The Effect of Sex and Obesity on the Gene Expression of Lipid Flippases in Adipose Tissue
Abstract
:1. Introduction
2. Materials and Methods
2.1. Subjects
2.2. Sample Collection and Laboratory Measurements
2.3. Gene Expression
2.4. Prediction of Putative miR Modulators
2.5. Statistical Analysis
3. Results
3.1. Clinical and Metabolic Variables
3.2. Effect of Sex and Obesity on P4-ATPase Gene Expression Levels in VAT
Relationships between VAT P4-ATPase Genes and Clinical Variables
3.3. Potential P4-ATPase-Modulator miRs in VAT
- -
- Model 1: dependent variable: the expression of ATP8A1; independent variables: miR-548b-5p and miR-4643. The regression model (R2 = 0.263, F = 3.9, p = 0.035) suggested that 26% of the variation in the expression of ATP8A1 may be explained by a negative effect of miR-548b-5p (ß = −0.615, p = 0.034) and a positive effect of miR-4643 (ß = 0.761, p = 0.011).
- -
- Model 2: dependent variable: the expression of ATP8B1; independent variables: miR-548b-5p and miR-4643 as independent variables. The regression model with ATP8B1 (R2 = 0.179, F = 2.3, p = 0.127) showed a negative effect of miR-548b-5p (ß = −0.563, p = 0.071) and a positive effect of miR-4643 (ß = 0.611, p = 0.051) in the expression of ATP8B1, although not reaching statistical significance.
- -
- Model 3: dependent variable: the expression of ATP8A1; independent variables: obesity, sex, and the gene expression of miR-548b-5p and miR-4643. The regression model (R2 = 0.263, F = 3.9, p = 0.035) still suggested that 26% of the variation in the expression of ATP8A1 could be explained by a negative effect of miR-548b-5p (ß = −0.615, p = 0.034) and a positive effect of miR-4643 (ß = 0.761, p = 0.011).
- -
- Model 4: dependent variable: the expression of ATP8B1; independent variables: waist, sex, and the gene expression of miR-548b-5p and miR-4643. Overall, 45% of the variation in the expression of ATP8B1 (R2 = 0.451, F = 17.3, p < 0.0001) could be explained by a positive effect of waist circumference (ß = 0.672, p < 0.001).
Functional Significance of miRs
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Upadhyay, J.; Farr, O.; Perakakis, N.; Ghaly, W.; Mantzoros, C. Obesity as a Disease. Med. Clin. N. Am. 2018, 102, 13–33. [Google Scholar] [CrossRef]
- Ng, M.; Fleming, T.; Robinson, M.; Thomson, B.; Graetz, N.; Margono, C.; Mullany, E.C.; Biryukov, S.; Abbafati, C.; Abera, S.F.; et al. Global, regional, and national prevalence of overweight and obesity in children and adults during 1980-2013: A systematic analysis for the Global Burden of Disease Study 2013. Lancet 2014, 384, 766–781. [Google Scholar] [CrossRef]
- Luque-Ramírez, M.; Martínez-García, M.; Montes-Nieto, R.; Fernández-Durán, E.; Insenser, M.; Alpañés, M.; Escobar-Morreale, H.F. Sexual dimorphism in adipose tissue function as evidenced by circulating adipokine concentrations in the fasting state and after an oral glucose challenge. Hum. Reprod. 2013, 28, 1908–1918. [Google Scholar] [CrossRef] [PubMed]
- Dearden, L.; Bouret, S.G.; Ozanne, S.E. Sex and gender differences in developmental programming of metabolism. Mol. Metab. 2018, 15, 8–19. [Google Scholar] [CrossRef] [PubMed]
- Matsuzawa-Nagata, N.; Takamura, T.; Ando, H.; Nakamura, S.; Kurita, S.; Misu, H.; Ota, T.; Yokoyama, M.; Honda, M.; Miyamoto, K.; et al. Increased oxidative stress precedes the onset of high-fat diet-induced insulin resistance and obesity. Metabolism 2008, 57, 1071–1077. [Google Scholar] [CrossRef]
- Ibrahim, M.M. Subcutaneous and visceral adipose tissue: Structural and functional differences. Obes. Rev. 2010, 11, 11–18. [Google Scholar] [CrossRef]
- Stefan, N. Causes, consequences, and treatment of metabolically unhealthy fat distribution. Lancet Diabetes Endocrinol. 2020, 8, 616–627. [Google Scholar] [CrossRef]
- Sun, K.; Kusminski, C.M.; Scherer, P.E. Adipose tissue remodeling and obesity. J. Clin. Investig. 2011, 121, 2094–2101. [Google Scholar] [CrossRef]
- Pietiläinen, K.H.; Róg, T.; Seppänen-Laakso, T.; Virtue, S.; Gopalacharyulu, P.; Tang, J.; Rodriguez-Cuenca, S.; Maciejewski, A.; Naukkarinen, J.; Ruskeepää, A.L.; et al. Association of lipidome remodeling in the adipocyte membrane with acquired obesity in humans. PLoS Biol. 2011, 9, e1000623. [Google Scholar] [CrossRef]
- Desai, A.J.; Miller, L.J. Changes in the plasma membrane in metabolic disease: Impact of the membrane environment on G protein-coupled receptor structure and function. Br. J. Pharmacol. 2018, 175, 4009–4025. [Google Scholar] [CrossRef]
- Pomorski, T.; Menon, A.K. Lipid flippases and their biological functions. Cell. Mol. Life Sci. 2006, 63, 2908–2921. [Google Scholar] [CrossRef] [PubMed]
- Bai, L.; Jain, B.K.; You, Q.; Duan, H.D.; Takar, M.; Graham, T.R.; Li, H. Structural basis of the P4B ATPase lipid flippase activity. Nat. Commun. 2021, 12, 5963. [Google Scholar] [CrossRef] [PubMed]
- Folmer, D.E.; Elferink, R.P.; Paulusma, C.C. P4 ATPases—Lipid flippases and their role in disease. Biochim. Biophys. Acta 2009, 1791, 628–635. [Google Scholar] [CrossRef] [PubMed]
- Westermann-Clark, E.; Soundararajan, R.; Fukumoto, J.; Patil, S.S.; Stearns, T.M.; Saji, S.; Czachor, A.; Hernandez-Cuervo, H.; Breitzig, M.; Krishnamurthy, S.; et al. Matrix Metalloproteinase 7 Expression and Apical Epithelial Defects in Atp8b1 Mutant Mouse Model of Pulmonary Fibrosis. Biomolecules 2022, 12, 293. [Google Scholar] [CrossRef] [PubMed]
- Zhang, X.; Zhang, R.; Liu, P.; Ning, J.; Ye, Y.; Yu, W.; Yu, J. ATP8B1 Knockdown Activated the Choline Metabolism Pathway and Induced High-Level Intracellular REDOX Homeostasis in Lung Squamous Cell Carcinoma. Cancers 2022, 14, 835. [Google Scholar] [CrossRef]
- Li, L.; Deheragoda, M.; Lu, Y.; Gong, J.; Wang, J. Hypothyroidism Associated with ATP8B1 Deficiency. J. Pediatr. 2015, 167, 1334–1339.e1. [Google Scholar] [CrossRef]
- Pawlikowska, L.; Strautnieks, S.; Jankowska, I.; Czubkowski, P.; Emerick, K.; Antoniou, A.; Wanty, C.; Fischler, B.; Jacquemin, E.; Wali, S.; et al. Differences in presentation and progression between severe FIC1 and BSEP deficiencies. J. Hepatol. 2010, 53, 170–178. [Google Scholar] [CrossRef]
- Felzen, A.; Verkade, H.J. The spectrum of Progressive Familial Intrahepatic Cholestasis diseases: Update on pathophysiology and emerging treatments. Eur. J. Med. Genet. 2021, 64, 104317. [Google Scholar] [CrossRef]
- Yap, Y.T.; Li, Y.H.; Li, W.; Banerjee, P.; Zhang, Z. ATP8a1, an IFT27 binding partner, is dispensable for spermatogenesis and male fertility. Mol. Reprod. Dev. 2021, 88, 371–375. [Google Scholar] [CrossRef]
- Li, D.; Xu, T.; Wang, X.; Ma, X.; Liu, T.; Wang, Y.; Jiang, S. The role of ATP8A1 in non-small cell lung cancer. Int. J. Clin. Exp. Pathol. 2017, 10, 7760–7766. [Google Scholar]
- Pan, R.; Chen, Y. Fat biology and metabolic balance: On the significance of sex. Mol. Cell. Endocrinol. 2021, 533, 111336. [Google Scholar] [CrossRef] [PubMed]
- Landrier, J.F.; Derghal, A.; Mounien, L. MicroRNAs in Obesity and Related Metabolic Disorders. Cells 2019, 8, 859. [Google Scholar] [CrossRef] [PubMed]
- Murri, M.; El Azzouzi, H. MicroRNAs as regulators of mitochondrial dysfunction and obesity. Am. J. Physiol. Heart Circ. Physiol. 2018, 315, H291–H302. [Google Scholar] [CrossRef] [PubMed]
- Mi, H.; Muruganujan, A.; Huang, X.; Ebert, D.; Mills, C.; Guo, X.; Thomas, P.D. Protocol Update for large-scale genome and gene function analysis with the PANTHER classification system (v.14.0). Nat. Protoc. 2019, 14, 703–721. [Google Scholar] [CrossRef]
- Shin, H.W.; Takatsu, H. Substrates of P4-ATPases: Beyond aminophospholipids (phosphatidylserine and phosphatidylethanolamine). FASEB J. 2019, 33, 3087–3096. [Google Scholar] [CrossRef]
- Soupene, E.; Kemaladewi, D.U.; Kuypers, F.A. ATP8A1 activity and phosphatidylserine transbilayer movement. J. Recept. Ligand Channel Res. 2008, 1, 1–10. [Google Scholar] [CrossRef]
- Paterson, J.K.; Renkema, K.; Burden, L.; Halleck, M.S.; Schlegel, R.A.; Williamson, P.; Daleke, D.L. Lipid specific activation of the murine P4-ATPase Atp8a1 (ATPase II). Biochemistry 2006, 45, 5367–5376. [Google Scholar] [CrossRef]
- Takatsu, H.; Tanaka, G.; Segawa, K.; Suzuki, J.; Nagata, S.; Nakayama, K.; Shin, H.W. Phospholipid flippase activities and substrate specificities of human type IV P-type ATPases localized to the plasma membrane. J. Biol. Chem. 2014, 289, 33543–33556. [Google Scholar] [CrossRef]
- Paulusma, C.C.; Folmer, D.E.; Ho-Mok, K.S.; de Waart, D.R.; Hilarius, P.M.; Verhoeven, A.J.; Oude Elferink, R.P. ATP8B1 requires an accessory protein for endoplasmic reticulum exit and plasma membrane lipid flippase activity. Hepatology 2008, 47, 268–278. [Google Scholar] [CrossRef]
- Daleke, D.L. Regulation of transbilayer plasma membrane phospholipid asymmetry. J. Lipid Res. 2003, 44, 233–242. [Google Scholar] [CrossRef]
- Ortiz-Huidobro, R.I.; Velasco, M.; Larqué, C.; Escalona, R.; Hiriart, M. Molecular Insulin Actions Are Sexually Dimorphic in Lipid Metabolism. Front. Endocrinol. 2021, 12, 690484. [Google Scholar] [CrossRef] [PubMed]
- Cornier, M.A.; Després, J.P.; Davis, N.; Grossniklaus, D.A.; Klein, S.; Lamarche, B.; Lopez-Jimenez, F.; Rao, G.; St-Onge, M.P.; Towfighi, A.; et al. Assessing adiposity: A scientific statement from the American Heart Association. Circulation 2011, 124, 1996–2019. [Google Scholar] [CrossRef] [PubMed]
- Alatibi, K.I.; Wehbe, Z.; Spiekerkoetter, U.; Tucci, S. Sex-specific perturbation of complex lipids in response to medium-chain fatty acids in very long-chain acyl-CoA dehydrogenase deficiency. FEBS J. 2020, 287, 3511–3525. [Google Scholar] [CrossRef] [PubMed]
- Long, S.D.; Pekala, P.H. Lipid mediators of insulin resistance: Ceramide signalling down-regulates GLUT4 gene transcription in 3T3-L1 adipocytes. Biochem. J. 1996, 319 Pt 1, 179–184. [Google Scholar] [CrossRef]
- Tramunt, B.; Smati, S.; Grandgeorge, N.; Lenfant, F.; Arnal, J.F.; Montagner, A.; Gourdy, P. Sex differences in metabolic regulation and diabetes susceptibility. Diabetologia 2020, 63, 453–461. [Google Scholar] [CrossRef]
- Vasudevan, S.; Tong, Y.; Steitz, J.A. Switching from repression to activation: MicroRNAs can up-regulate translation. Science 2007, 318, 1931–1934. [Google Scholar] [CrossRef]
- Tan, H.; Huang, S.; Zhang, Z.; Qian, X.; Sun, P.; Zhou, X. Pan-cancer analysis on microRNA-associated gene activation. EBioMedicine 2019, 43, 82–97. [Google Scholar] [CrossRef]
- Nunez-Iglesias, J.; Liu, C.C.; Morgan, T.E.; Finch, C.E.; Zhou, X.J. Joint genome-wide profiling of miRNA and mRNA expression in Alzheimer’s disease cortex reveals altered miRNA regulation. PLoS ONE 2010, 5, e8898. [Google Scholar] [CrossRef]
- Murri, M.; Insenser, M.; Fernandez-Duran, E.; San-Millan, J.L.; Luque-Ramirez, M.; Escobar-Morreale, H.F. Non-targeted profiling of circulating microRNAs in women with polycystic ovary syndrome (PCOS): Effects of obesity and sex hormones. Metab.-Clin. Exp. 2018, 86, 49–60. [Google Scholar] [CrossRef]
- Karastergiou, K.; Smith, S.R.; Greenberg, A.S.; Fried, S.K. Sex differences in human adipose tissues—The biology of pear shape. Biol. Sex Differ. 2012, 3, 13. [Google Scholar] [CrossRef]
- Moreira-Pais, A.; Ferreira, R.; Neves, J.S.; Vitorino, R.; Moreira-Gonçalves, D.; Nogueira-Ferreira, R. Sex differences on adipose tissue remodeling: From molecular mechanisms to therapeutic interventions. J. Mol. Med. 2020, 98, 483–493. [Google Scholar] [CrossRef] [PubMed]
- Wawrzkiewicz-Jałowiecka, A.; Lalik, A.; Soveral, G. Recent Update on the Molecular Mechanisms of Gonadal Steroids Action in Adipose Tissue. Int. J. Mol. Sci. 2021, 22, 5226. [Google Scholar] [CrossRef] [PubMed]
- Anderson, W.D.; Soh, J.Y.; Innis, S.E.; Dimanche, A.; Ma, L.; Langefeld, C.D.; Comeau, M.E.; Das, S.K.; Schadt, E.E.; Björkegren, J.L.M.; et al. Sex differences in human adipose tissue gene expression and genetic regulation involve adipogenesis. Genome Res. 2020, 30, 1379–1392. [Google Scholar] [CrossRef] [PubMed]
Women | Men | P Gender Effect | P Obesity Effect | P Interaction Effect | |||
---|---|---|---|---|---|---|---|
NW | Obese | NW | Obese | ||||
N | 5 | 7 | 7 | 6 | |||
Age (years) | 43 (27–45) | 43 (39–45) | 47 (40–57) | 42 (34–57) | 0.144 | 0.943 | 0.245 |
BMI (kg/m2) | 21 ± 2 | 48 ± 7 | 22 ± 1 | 49 ± 4 | 0.312 | <0.001 | 0.690 |
Waist (cm) | 73 ± 3 | 123 ± 11 | 80 ± 3 | 147 ± 9 | <0.001 | <0.001 | 0.017 |
Hip (cm) | 93 ± 9 | 142 ± 13 | 92 ± 5 | 147 ± 9 | 0.689 | <0.001 | 0.534 |
Waist to Hip ratio | 0.8 ± 0.1 | 0.9 ± 0.1 | 0.9 ± 0.1 | 1.0 ± 0.1 | <0.001 | 0.001 | 0.290 |
SBP (mmHg) | 108 ± 28 | 136 ± 10 | 121 ± 12 | 146 ± 16 | 0.121 | 0.001 | 0.852 |
DBP (mmHg) | 84 ± 24 | 85 ± 8 | 75 ± 6 | 85 ± 9 | 0.447 | 0.282 | 0.378 |
Cholesterol (mmol/L) | 5.1 ± 1.2 | 4.8 ± 0.8 | 5.5 ± 1.0 | 4.7 ± 0.5 | 0.728 | 0.142 | 0.517 |
HDL-chol (mmol/L) | 1.8 ± 0.3 | 1.4 ± 0.1 | 1.7 ± 0.3 | 1.4 ± 0.2 | 0.577 | 0.001 | 0.625 |
LDL-chol (mmol/L) | 2.7± 0.6 | 2.6 ± 0.6 | 3.2 ± 0.8 | 2.8 ± 0.4 | 0.252 | 0.435 | 0.525 |
Triglyceride (mmol/L) | 0.8 ± 0.2 | 1.0 ± 0.3 | 0.9 ± 0.2 | 1.1 ± 0.2 | 0.229 | 0.080 | 0.591 |
Glucose (mmol/L) | 4.9 ± 0.2 | 5.0 ± 0.4 | 4.9 ± 0.3 | 5.1 ± 0.3 | 0.813 | 0.403 | 0.632 |
Insulin (µUI/mL) | 5 ± 1 | 15 ± 12 | 6 ± 3 | 29 ± 13 | 0.068 | <0.001 | 0.144 |
HOMA-IR | 1.1 ± 0.2 | 3.4 ± 2.9 | 1.3 ± 0.6 | 6.6 ± 3.0 | 0.071 | <0.001 | 0.147 |
GOT (IU/L) | 16 ± 3 | 17 ± 4 | 21 ± 7 | 30 ± 6 | 0.001 | 0.047 | 0.086 |
GPT (IU/L) | 31 ± 5 | 32 ± 8 | 35 ± 14 | 52 ± 20 | 0.036 | 0.098 | 0.158 |
GGT (IU/L) | 27 ± 12 | 18 ± 9 | 25 ± 10 | 50 ± 12 | 0.002 | 0.079 | 0.001 |
ALP (IU/L) | 53 ± 12 | 67 ± 13 | 61 ± 22 | 66 ± 19 | 0.625 | 0.252 | 0.593 |
Urea (μmol/L) | 3.7 ± 0.3 | 4.8 ± 1.0 | 6.0 ± 1.0 | 4.8 ± 1.0 | 0.037 | 0.978 | 0.019 |
Creatinine (μmol/L) | 62 ± 18 | 62 ± 9 | 80 ± 18 | 80 ± 9 | 0.006 | 0.650 | 0.424 |
Uric acid (μmol/L) | 184 ± 30 | 309 ± 36 | 250 ± 59 | 339 ± 65 | 0.031 | <0.001 | 0.368 |
Iron (μmol/L) | 13 ± 7 | 11 ± 5 | 21 ± 4 | 14 ± 6 | 0.054 | 0.124 | 0.334 |
Transferrin (μmol/L) | 37 ± 4 | 35 ± 4 | 30 ± 2 | 32 ± 3 | 0.004 | 0.954 | 0.188 |
Ferritin (μg/L) | 23 ± 21 | 18 ± 11 | 172 ± 76 | 154 ± 116 | <0.001 | 0.711 | 0.840 |
Albumin (g/L) | 39 ± 1 | 38 ± 2 | 42 ± 2 | 40 ± 4 | 0.084 | 0.235 | 0.451 |
hs-CRP (mg/L) | 2.4 ± 1.3 | 8.8 ± 11.7 | 2.4 ± 0.9 | 5.8 ± 5.8 | 0.638 | 0.128 | 0.623 |
Genes/miRs | Forward Primer | Reverse Primer |
---|---|---|
L7 | TTGACGAAGGCGAAGAAGCT | ACCTGCAGAACCCAAATTGG |
ATP8A1 | TTCAGGAGTGGCGAGCAGTCTA | CCTCAATGGCTGTTGCTCCAAG |
ATP8B1 | GCCAAAGTTCCTGGCAGCGTTT | CTTCTTGCTCGCAGTTTGCCAC |
RNU6 | ACACGCAAATTCGTGAAGCGTTG | GAATCGAGCACCAGTTACG |
miR-548b-5p | AAAAGTAATTGTGGTTTTGGCC | GAATCGAGCACCAGTTACG |
miR-4643 | GACACATGACCATAAATGCTAA | GAATCGAGCACCAGTTACG |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Motahari-Rad, H.; Subiri, A.; Soler, R.; Ocaña, L.; Alcaide, J.; Rodríguez-Capitan, J.; Buil, V.; Azzouzi, H.e.; Ortega-Gomez, A.; Bernal-Lopez, R.; et al. The Effect of Sex and Obesity on the Gene Expression of Lipid Flippases in Adipose Tissue. J. Clin. Med. 2022, 11, 3878. https://doi.org/10.3390/jcm11133878
Motahari-Rad H, Subiri A, Soler R, Ocaña L, Alcaide J, Rodríguez-Capitan J, Buil V, Azzouzi He, Ortega-Gomez A, Bernal-Lopez R, et al. The Effect of Sex and Obesity on the Gene Expression of Lipid Flippases in Adipose Tissue. Journal of Clinical Medicine. 2022; 11(13):3878. https://doi.org/10.3390/jcm11133878
Chicago/Turabian StyleMotahari-Rad, Hanieh, Alba Subiri, Rocio Soler, Luis Ocaña, Juan Alcaide, Jorge Rodríguez-Capitan, Veronica Buil, Hamid el Azzouzi, Almudena Ortega-Gomez, Rosa Bernal-Lopez, and et al. 2022. "The Effect of Sex and Obesity on the Gene Expression of Lipid Flippases in Adipose Tissue" Journal of Clinical Medicine 11, no. 13: 3878. https://doi.org/10.3390/jcm11133878
APA StyleMotahari-Rad, H., Subiri, A., Soler, R., Ocaña, L., Alcaide, J., Rodríguez-Capitan, J., Buil, V., Azzouzi, H. e., Ortega-Gomez, A., Bernal-Lopez, R., Insenser, M., Tinahones, F. J., & Murri, M. (2022). The Effect of Sex and Obesity on the Gene Expression of Lipid Flippases in Adipose Tissue. Journal of Clinical Medicine, 11(13), 3878. https://doi.org/10.3390/jcm11133878