptible/Susceptible0.120.12M191I, G208ENone aSDRPUD
HC138Resistant/Susceptible160.5V150A, M191I, G208ENone aMDRPUD
HC168Susceptible/Susceptible0.250.06D143E, G208K, I212S, E214KND bMDRPUD
OC179Susceptible/Susceptible0.50.06M191I, V199A, G208AND bSDRCG
OC180Susceptible/Susceptible0.120.06V150A, M191I, V199A, G208ENone aMDRIM
OC217Susceptible/Susceptible0.120.06M191I, G208END bMDRCG
OC218Susceptible/Susceptible0.120.06ND bND bSDRCG
OC235Susceptible/Susceptible0.250.06D86N, M191I, G208ENone aMDRPUD
OC245Resistant/Resistant1616M191I, V199A, G208ANone aMDRIM
OC250 dResistant/Susceptible160.5D86G, M191INone aSDRPUD
OC485 dResistant/Susceptible20.12D86N, A183V, M191INone aMDRCG
OC494 dResistant/Susceptible320.5None aNone aMDRCG
OC557Susceptible/Resistant0.1216V199A, G208ENone aMDRPUD
OC562Susceptible/Susceptible10.12D86G, M191I, A207T, G208END bSDRCG
OC571Resistant/Resistant1616D86G, M191I, V199A, G208ENone aMDRCG
OC576Susceptible/Susceptible0.060.5V199A, G208ED481ESDRCG
OC688Susceptible/Susceptible11M191I, V199A, G208ENone aMDRIM
OC797Resistant/Susceptible20.03M191I, V199A, G208ED481E, R484KMDRIM
OC803Resistant/Susceptible20.03S63P, M191I, V199A, G208ENone aMDRCG
OC810Susceptible/Resistant132M191I, G208ENone aMDRCG
OC824Resistant/Resistant1616M191I, G208ED481E, R484KMDRPUD
OC840Susceptible/Susceptible10.06G208ENone aSDRPUD
OC852Susceptible/Resistant0.52M191I, G208ED481E, R484KMDRIM
OC897Susceptible/Susceptible0.250.03A97V, G208ENone aSDRPUD
OC912Resistant/Susceptible20.12G208ED481E, R484KMDRPUD
OC913Susceptible/Resistant0.2516M191I, G208ED481E, R484KMDRPUD
OC937Susceptible/Susceptible0.120.5G208ENone aSDRCG
OC939Resistant/Susceptible40.12M191I, G208ENone aMDRPUD
OC975Susceptible/Resistant0.2516D86N, R140K, M191I, G208ENone aMDRIM
OC985Susceptible/Susceptible0.120.06ND bNone aMDRCG
OC1031Resistant/Resistant1616D86N, M191I, G208END bMDRCG
Abbreviations: CIP, ciprofloxacin; LEV, levofloxacin; SDR, single-drug resistance; MDR, multidrug resistance; CG, chronic gastritis; PUD, peptic ulcer disease; IM, intestinal metaplasia. a None, no specific variation detected as compared with genes or amino acids from fluoroquinolone-sensitive H. pylori isolates; b ND, not determined (the obtained sequence was not appropriate for mutational analysis); c N, not resistant to any of the antibiotics tested; d the gyrA quinolone-resistant determining regions of the strains OC250, OC485, and OC494 were partially translated because of the low quality of the obtained sequences.
Table 7. Mutations in the 23S rRNA gene involved in clarithromycin resistance among H. pylori isolates used in this study.
Table 7. Mutations in the 23S rRNA gene involved in clarithromycin resistance among H. pylori isolates used in this study.
StrainsClarithromycin Resistance PhenotypeMIC (mg/L)MutationsSDR/MDRClinical Diagnosis
OC80Susceptible0.062None aN cCG
OC112Susceptible0.125ND bMDRCG
HC114Susceptible0.062None aSDRPUD
HC138Resistant16None aMDRPUD
HC168Susceptible0.062None aMDRPUD
OC179Susceptible0.062ND bSDRCG
OC180Resistant16A2143GMDRIM
OC217Susceptible0.062ND bMDRCG
OC218Susceptible0.25ND bSDRCG
OC235Intermediate0.5None aMDRPUD
OC245Resistant16ND bMDRIM
OC250Susceptible0.25None aSDRPUD
OC485Resistant2None aMDRCG
OC494Susceptible0.062None aMDRCG
OC557Resistant2C2195TMDRPUD
OC562Intermediate0.5ND bSDRCG
OC571Susceptible0.25None aMDRCG
OC576Susceptible0.125ND bSDRCG
OC688Susceptible0.125None aMDRIM
OC797Resistant16None aMDRIM
OC803Resistant1ND bMDRCG
OC810Resistant2C2195TMDRCG
OC824Susceptible0.062None aMDRPUD
OC840Resistant1A2143GSDRPUD
OC852Resistant2ND bMDRIM
OC897Susceptible0.062None aSDRPUD
OC912Intermediate0.5None aMDRPUD
OC913Susceptible0.125None aMDRPUD
OC937Susceptible0.125None aSDRCG
OC939Resistant4None aMDRPUD
OC975Susceptible0.125None aMDRIM
OC985Susceptible0.125None aMDRCG
OC1031Susceptible0.062None aMDRCG
Abbreviations: SDR, single-drug resistance; MDR, multidrug resistance; CG, chronic gastritis; PUD, peptic ulcer disease; IM, intestinal metaplasia. a None, no specific variation detected as compared with genes from clarithromycin-sensitive H. pylori isolates; b ND, not determined (the obtained sequence was not appropriate for mutational analysis); c N, not resistant to any of the antibiotics tested.
Table 8. Frequency and distribution of virulence genotypes in relation to antibiotic resistance patterns among H. pylori isolates used in this study.
Table 8. Frequency and distribution of virulence genotypes in relation to antibiotic resistance patterns among H. pylori isolates used in this study.
Virulence GenotypesResistance No. (%)Total No. (%)
MNZCLRAMXCIPLEVRIFTCN
S
(n = 12)
R
(n = 56)
S
(n = 40)
I
(n = 5)
R
(n = 23)
S
(n = 47)
R
(n = 21)
S
(n = 45)
R
(n = 23)
S
(n = 49)
R
(n = 19)
S
(n = 46)
R
(n = 22)
S
(n = 65)
R
(n = 3)
cagL+11 (16.2)55 (80.9)38 (55.9)5 (7.5)23 (33.8)46 (67.6)20 (29.4)43 (63.2)23 (33.8)47 (69.1)19 (27.9)44 (64.7)22 (32.3)63 (92.6)3 (4.4)66/68 (97)
cagL¯1 (1.5)1 (1.5)2 (2.9)001 (1.5)1 (1.5)2 (2.9)02 (2.9)02 (2.9)02 (2.9)02/68 (2.9)
cagA+5 (7.5)52 (76.5)33 (48.5)4 (5.9)20 (29.4)39 (57.3)18 (26.5)36 (52.9)21 (30.9)40 (58.8)17 (25)38 (55.9)19 (27.9)54 (79.4)3 (4.4)57/68 (83.8)
cagA¯7 (10.4)4 (5.9)7 (10.4)1 (1.5)3 (4.4)8 (11.8)3 (4.4)9 (13.2)2 (2.9)9 (13.2)2 (2.9)8 (11.8)3 (4.4)11 (16.2)011/68 (16.2)
cagA EPIYA motifs
ABC3 (5.3)36 (63.1)24 (42.1)2 (3.5)13 (22.8)29 (50.9)10 (17.5)28 (49.1)11 (19.3)27 (47.4)12 (21)27 (47.4)12 (21)37 (64.9)2 (3.5)39/57 (68.4)
ABCC1 (1.7)3 (5.3)2 (3.5)02 (3.5)1 (1.7)3 (5.3)1 (1.7)3 (5.3)3 (5.3)1 (1.7)2 (3.5)2 (3.5)4 (7))04/57 (7)
ABCCC02 (3.5)1 (1.7)01 (1.7)02 (3.5)02 (3.5)1 (1.7)1 (1.7)2 (3.5)01 (1.7)1 (1.7)2/57 (3.5)
Mixed type a1 (1.7)11 (19.3)6 (10.5)2 (3.5)4 (7)9 (15.8)3 (5.3)7 (12.3)5 (8.8)9 (15.8)3 (5.3)7 (12.3)5 (8.8)12 (21)012/57 (21)
cagPAI integrity
Intact cagPAI5 (7.5)39 (58.2)24 (35.2)3 (4.5)17 (25.4)32 (47.8)12 (17.9)26 (38.8)18 (26.9)31 (46.3)13 (22.8)26 (38.8)18 (26.9)41 (61.2)3 (4.5)44/67 (65.7)
Partial cagPAI7 (10.4)16 (23.9)15 (22.4)2 (3)6 (8.9)14 (20.9)9 (13.4)18 (26.9)5 (7.5)17 (25.4)6 (8.9)19 (28.3)4 (5.9)23 (34.3)023/67 (34.3)
Totally deleted cagPAI01 (1.5)1 (1.5)001 (1.5)01 (1.5)01 (1.5)01 (1.5)01 (1.5)01/68 (1.5)
vacA alleles
vacA s1m17 (10.4)23 (33.8)14 (20.6)2 (2.9)10 (14.7)18 (26.5)8 (11.8)17 (25)9 (13.2)19 (27.9)7 (10.4)18 (26.5)8 (11.8)25 (36.8)1 (1.5)26/68 (38.2)
vacA s1m24 (5.9)29 (42.6)22 (32.3)2 (2.9)11 (16.2)26 (38.2)9 (13.2)24 (35.3)11 (16.2)26 (38.2)9 (13.2)23 (33.8)12 (17.6)33 (48.5)2 (2.9)35/68 (51.5)
vacA s2m21 (1.5)4 (5.9)4 (5.9)1 (1.5)2 (2.9)3 (4.4)4 (5.9)4 (5.9)3 (4.4)4 (5.9)3 (4.4)5 (7.5)2 (2.9)7 (10.4)07/68 (10.3)
Adhesions
Oip “on”10 (14.7)49 (72)37 (54.4)3 (4.4)19 (27.9)44 (64.7)15 (22)38 (55.9)21 (30.9)42 (61.8)17 (25)40 (58.8)19 (27.9)57 (83.8)2 (2.9)59/68 (86.8)
Oip “off”2 (2.9)7 (10.4)3 (4.4)2 (2.9)4 (5.9)3 (4.4)6 (8.8)7 (10.4)2 (2.9)7 (10.4)2 (2.9)6 (8.8)3 (4.4)8 (11.8)1 (1.5)9/68 (13.2)
babA2+10 (14.7)55 (80.9)37 (54.4)5 (7.5)23 (33.8)45 (66.2)20 (29.4)43 (63.2)22 (32.3)46 (67.6)19 (27.9)44 (64.7)21 (30.9)62 (91.2)3 (4.4)65/68 (95.6)
babA2¯2 (2.9)1 (1.5)3 (4.4)002 (2.9)1 (1.5)2 (2.9)1 (1.5)3 (4.4)02 (2.9)1 (1.5)3 (4.4)03/68 (4.4)
sabA+3 (4.4)52 (76.5)32 (47)4 (5.9)19 (27.9)38 (55.9)17 (25)36 (52.9)19 (27.9)41 (60.3)14 (20.6)37 (54.4)18 (26.5)52 (76.5)3 (4.4)55/68 (80.9)
sabA¯9 (13.2)4 (5.9)8 (11.8)1 (1.5)4 (5.9)9 (13.2)4 (5.9)9 (13.2)4 (5.9)8 (11.8)5 (7.5)9 (13.2)4 (5.9)13 (19.1)013/68 (19.1)
dupA+5 (7.5)53 (77.9)34 (50)4 (5.9)20 (29.4)40 (58.8)18 (26.5)38 (55.9)20 (29.4)42 (61.8)16 (23.5)39 (57.3)19 (27.9)56 (82.3)2 (2.9)58/68 (85.3)
dupA¯7 (10.4)3 (4.4)6 (8.8)1 (1.5)3 (4.4)7 (10.4)3 (4.4)7 (10.4)3 (4.4)7 (10.4)3 (4.4)7 (10.4)3 (4.4)9 (13.2)1 (1.5)10/68 (14.7)
Abbreviations: MNZ, metronidazole; CLR, clarithromycin; AMX, amoxicillin; CIP, ciprofloxacin; LEV, levofloxacin; RIF, rifampicin; TCN, tetracycline; S, susceptible; I, intermediate; R, resistant, a Denotes the presence of multiple cagA EPIYA motifs, indicating mixed infections.

Share and Cite

MDPI and ACS Style

Farzi, N.; Yadegar, A.; Sadeghi, A.; Asadzadeh Aghdaei, H.; Marian Smith, S.; Raymond, J.; Suzuki, H.; Zali, M.R. High Prevalence of Antibiotic Resistance in Iranian Helicobacter pylori Isolates: Importance of Functional and Mutational Analysis of Resistance Genes and Virulence Genotyping. J. Clin. Med. 2019, 8, 2004. https://doi.org/10.3390/jcm8112004

AMA Style

Farzi N, Yadegar A, Sadeghi A, Asadzadeh Aghdaei H, Marian Smith S, Raymond J, Suzuki H, Zali MR. High Prevalence of Antibiotic Resistance in Iranian Helicobacter pylori Isolates: Importance of Functional and Mutational Analysis of Resistance Genes and Virulence Genotyping. Journal of Clinical Medicine. 2019; 8(11):2004. https://doi.org/10.3390/jcm8112004

Chicago/Turabian Style

Farzi, Nastaran, Abbas Yadegar, Amir Sadeghi, Hamid Asadzadeh Aghdaei, Sinéad Marian Smith, Josette Raymond, Hidekazu Suzuki, and Mohammad Reza Zali. 2019. "High Prevalence of Antibiotic Resistance in Iranian Helicobacter pylori Isolates: Importance of Functional and Mutational Analysis of Resistance Genes and Virulence Genotyping" Journal of Clinical Medicine 8, no. 11: 2004. https://doi.org/10.3390/jcm8112004

APA Style

Farzi, N., Yadegar, A., Sadeghi, A., Asadzadeh Aghdaei, H., Marian Smith, S., Raymond, J., Suzuki, H., & Zali, M. R. (2019). High Prevalence of Antibiotic Resistance in Iranian Helicobacter pylori Isolates: Importance of Functional and Mutational Analysis of Resistance Genes and Virulence Genotyping. Journal of Clinical Medicine, 8(11), 2004. https://doi.org/10.3390/jcm8112004

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop