The Interaction of miR-378i-Skp2 Regulates Cell Senescence in Diabetic Nephropathy
Abstract
1. Introduction
2. Materials and Methods
2.1. Cell Lines and Cell Cultures
2.2. Senescence-Associated β-Galactosidase (SAβ-Gal) Staining
2.3. Western Blot Analysis
2.4. RNA Sequencing
2.5. Database for Annotation, Visualization and Integrated Discovery (DAVID) Bioinformatics Resources
2.6. Search Tool for the Retrieval of Interacting Genes (STRING)
2.7. Ingenuity Pathway Analysis (IPA)
2.8. TargetScan and MiRmap Database
2.9. RNA Extraction and Reverse Transcription PCR (RT-PCR)
2.10. Transient Transfection
2.11. Experimental Animals
2.12. Human Study Participants
2.13. Laboratory Data Measurement and Quantification of Urinary IL-6, IL-8, MCP-1 and Urinary Albumin/Creatinine Ratio (ACR) in Mice and Humans
2.14. Immunohistochemistry Stain of Humans and Mice Kidneys
2.15. Statistical Analysis
3. Results
3.1. HG Induces PTEC Senescence in DN
3.2. Identification of Differentially Expressed Genes Associated with Cell Senescence in PTECs of DM Patients and Normal Individuals
3.3. Decreased Skp2 Expression Contributes to Cell Senescence in DN
3.4. Identification of Potential miR-378i-Skp2 Interaction in Diabetic PTECs
3.5. Urinary miR-378i Levels are Positively Correlated with Urinary SASP Levels and Albuminuria in Mice and Type 2 DM Patients
4. Discussion
5. Conclusions
Author Contributions
Funding
Acknowledgments
Conflicts of Interest
References
- Shaw, J.E.; Sicree, R.A.; Zimmet, P.Z. Global estimates of the prevalence of diabetes for 2010 and 2030. Diabetes Res. Clin. Pract. 2010, 87, 4–14. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kanwar, Y.S.; Wada, J.; Sun, L.; Xie, P.; Wallner, E.I.; Chen, S.; Chugh, S.; Danesh, F.R. Diabetic nephropathy: Mechanisms of renal disease progression. Exp. Biol. Med. 2008, 233, 4–11. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Phillips, A.O.; Steadman, R. Diabetic nephropathy: The central role of renal proximal tubular cells in tubulointerstitial injury. Histol. Histopathol. 2002, 17, 247–252. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Vallon, V. The proximal tubule in the pathophysiology of the diabetic kidney. Am. J. Physiol. Regul. Integr. Comp. Physiol. 2011, 300, R1009–R1022. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Sturmlechner, I.; Durik, M.; Sieben, C.J.; Baker, D.J.; van Deursen, J.M. Cellular senescence in renal ageing and disease. Nat. Rev. Nephrol. 2017, 13, 77–89. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ren, J.L.; Pan, J.S.; Lu, Y.P.; Sun, P.; Han, J. Inflammatory signaling and cellular senescence. Cell. Signal. 2009, 21, 378–383. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Satriano, J.; Mansoury, H.; Deng, A.; Sharma, K.; Vallon, V.; Blantz, R.C.; Thomson, S.C. Transition of kidney tubule cells to a senescent phenotype in early experimental diabetes. Am. J. Physiol. Cell. Physiol. 2010, 299, C374–C380. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Sebastian, C.; Lloberas, J.; Celada, A. Molecular and cellular aspects of macrophage aging. In Handbook On Immunosenescence; Fulop, T., Ed.; Springer: Dordrecht, The Netherlands, 2009; pp. 919–945. [Google Scholar] [CrossRef] [Scilit]
- Coppé, J.P.; Patil, C.K.; Rodier, F.; Sun, Y.; Muñoz, D.P.; Goldstein, J.; Nelson, P.S.; Desprez, P.Y.; Campisi, J. Senescence-associated secretory phenotypes reveal cell-nonautonomous functions of oncogenic RAS and the p53 tumor suppressor. PLoS Biol. 2008, 6, 2853–2868. [Google Scholar] [CrossRef] [Scilit]
- Adams, P.D. Healing and Hurting: Molecular Mechanisms, Functions, and Pathologies of Cellular Senescence. Mol. Cell. 2009, 36, 2–14. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Tchkonia, T.; Zhu, Y.; van Deursen, J.; Campisi, J.; Kirkland, J.L. Cellular senescence and the senescent secretory phenotype: therapeutic opportunities. J. Clin. Invest. 2013, 123, 966–972. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Campisi, J.; di Fagagna, F.D.A. Cellular senescence: When bad things happen to good cells. Nat. Rev. Mol. Cell Biol. 2007, 8, 729–740. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Sone, H.; Kagawa, Y. Pancreatic β cell senescence contributes to the pathogenesis of type 2 diabetes in high-fat diet-induced diabetic mice. Diabetologia 2005, 48, 58–67. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Yokoi, T.; Fukuo, K.; Yasuda, O.; Hotta, M.; Miyazaki, J.; Takemura, Y.; Kawamoto, H.; Ichijo, H.; Ogihara, T. Apoptosis signal-regulating kinase 1 mediates cellular senescence induced by high glucose in endothelial cells. Diabetes 2006, 55, 1660–1665. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Verzola, D.; Gandolfo, M.T.; Gaetani, G.; Ferraris, A.; Mangerini, R.; Ferrario, F.; Villaggio, B.; Gianiorio, F.; Tosetti, F.; Weiss, U.; et al. Accelerated senescence in the kidneys of patients with type 2 diabetic nephropathy. Am. J. Physiol. Renal Physiol. 2008, 295, F1563–F1573. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kitada, K.; Nakano, D.; Ohsaki, H.; Hitomi, H.; Minamino, T.; Yatabe, J.; Felder, R.A.; Mori, H.; Masaki, T.; Kobori, H.; et al. Hyperglycemia causes cellular senescence via a SGLT2- and p21-dependent pathway in proximal tubules in the early stage of diabetic nephropathy. J. Diabetes Complicat. 2014, 28, 604–611. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Jinek, M.; Doudna, J.A. A three-dimensional view of the molecular machinery of RNA interference. Nature 2009, 457, 405–412. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Weilner, S.; Grillari-Voglauer, R.; Redl, H.; Grillari, J.; Nau, T. The role of microRNAs in cellular senescence and age-related conditions of cartilage and bone. Acta Orthop. 2015, 86, 92–99. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Williams, J.; Smith, F.; Kumar, S.; Vijayan, M.; Reddy, P.H. Are microRNAs true sensors of ageing and cellular senescence? Ageing Res. Rev. 2017, 35, 350–363. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Chen, Y.J.; Chang, W.A.; Wu, L.Y.; Hsu, Y.L.; Chen, C.H.; Kuo, P.L. Systematic analysis of differential expression profile in rheumatoid arthritis chondrocytes using next-generation sequencing and bioinformatics approaches. Int. J. Med. Sci. 2018, 15, 1129–1142. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Huang, D.W.; Sherman, B.T.; Tan, Q.; Kir, J.; Liu, D.; Bryant, D.; Guo, Y.; Stephens, R.; Baseler, M.W.; Lane, H.C.; et al. DAVID bioinformatics resources: Expanded annotation database and novel algorithms to better extract biology from large gene lists. Nucleic Acids Res. 2007, 35, W169–W175. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Szklarczyk, D.; Franceschini, A.; Wyder, S.; Forslund, K.; Heller, D.; Huerta-Cepas, J.; Simonovic, M.; Roth, A.; Santos, A.; Tsafou, K.P.; et al. STRING v10: Protein-protein interaction networks, integrated over the tree of life. Nucleic Acids Res. 2015, 43, D447–D452. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Thomas, S.; Bonchev, D. A survey of current software for network analysis in molecular biology. Hum. Genomics 2010, 4, 353–360. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Vejnar, C.E.; Zdobnov, E.M. Mirmap: Comprehensive prediction of microRNA target repression strength. Nucleic Acids Res. 2012, 40, 11673–11683. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Vickery, S.; Stevens, P.E.; Dalton, R.N.; van Lente, F.; Lamb, E.J. Does the ID-MS traceable MDRD equation work and is it suitable for use with compensated Jaffe and enzymatic creatinine assays? Nephrol. Dial. Transplant. 2006, 21, 2439–2445. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Levey, A.S.; Bosch, J.P.; Lewis, J.B.; Greene, T.; Rogers, N.; Roth, D. A more accurate method to estimate glomerular filtration rate from serum creatinine: A new prediction equation. Modification of diet in renal disease study group. Ann. Intern. Med. 1999, 130, 461–470. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Varghese, F.; Bukhari, A.B.; Malhotra, R.; De, A. IHC Profiler: An open source plugin for the quantitative evaluation and automated scoring of immunohistochemistry images of human tissue samples. PLoS ONE 2014, 9, e96801. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Khan, S.S.; Quaggin, S.E. Therapies on the Horizon for Diabetic Kidney Disease. Curr. Diab. Rep. 2015, 15, 111. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wang, W.J.; Cai, G.Y.; Chen, X.M. Cellular senescence, senescence-associated secretory phenotype, and chronic kidney disease. Oncotarget 2017, 8, 64520–64533. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Bhat, R.; Crowe, E.P.; Bitto, A.; Moh, M.; Katsetos, C.D.; Garcia, F.U.; Johnson, F.B.; Trojanowski, J.Q.; Sell, C.; Torres, C. Astrocyte senescence as a component of Alzheimer’s disease. PLoS ONE. 2012, 7, e45069. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zheng, N.; Schulman, B.A.; Song, L.; Miller, J.J.; Jeffrey, P.D.; Wang, P.; Chu, C.; Koepp, D.M.; Elledge, S.J.; Pagano, M.; et al. Structure of the Cul1-Rbx1-Skp1-F boxSkp2 SCF ubiquitin ligase complex. Nature 2002, 416, 703–709. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wei, W.; Ayad, N.G.; Wan, Y.; Zhang, G.J.; Kirschner, M.W.; Kaelin, W.G., Jr. Degradation of the SCF component Skp2 in cellcycle phase G1 by the anaphase-promoting complex. Nature 2004, 428, 194–198. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Hao, Z.; Huang, S. E3 ubiquitin ligase Skp2 as an attractive target in cancer therapy. Front. Biosci. (Landmark Ed.) 2015, 20, 474–490. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Lin, H.K.; Chen, Z.; Wang, G.; Nardella, C.; Lee, S.W.; Chan, C.H.; Yang, W.L.; Wang, J.; Egia, A.; Nakayama, K.I.; et al. Skp2 targeting suppresses tumorigenesis by Arf-p53-independent cellular senescence. Nature 2010, 464, 374–379. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Su, B.; Chen, X.; Zhong, C.; Guo, N.; He, J.; Fan, Y. All-trans retinoic acid inhibits mesangial cell proliferation by up-regulating p21Waf1/Cip1 and p27Kip1 and down-regulating Skp2. J. Nephrol. 2012, 25, 1031–1040. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Liu, S.; Xie, Y.; Lv, Y.; Qin, F.; Fu, B.; Shi, S.; Yin, Z.; Hong, Q.; Zhang, X.; Wang, J.; et al. A novel target of mizoribine inhibiting mesangial cell proliferation: S phase kinase-associated protein 2. Am. J. Nephrol. 2010, 32, 447–455. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Su, H.; Wan, Q.; Tian, X.J.; He, F.F.; Gao, P.; Tang, H.; Ye, C.; Fan, D.; Chen, S.; Wang, Y.M.; et al. MAD2B contributes to podocyte injury of diabetic nephropathy via inducing cyclin B1 and Skp2 accumulation. Am. J. Physiol. Renal Physiol. 2015, 308, 728–736. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Lawson, C.; Vicencio, J.M.; Yellon, D.M.; Davidson, S.M. Microvesicles and exosomes: New players in metabolic and cardiovascular disease. J. Endocrinol. 2016, 228, 57–71. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Bu, H.; Wedel, S.; Cavinato, M.; Jansen-Dürr, P. MicroRNA Regulation of Oxidative Stress-Induced Cellular Senescence. Oxid. Med. Cell. Longev. 2017, 2017, 2398696. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Nassirpour, R.; Mathur, S.; Gosink, M.M.; Li, Y.; Shoieb, A.M.; Wood, J.; O’Neil, S.P.; Homer, B.L.; Whiteley, L.O. Identification of tubular injury microRNA biomarkers in urine: comparison of next-generation sequencing and qPCR-based profiling platforms. BMC Genomics 2014, 15, 485. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zhou, J.; Han, S.; Qian, W.; Gu, Y.; Li, X.; Yang, K. Metformin induces miR-378 to downregulate the CDK1, leading to suppression of cell proliferation in hepatocellular carcinoma. Onco Targets Ther. 2018, 11, 4451–4459. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zeng, M.; Zhu, L.; Li, L.; Kang, C. miR-378 suppresses the proliferation, migration and invasion of colon cancer cells by inhibiting SDAD1. Cell. Mol. Biol. Lett. 2017, 22, 12. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wagner, M.C.; Campos-Bilderback, S.B.; Chowdhury, M.; Flores, B.; Lai, X.; Myslinski, J.; Pandit, S.; Sandoval, R.M.; Wean, S.E.; Wei, Y.; et al. Proximal Tubules Have the Capacity to Regulate Uptake of Albumin. J. Am. Soc. Nephrol. 2016, 27, 482–494. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Dickson, L.E.; Wagner, M.C.; Sandoval, R.M.; Molitoris, B.A. The proximal tubule and albuminuria: really! J. Am. Soc. Nephrol. 2014, 25, 443–453. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Poronnik, P.; Nikolic-Paterson, D.J. Renal physiology: The proximal tubule and albuminuria—At last a starring role. Nat. Rev. Nephrol. 2015, 11, 573–575. [Google Scholar] [CrossRef] [Scilit] [PubMed]









| Mouse Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) | Forward AACTTTGGCATTGTGTGGAAGG |
| Reverse ACACATTGGGGGTAGGAACA | |
| Homo Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) | Forward GAGTCAACGGATTTGGTCGT |
| Reverse TTGATTTTGGAGGGATCTCG | |
| hsa-miR-378i | 5′d ACTGGACTAGGAGTCAGAAGG 3′ |
| mmu-miR-378a-3p | 5′d ACTGGACTTGGAGTCAGAAGG 3′ |
| miRIDIAN microRNA Human hsa-miR378i-Mimic | ACUGGACUAGGAGUCAGAAGG |
| Homo SKP2 | Forward AATTTGCCCTGCAGACTTTG |
| Reverse CTGGAGATTCTTTCTGTAGCCG |
| Top Diseases and Functions | Score | Focus Molecules | Molecules in Network | |
|---|---|---|---|---|
| 1 | Cell Cycle, Cell Morphology, Cellular Movement | 46 | 27 | ADAM11, AKR1B10, AKR1D1, caspase, CDK15, cytochrome C, FAM83G, H1F0, HSPA13, KLF4, LAMP3, MMD, MSR1, NMDA Receptor, NT5E, NUPR1, PARP, Pkc(s), PRKCE, PXK, RAB32, RAB39B, RCN3, SLC30A2, SLC47A1, SLC6A9, Sos, STAT5a/b, STC2, TICRR, Tnf (family), TRIM29, ULBP1, XAF1, XBP1 |
| 2 | Cellular Development, Cellular Growth and Proliferation, Connective Tissue Development and Function | 37 | 23 | ACVR1, ANK1, AURK, Cbp/p300, CCNF, CEBPA, CKB, Ctbp, DKK3, FAM49A, GSTM1, H2AFZ, Hdac, HIST1H2BA, HISTONE, histone deacetylase, Histone h3, Histone h4, HMG CoA synthase, Hsp90, INHBE, JMY, KLF15, MEF2A, MEF2C, NDRG2, NPM2, NUAK2, P38 MAPK, PPARG, PSTPIP2, RNA polymerase II, SESN2, TBX15, TFAP2B |
| 3 | Cellular Compromise, Cellular Function Maintenance, Immunological Disease | 18 | 14 | Alp, AMPK, ASNS, ATF3, CTH, DDIT3, DPEP1, ERK, ERN1, GADD45, GDF15, GNRH, GOT, GOT1, Growth hormone, HDL, HDL-cholesterol, hemoglobin, IFN Beta, IgG, IgG2a, Igm, IL12 (complex), Ldh (complex), LDL, LIPG, NADPH oxidase, NFIL3, PCK2, PI3K (family), PPP1R3G, PRKAA, Pro-inflammatory Cytokine, SAA2, TRIB3 |
| 4 | Cellular Development, Cellular Growth and Proliferation, Organ Development | 15 | 12 | Akt, calpain, Cdc2, Cdk, CDO1, Collagen type IV, Collagen(s), Cyclin A, Cyclin D, Cyclin E, E2f, ELN, FBLN1, FGF2, Fibrin, Fibrinogen, GABP, gelatinase, HEY1, Laminin (complex), MLPH, ORC1, Pdgf (complex), PDGF BB, PDGF-AA, PLAT, PRKG2, Ptk, Rb, SERPINF, SERPINF2, SKP2, trypsin, Wnt, ZFP57 |
| 5 | Cellular Growth and Proliferation, Hair and Skin Development and Function, Cancer | 13 | 11 | AGT, Ap1, BNC1, Calmodulin, Cg, EREG, FSH, G protein alphai, GLI2, Gpcr, Gpd, ID4, Insulin, Lh, LZTS1, Mapk, Mek, Mmp, p70 S6k, Pka, Pka catalytic subunit, PLA1A, PLC, PPEF2, Ras, Sfk, SFRP1, Shc, SLC4A4, Smad, Smad2/3, SSTR5, Tgf beta, Vegf, voltage-gated calcium channel |
| miRNA | Precursor | Log2 Ratio | Fold Change | DM Seq (norm) | Non-DM Seq (norm) | DM Read Count | Non-DM Read Count | Target Gene | Fold Change |
|---|---|---|---|---|---|---|---|---|---|
| hsa-miR-378i | hsa-mir-378i | 1.02 | 2.02 | 9.61 | 4.76 | 111 | 53 | Skp2 | −1.504 |
| hsa-miR-92a-1-5p | hsa-mir-92a-1 | 1.05 | 2.07 | 9.09 | 4.4 | 105 | 49 | ORC1 | −1.666 |
| hsa-miR-4454 | hsa-mir-4454 | 1.07 | 2.11 | 11.35 | 5.39 | 131 | 60 |
| db/m mice n = 6 | db/db mice n = 6 | p-Value | |
|---|---|---|---|
| Post-meal blood glucose, mg/dL | 204.6 ± 65.9 | 521.8 ± 44.7 | <0.001 |
| Blood urea nitrogen, mg/dL | 12.9 ± 1.6 | 42.7 ± 21.5 | 0.02 |
| Serum creatinine, mg/dL; | 0.0 ± 0.1 | 0.1 ± 0.1 | 0.02 |
| Urinary albumin/creatinine ratio, mg/g | 26.9 (3.0–30.8) | 717.9 (282.1–1737.7) | <0.001 |
| Normal Individuals n = 45 | Type 2 Diabetes n = 107 | p-Value | |
|---|---|---|---|
| Age, years | 60.4 ± 6.6 | 63.3 ± 11.0 | 0.05 |
| Sex (male), % | 53.3 | 54.2 | 0.92 |
| Fasting blood glucose, mg/dL | 107.9 ± 33.4 | 146.2 ± 51.9 | <0.001 |
| Blood urea nitrogen, mg/dL | 15.2 ± 3.6 | 20.2 ± 9.3 | <0.001 |
| Serum creatinine, mg/dL | 0.8 ± 0.2 | 1.2 ± 0.7 | <0.001 |
| Estimated glomerular filtration rate, mL/min/1.73m2 | 97.5 ± 19.4 | 66.8 ± 29.7 | <0.001 |
| Urine albumin/creatinine ratio, mg/g | 2.8 (1.4–4.7) | 77.0 (22.9–596.5) | <0.001 |
| ACEI/ARB usage, % | 33.8 |
| Urinary Parameters | Unstandardized Coefficient β (95% CI) | p-Value |
|---|---|---|
| miR378i/Cr | 2.616 (0.863–4.369) | 0.004 |
| IL-6/Cr, pg/mg | 0.097 (0.058–0.135) | <0.001 |
| IL-8/Cr, pg/mg | 0.015 (0.007–0.023) | <0.001 |
| MCP-1, pg/mg | 0.002 (0.001–0.003) | 0.003 |
© 2018 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Tsai, Y.-C.; Kuo, P.-L.; Kuo, M.-C.; Hung, W.-W.; Wu, L.-Y.; Chang, W.-A.; Wu, P.-H.; Lee, S.-C.; Chen, H.-C.; Hsu, Y.-L. The Interaction of miR-378i-Skp2 Regulates Cell Senescence in Diabetic Nephropathy. J. Clin. Med. 2018, 7, 468. https://doi.org/10.3390/jcm7120468
Tsai Y-C, Kuo P-L, Kuo M-C, Hung W-W, Wu L-Y, Chang W-A, Wu P-H, Lee S-C, Chen H-C, Hsu Y-L. The Interaction of miR-378i-Skp2 Regulates Cell Senescence in Diabetic Nephropathy. Journal of Clinical Medicine. 2018; 7(12):468. https://doi.org/10.3390/jcm7120468
Chicago/Turabian StyleTsai, Yi-Chun, Po-Lin Kuo, Mei-Chuan Kuo, Wei-Wen Hung, Ling-Yu Wu, Wei-An Chang, Ping-Hsun Wu, Su-Chu Lee, Hung-Chun Chen, and Ya-Ling Hsu. 2018. "The Interaction of miR-378i-Skp2 Regulates Cell Senescence in Diabetic Nephropathy" Journal of Clinical Medicine 7, no. 12: 468. https://doi.org/10.3390/jcm7120468
APA StyleTsai, Y.-C., Kuo, P.-L., Kuo, M.-C., Hung, W.-W., Wu, L.-Y., Chang, W.-A., Wu, P.-H., Lee, S.-C., Chen, H.-C., & Hsu, Y.-L. (2018). The Interaction of miR-378i-Skp2 Regulates Cell Senescence in Diabetic Nephropathy. Journal of Clinical Medicine, 7(12), 468. https://doi.org/10.3390/jcm7120468

