Patient-Derived Head and Neck Cancer Organoids Recapitulate EGFR Expression Levels of Respective Tissues and Are Responsive to EGFR-Targeted Photodynamic Therapy
Abstract
1. Introduction
2. Experimental Section
2.1. Human Material for Organoid Cultures
2.2. Tissue Processing
2.3. Organoid Culture
2.4. Cell Line Culture
2.5. RNA Collection
2.6. cDNA Synthesis and Quantitative Polymerase Chain Reaction (PCR)
2.7. Photosensitizer Conjugation
2.8. EGFR Flow Cytometry
2.9. Immunohistochemistry
2.10. In Vitro PDT Assay on HNSCC Organoids
2.11. EGFR Overexpression Construct and Lentivirus Production
2.12. Organoid Infection and Doxycycline-Mediated Induction of EGFR Expression
3. Results
3.1. EGFR Expression Differs between Patient-Derived Organoids from Different Donors and Recapitulates EGFR Levels of Respective Tissues
3.2. Organoid Response to EGFR-Targeted PDT Is Donor-Dependent and Tumor-Specific
3.3. Organoid Response to EGFR-Targeted PDT Correlates with EGFR Expression Levels
3.4. Induction of EGFR Expression Increases Sensitivity to EGFR-Targeted PDT
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Acknowledgments
Conflicts of Interest
References
- Squier, C.; Kremer, M. Biology of oral mucosa and esophagus. J. Natl. Cancer Inst. Monogr. 2001, 29, 7–15. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Tijink, B.M.; Buter, J.; de Bree, R.; Giaccone, G.; Lang, M.S.; Staab, A.; Leemans, C.R.; van Dongen, G.A.M.S. A phase I dose escalation study with anti-CD44v6 bivatuzumab mertansine in patients with incurable squamous cell carcinoma of the head and neck or esophagus. Clin. Cancer Res. 2006, 12, 6064–6072. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Guan, J.; Li, Q.; Zhang, Y.; Xiao, N.; Chen, M.; Zhang, Y.; Li, L.; Chen, L. A meta-analysis comparing cisplatin-based to carboplatin-based chemotherapy in moderate to advanced squamous cell carcinoma of head and neck (SCCHN). Oncotarget 2016, 7, 7110–7119. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- The Cancer Genome Atlas Network. Comprehensive genomic characterization of head and neck squamous cell carcinomas. Nature 2015, 517, 576–582. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Bossi, P.; Resteghini, C.; Paielli, N.; Licitra, L.; Pilotti, S.; Perrone, F. Prognostic and predictive value of EGFR in head and neck squamous cell carcinoma. Oncotarget 2016, 7, 74362–74379. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Mandic, R.; Rodgarkia-Dara, C.J.; Zhu, L.; Folz, B.J.; Bette, M.; Weihe, E.; Neubauer, A.; Werner, J.A. Treatment of HNSCC cell lines with the EGFR-specific inhibitor cetuximab (Erbitux®) results in paradox phosphorylation of tyrosine 1173 in the receptor. FEBS Lett. 2006, 580, 4793–4800. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Bonner, J.A.; Harari, P.M.; Giralt, J.; Azarnia, N.; Shin, D.M.; Cohen, R.B.; Jones, C.U.; Sur, R.; Raben, D.; Jassem, J.; et al. Radiotherapy plus cetuximab for squamous-cell carcinoma of the head and neck. N. Engl. J. Med. 2006, 354, 567–578. [Google Scholar] [CrossRef] [Scilit]
- Argiris, A.; Karamouzis, M.V.; Raben, D.; Ferris, R.L. Head and neck cancer. Lancet (London, England) 2008, 371, 1695–1709. [Google Scholar] [CrossRef] [Scilit]
- Plaetzer, K.; Krammer, B.; Berlanda, J.; Berr, F.; Kiesslich, T. Photophysics and photochemistry of photodynamic therapy: Fundamental aspects. Lasers Med. Sci. 2009, 24, 259–268. [Google Scholar] [CrossRef] [Scilit]
- Trachootham, D.; Alexandre, J.; Huang, P. Targeting cancer cells by ROS-mediated mechanisms: A radical therapeutic approach? Nat. Rev. Drug Discov. 2009, 8, 579–591. [Google Scholar] [CrossRef] [Scilit]
- Curtin, J.F.; Donovan, M.; Cotter, T.G. Regulation and measurement of oxidative stress in apoptosis. J. Immunol. Methods 2002, 265, 49–72. [Google Scholar] [CrossRef] [Scilit]
- Agostinis, P.; Berg, K.; Cengel, K.A.; Foster, T.H.; Girotti, A.W.; Gollnick, S.O.; Hahn, S.M.; Hamblin, M.R.; Juzeniene, A.; Kessel, D. Photodynamic therapy of cancer: An update. CA Cancer J. Clin. 2011, 61, 250–281. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Mew, D.; Wat, C.-K.; Towers, G.H.; Levy, J.G. Photoimmunotherapy: Treatment of animal tumors with tumor-specific monoclonal antibody-hematoporphyrin conjugates. J. Immunol. 1983, 130, 1473–1477. [Google Scholar] [PubMed]
- Van Dongen, G.A.; Visser, G.W.; Vrouenraets, M.B. Photosensitizer-antibody conjugates for detection and therapy of cancer. Adv. Drug Deliv. Rev. 2004, 56, 31–52. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Cognetti, D.; Curry, J.M.; Gillenwater, A.M.; William, W.N.; Kochuparambil, S.T.; McDonald, D.; Fidler, M.; Stenson, K.M.; Vasan, N.R.; Razaq, M.A.; et al. A phase 2a, multicenter, open-label study of RM-1929 photoimmunotherapy in patients with recurrent head and neck cancer. Int. J. Radiat. Oncol. 2018, 100, 1368. [Google Scholar] [CrossRef] [Scilit]
- Heukers, R.; van Bergen en Henegouwen, P.M.; Oliveira, S. Nanobody-photosensitizer conjugates for targeted photodynamic therapy. Nanomedicine 2014, 10, 1441–1451. [Google Scholar] [CrossRef] [Scilit]
- Van Driel, P.B.A.A.; Boonstra, M.C.; Slooter, M.D.; Heukers, R.; Stammes, M.A.; Snoeks, T.J.A.; De Bruijn, H.S.; Van Diest, P.J.; Vahrmeijer, A.L.; van Bergen En Henegouwen, P.M.P.; et al. EGFR targeted nanobody-photosensitizer conjugates for photodynamic therapy in a pre-clinical model of head and neck cancer. J. Control. Release 2016, 229, 93–105. [Google Scholar] [CrossRef] [Scilit]
- Hamers-Casterman, C.; Atarhouch, T.; Muyldermans, S.; Robinson, G.; Hammers, C.; Songa, E.B.; Bendahman, N.; Hammers, R. Naturally occurring antibodies devoid of light chains. Nature 1993, 363, 446–448. [Google Scholar] [CrossRef] [Scilit]
- Carpenter, G.; Cohen, S. Epidermal growth factor. Annu. Rev. Biochem. 1979, 48, 193–216. [Google Scholar] [CrossRef] [Scilit]
- Kretzschmar, K.; Clevers, H. Organoids: Modeling Development and the Stem Cell Niche in a Dish. Dev. Cell 2016, 38, 590–600. [Google Scholar] [CrossRef] [Scilit]
- Driehuis, E.; Kolders, S.; Spelier, S.; Lõhmussaar, K.; Willems, S.M.; Devriese, L.A.; de Bree, R.; de Ruiter, E.J.; Korving, J.; Begthel, H.; et al. Oral mucosal organoids as a potential platform for personalized cancer therapy. Cancer Discov. 2019, 9, 852–871. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Broekgaarden, M.; Rizvi, I.; Bulin, A.L.; Petrovic, L.; Goldschmidt, R.; Massodi, I.; Celli, J.P.; Hasan, T. Neoadjuvant photodynamic therapy augments immediate and prolonged oxaliplatin efficacy in metastatic pancreatic cancer organoids. Oncotarget 2018, 9, 13009–13022. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zuchowska, A.; Jastrzebska, E.; Chudy, M.; Dybko, A.; Brzozka, Z. 3D lung spheroid cultures for evaluation of photodynamic therapy (PDT) procedures in microfluidic lab-on-a-chip system. Anal. Chim. Acta 2017, 990, 110–120. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Sato, K.; Hanaoka, H.; Watanabe, R.; Nakajima, T.; Choyke, P.L.; Kobayashi, H. Near infrared photoimmunotherapy in the treatment of disseminated peritoneal ovarian cancer. Mol. Cancer Ther. 2015, 14, 141–150. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Millard, M.; Yakavets, I.; Piffoux, M.; Brun, A.; Gazeau, F.; Guigner, J.-M.; Jasniewski, J.; Lassalle, H.-P.; Wilhelm, C.; Bezdetnaya, L. mTHPC-loaded extracellular vesicles outperform liposomal and free mTHPC formulations by an increased stability, drug delivery efficiency and cytotoxic effect in tridimensional model of tumors. Drug Deliv. 2018, 25, 1790–1801. [Google Scholar] [CrossRef] [Scilit]
- Vassilev, L.T.; Vu, B.T.; Graves, B.; Carvajal, D.; Podlaski, F.; Filipovic, Z.; Kong, N.; Kammlott, U.; Lukacs, C.; Klein, C.; et al. In vivo activation of the p53 pathway by small-molecule antagonists of MDM2. Science 2004, 303, 844–848. [Google Scholar] [CrossRef] [Scilit]
- Kalyankrishna, S.; Grandis, J.R. Epidermal growth factor receptor biology in head and neck cancer. J Clin. Oncol. 2006, 24, 2666–2672. [Google Scholar] [CrossRef] [Scilit]
- Heukers, R.; Vermeulen, J.F.; Fereidouni, F.; Bader, A.N.; Voortman, J.; Roovers, R.C.; Gerritsen, H.C.; Van Bergen En Henegouwen, P.M.P. Endocytosis of EGFR requires its kinase activity and N-terminal transmembrane dimerization motif. J. Cell Sci. 2013, 126, 4900–4912. [Google Scholar] [CrossRef] [Scilit]
- Gijsens, A.; Missiaen, L.; Merlevede, W.; De Witte, P. Epidermal growth factor-mediated targeting of chlorin e6 selectively potentiates its photodynamic activity. Cancer Res. 2000, 60, 2197–2202. [Google Scholar]
- Hemming, A.W.; Davis, N.L.; Dubois, B.; Quenville, N.F.; Finley, R.J. Photodynamic therapy of squamous cell carcinoma. An evaluation of a new photosensitizing agent, benzoporphyrin derivative and new photoimmunoconjugate. Surg. Oncol. 1993, 2, 187–196. [Google Scholar] [CrossRef] [Scilit]
- Kameyama, N.; Matsuda, S.; Itano, O.; Ito, A.; Konno, T.; Arai, T.; Ishihara, K.; Ueda, M.; Kitagawa, Y. Photodynamic therapy using an anti-EGF receptor antibody complexed with verteporfin nanoparticles: A proof of concept study. Cancer Biother. Radiopharm. 2011, 26, 697–704. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Master, A.; Malamas, A.; Solanki, R.; Clausen, D.M.; Eiseman, J.L.; Sen Gupta, A. A cell-targeted photodynamic nanomedicine strategy for head and neck cancers. Mol. Pharm. 2013, 10, 1988–1997. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Springa, B.Q.; Abu-Yousif, A.O.; Palanisami, A.; Rizvi, I.; Zheng, X.; Mai, Z.; Anbil, S.; Sears, R.B.; Mensah, L.B.; Goldschmidt, R.; et al. Selective treatment and monitoring of disseminated cancer micrometastases in vivo using dual-function, activatable immunoconjugates. Proc. Natl. Acad. Sci. USA 2014, 111, 933–942. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Mitsunaga, M.; Ogawa, M.; Kosaka, N.; Rosenblum, L.T.; Choyke, P.L.; Kobayashi, H. Cancer cell-selective in vivo near infrared photoimmunotherapy targeting specific membrane molecules. Nat. Med. 2011, 17, 1685–1691. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Maeding, N.; Verwanger, T.; Krammer, B. Boosting Tumor-Specific Immunity Using PDT. Cancers (Basel). 2016, 8, 91. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Luo, D.; Carter, K.A.; Miranda, D.; Lovell, J.F. Chemophototherapy: An emerging treatment option for solid tumors. Adv. Sci. 2017, 4, 1600106. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Schumacker, P.T. Reactive oxygen species in cancer cells: Live by the sword, die by the sword. Cancer Cell 2006, 10, 175–176. [Google Scholar] [CrossRef] [Scilit]
- Szatrowski, T.P.; Nathan, C.F. Production of large amounts of hydrogen peroxide by human tumor cells. Cancer Res. 1991, 51, 794–798. [Google Scholar]
- Carcenac, M.; Dorvillius, M.; Garambois, V.; Glaussel, F.; Larroque, C.; Langlois, R.; Hynes, N.E.; Van Lier, J.E.; Pèlegrin, A. Internalisation enhances photo-induced cytotoxicity of monoclonal antibody-phthalocyanine conjugates. Br. J. Cancer 2001, 85, 1787–1793. [Google Scholar] [CrossRef]
- Vrouenraets, M.B.; Visser, G.W.M.; Stigter, M.; Oppelaar, H.; Snow, G.B.; Van Dongen, G.A.M.S. Targeting of aluminum (III) phthalocyanine tetrasulfonate by use of internalizing monoclonal antibodies: Improved efficacy in photodynamic therapy. Cancer Res. 2001, 61, 1970–1975. [Google Scholar]
- Beltrán Hernández, I.; Rompen, R.; Rossin, R.; Xenaki, K.T.; Katrukha, E.A.; Nicolay, K.; van Bergen en Henegouwen, P.; Grüll, H.; Oliveira, S.; Beltran Hernandez, I. Imaging of tumor spheroids, dual-isotope SPECT, and autoradiographic analysis to assess the tumor uptake and distribution of different nanobodies. Mol. Imaging Biol. 2019. [Google Scholar] [CrossRef] [Scilit]
- Van De Wetering, M.; Francies, H.E.; Francis, J.M.; Bounova, G.; Iorio, F.; Pronk, A.; Van Houdt, W.; Van Gorp, J.; Taylor-Weiner, A.; Kester, L.; et al. Prospective derivation of a living organoid biobank of colorectal cancer patients. Cell 2015, 161, 933–945. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Mullenders, J.; de Jongh, E.; Brousali, A.; Roosen, M.; Blom, J.P.A.; Begthel, H.; Korving, J.; Jonges, T.; Kranenburg, O.; Meijer, R.; et al. Mouse and human urothelial cancer organoids: A tool for bladder cancer research. Proc. Natl. Acad. Sci. USA 2019, 116, 4567–4574. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ooft, S.N.; Weeber, F.; Dijkstra, K.K.; McLean, C.M.; Kaing, S.; van Werkhoven, E.; Schipper, L.; Hoes, L.; Vis, D.J.; van de Haar, J.; et al. Patient-derived organoids can predict response to chemotherapy in metastatic colorectal cancer patients. Sci. Transl. Med. 2019, 11. [Google Scholar] [CrossRef] [Scilit]
- Sachs, N.; de Ligt, J.; Kopper, O.; Gogola, E.; Bounova, G.; Weeber, F.; Balgobind, A.V.; Wind, K.; Gracanin, A.; Begthel, H.; et al. A living biobank of breast cancer organoids captures disease heterogeneity. Cell 2018, 172, 373–386. [Google Scholar] [CrossRef] [Scilit]
- Tiriac, H.; Belleau, P.; Engle, D.D.; Plenker, D.; Deschênes, A.; Somerville, T.; Froeling, F.E.M.; Burkhart, R.A.; Denroche, R.E.; Jang, G.-H.; et al. Organoid profiling identifies common responders to chemotherapy in pancreatic cancer. Cancer Discov. 2018, 8, 1112–1129. [Google Scholar] [CrossRef] [Scilit]
- Kopper, O.; de Witte, C.J.; Lohmussaar, K.; Valle-Inclan, J.E.; Hami, N.; Kester, L.; Balgobind, A.V.; Korving, J.; Proost, N.; Begthel, H.; et al. An organoid platform for ovarian cancer captures intra- and interpatient heterogeneity. Nat. Med. 2019, 25, 838–849. [Google Scholar] [CrossRef] [Scilit]
- Vlachogiannis, G.; Hedayat, S.; Vatsiou, A.; Jamin, Y.; Fernández-Mateos, J.; Khan, K.; Lampis, A.; Eason, K.; Huntingford, I.; Burke, R.; et al. Patient-derived organoids model treatment response of metastatic gastrointestinal cancers. Science 2018, 926, 920–926. [Google Scholar] [CrossRef] [Scilit]
- Broutier, L.; Mastrogiovanni, G.; Verstegen, M.M.; Francies, H.E.; Gavarró, L.M.; Bradshaw, C.R.; Allen, G.E.; Arnes-Benito, R.; Sidorova, O.; Gaspersz, M.P.; et al. Human primary liver cancer-derived organoid cultures for disease modeling and drug screening. Nat. Med. 2017, 23, 1424–1435. [Google Scholar] [CrossRef] [Scilit]
- Yan, H.H.N.; Siu, H.C.; Law, S.; Ho, S.L.; Yue, S.S.K.; Tsui, W.Y.; Chan, D.; Chan, A.S.; Ma, S.; Lam, K.O.; et al. A comprehensive human gastric cancer organoid biobank captures tumor subtype heterogeneity and enables therapeutic screening. Cell Stem Cell 2018, 23, 882–897. [Google Scholar] [CrossRef] [Scilit]
- Ganesh, K.; Wu, C.; O’Rourke, K.P.; Adileh, M.; Szeglin, B.C.; Wasserman, I.; Marco, M.R.; Shady, M.; Zheng, Y.; Karthaus, W.R.; et al. A rectal cancer model establishes a platform to study individual responses to chemoradiation. bioRxiv 2019. [Google Scholar] [CrossRef] [Scilit]
- Lee, S.H.; Hu, W.; Matulay, J.T.; Silva, M.V.; Owczarek, T.B.; Kim, K.; Chua, C.W.; Barlow, L.M.J.; Kandoth, C.; Williams, A.B.; et al. Tumor evolution and drug response in patient-derived organoid models of bladder cancer. Cell 2018, 173, 515–528. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Dekkers, J.F.; Wiegerinck, C.L.; de Jonge, H.R.; Bronsveld, I.; Janssens, H.M.; de Winter-de Groot, K.M.; Brandsma, A.M.; de Jong, N.W.M.; Bijvelds, M.J.C.; Scholte, B.J.; et al. A functional CFTR assay using primary cystic fibrosis intestinal organoids. Nat. Med. 2013, 19, 939–945. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Berkers, G.; van Mourik, P.; Vonk, A.M.; Kruisselbrink, E.; Dekkers, J.F.; de Winter-de Groot, K.M.; Arets, H.G.M.; Marck-van der Wilt, R.E.P.; Dijkema, J.S.; Vanderschuren, M.M.; et al. Rectal organoids enable personalized treatment of cystic fibrosis. Cell Rep. 2019, 26, 1701–1708. [Google Scholar] [CrossRef] [Scilit]




| Primer | Sequence ′5→′3 |
|---|---|
| Human EGFR FW | AGGCAGGAGTAACAAGCTCAC |
| Human EGFR RV | ATGAGGACATAACCAGCCACC |
| Human GAPDH FW | GGAGCGAGATCCCTCCAAAAT |
| Human GAPDH RV | GGCTGTTGTCATACTTCTCATCG |
| Organoid | Gender | Age | Tumor Location | HPV Status | Sequencing to Confirm Tumor Status | Tumor Status Confirmed? | N/T |
|---|---|---|---|---|---|---|---|
| 1 | male | 61 | tongue | negative | oncopanel | Yes | T |
| 2 | female | 90 | larynx | negative | oncopanel | Yes | T |
| 3 | female | 83 | larynx | negative | oncopanel | Yes | T |
| 4 | male | 60 | tongue | negative | oncopanel | Yes | N/T |
| 5 | male | 80 | parotid gland | negative | exome sequencing | Yes | N/T |
| 6 | male | 82 | oral cavity | negative | oncopanel | Yes | T |
| 8 | female | 70 | gingiva | negative | exome sequencing | Yes | N/T |
© 2019 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Driehuis, E.; Spelier, S.; Beltrán Hernández, I.; de Bree, R.; M. Willems, S.; Clevers, H.; Oliveira, S. Patient-Derived Head and Neck Cancer Organoids Recapitulate EGFR Expression Levels of Respective Tissues and Are Responsive to EGFR-Targeted Photodynamic Therapy. J. Clin. Med. 2019, 8, 1880. https://doi.org/10.3390/jcm8111880
Driehuis E, Spelier S, Beltrán Hernández I, de Bree R, M. Willems S, Clevers H, Oliveira S. Patient-Derived Head and Neck Cancer Organoids Recapitulate EGFR Expression Levels of Respective Tissues and Are Responsive to EGFR-Targeted Photodynamic Therapy. Journal of Clinical Medicine. 2019; 8(11):1880. https://doi.org/10.3390/jcm8111880
Chicago/Turabian StyleDriehuis, Else, Sacha Spelier, Irati Beltrán Hernández, Remco de Bree, Stefan M. Willems, Hans Clevers, and Sabrina Oliveira. 2019. "Patient-Derived Head and Neck Cancer Organoids Recapitulate EGFR Expression Levels of Respective Tissues and Are Responsive to EGFR-Targeted Photodynamic Therapy" Journal of Clinical Medicine 8, no. 11: 1880. https://doi.org/10.3390/jcm8111880
APA StyleDriehuis, E., Spelier, S., Beltrán Hernández, I., de Bree, R., M. Willems, S., Clevers, H., & Oliveira, S. (2019). Patient-Derived Head and Neck Cancer Organoids Recapitulate EGFR Expression Levels of Respective Tissues and Are Responsive to EGFR-Targeted Photodynamic Therapy. Journal of Clinical Medicine, 8(11), 1880. https://doi.org/10.3390/jcm8111880

