In Vitro Characterization of the Innate Immune Pathways Engaged by Live and Inactivated Tick-Borne Encephalitis Virus
Abstract
1. Introduction
2. Materials and Methods
2.1. Vaccine and Virus
2.2. Cells
2.3. Cell Stimulation
2.4. Cell Lysis and RNA Isolation
2.5. RT-qPCR
2.6. RNA Sequencing
2.7. Quantification of Cytokines and Chemokines
2.8. Statistical Analysis
3. Results
3.1. RNA-Seq Identifies an I-TBEV-Specific IFN-Dominated Signature in Human PBMCs
3.2. PBMCs Treated with Live and Inactivated TBEV Share Similar Transcriptional Profiles
3.3. Inhibition of RLRs, But Not of TLRs, Reduces I-TBEV-Induced Responses
3.4. TLR and NOD Reporter Cells Do Not Respond to I-TBEV, But Can Be Activated by Live TBEV
4. Discussion
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
Disclaimer
Appendix A
| Gene | Forward | Reverse | Source |
|---|---|---|---|
| IL12-p40 | CTGCCCAGAGCAAGATGTGTC | CATTTCTCCAGGGGCATCCG | Own design |
| ISG56 | CCTGGAGTACTATGAGCGGGC | TGGGTGCCTAAGGACCTTGTC | Holzinger et al., JVirol (2007) |
| CCL-8 | GTTTCTGCAGCGCTTCTGTG | TGGCTGAGCAAGTCCCTGA | Ma et al., Exp Terap Med (2016) |
| CXCL-10 | TGAAATTATTCCTGCAAGCCAA | CAGACATCTCTTCTCACCCTTCTTT | Ma et al., Exp Terap Med (2016) |
| STAT1 | TGCAAATGCTGTATTCTTCTTTGG | TATGCAGTGCCACGGAAAGC | Zhang et al., Immunol (2009) |
| IL4I1 | GCTGAAGAAAGAAGAAACCCACC | CCTAACTGCCACAGAAGGGA | Own design |
| CHI3L1 | TGCCCTTGACCGCTCCTCTGTACC | GAGCGTCACATCATTCCACTC | Erdman et al., MalariaJ (2014) |
| JAK2 | TTCAGAAGCAGGCAACAGG | TCTGTCATCGTAAGGCAGGC | Warby et al., J Virol (2003) |
| APOC1 | TTCTGTCGATCGTCTTGGAA | TCAGCTTATCCAAGGCACTG | Ko et al., ThoracicCan (2014) |
| CYBB | TAGTGGGTCCCATGTTTCTGTATC | ACATCACCACCTCATAGCTGAA | Okura et al., J Clin Immunol (2015) |
| EIF4B | GGCTGATGAAACGGATGACCT | GGTCGATATTGGGTTCCCGA | Nowak et al., EBioMedicine (2019) |
| GBP4 | CCGGCCTACAAATGACAAGC | AGCCGCTTTCCAGTGACAAT | Own design |
| COL4A2-AS2 | CTCTCAGGTCATGCCCATCC | CTGAGTCCTGTGCACGTCTT | Own design |
| GPNMB | TGCTGACTGTGAGACGAACC | CACCAAGAGGGAGATCACAGT | Own design |
| BASP1 | CAACTGGCTCCTCGCTCC | TGAGCTTGCCTCCCATCTTG | Own design |
| GAPDH | AGGGCTGCTTTTAACTCTGGT | CCCCACTTGATTTTGGAGGGA | Abubaker et al., PLOS One (2013) |










References
- Riccardi, N.; Antonello, R.M.; Luzzati, R.; Zajkowska, J.; Di Bella, S.; Giacobbe, D.R. Tick-borne encephalitis in Europe: A brief update on epidemiology, diagnosis, prevention, and treatment. Eur. J. Intern. Med. 2019, 62, 1–6. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Süss, J. Tick-borne encephalitis 2010: Epidemiology, risk areas, and virus strains in Europe and Asia—An overview. Ticks Tick. Borne. Dis. 2011, 2, 2–15. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kunze, U. The International Scientific Working Group on Tick-Borne Encephalitis (ISW TBE): Review of 17 years of activity and commitment. Ticks Tick Borne Dis. 2016, 7, 399–404. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Chernokhaeva, L.L.; Rogova, Y.V.; Kozlovskaya, L.I.; Romanova, L.I.; Osolodkin, D.I.; Vorovitch, M.F.; Karganova, G.G. Experimental Evaluation of the Protective Efficacy of Tick-Borne Encephalitis (TBE) Vaccines Based on European and Far-Eastern TBEV Strains in Mice and in Vitro. Front. Microbiol. 2018, 9, 1487. [Google Scholar] [CrossRef] [Scilit]
- Amicizia, D.; Domnich, A.; Panatto, D.; Lai, P.L.; Cristina, M.L.; Avio, U.; Gasparini, R. Epidemiology of tick-borne encephalitis (TBE) in Europe and its prevention by available vaccines. Hum. Vaccines Immunother. 2013, 9, 1163–1171. [Google Scholar] [CrossRef] [Scilit]
- Holzmann, H.; Karganova, G.; Barrett, A.; Süss, J.; Pervikov, Y.; Bjorvatn, B.; Duclos, P.; Hombach, J. Background Document on Vaccines and Vaccination against Tick-Borne Encephalitis (TBE)*. Available online: https://www.who.int/immunization/sage/6_TBE_backgr_18_Mar_net_apr_2011.pdf (accessed on 17 June 2021).
- Aberle, J.H.; Schwaiger, J.; Aberle, S.W.; Stiasny, K.; Scheinost, O.; Kundi, M.; Chmelik, V.; Heinz, F.X.; Heinz, F.; Stiasny, K.; et al. Human CD4+ T Helper Cell Responses after Tick-Borne Encephalitis Vaccination and Infection. PLoS ONE 2015, 10, e0140545. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kubinski, M.; Beicht, J.; Gerlach, T.; Volz, A.; Sutter, G.; Rimmelzwaan, G.F. Tick-Borne Encephalitis Virus: A Quest for Better Vaccines against a Virus on the Rise. Vaccines 2020, 8, 451. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Walther, M.; Woodruff, J.; Edele, F.; Jeffries, D.; Tongren, J.E.; King, E.; Andrews, L.; Bejon, P.; Gilbert, S.C.; De Souza, J.B.; et al. Innate Immune Responses to Human Malaria: Heterogeneous Cytokine Responses to Blood-Stage Plasmodium falciparum Correlate with Parasitological and Clinical Outcomes. J. Immunol. 2006, 177, 5736–5745. [Google Scholar] [CrossRef] [Scilit]
- Rechtien, A.; Richert, L.; Lorenzo, H.; Martrus, G.; Hejblum, B.; Dahlke, C.; Kasonta, R.; Zinser, M.; Stubbe, H.; Matschl, U.; et al. Systems Vaccinology Identifies an Early Innate Immune Signature as a Correlate of Antibody Responses to the Ebola Vaccine rVSV-ZEBOV. Cell Rep. 2017, 20, 2251–2261. [Google Scholar] [CrossRef] [Scilit]
- Querec, T.D.; Akondy, R.S.; Lee, E.K.; Cao, W.; Nakaya, H.I.; Teuwen, D.; Pirani, A.; Gernert, K.; Deng, J.; Marzolf, B.; et al. Systems biology approach predicts immunogenicity of the yellow fever vaccine in humans. Nat. Immunol. 2009, 10, 116–125. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Andersen-Nissen, E.; Fiore-Gartland, A.; Fleming, L.B.; Carppi, L.N.; Naidoo, A.F.; Harper, M.S.; Voillet, V.; Grunenberg, N.; Laher, F.; Innes, C.; et al. Innate immune signatures to a partiallyefficacious HIV vaccine predict correlates of HIV-1 infection risk. PLoS Pathog. 2021, 17, e1009363. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Heinz, F.X.; Holzmann, H.; Essl, A.; Kundi, M. Field effectiveness of vaccination against tick-borne encephalitis. Vaccine 2007, 25, 7559–7567. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Koyama, S.; Ishii, K.J.; Kumar, H.; Tanimoto, T.; Coban, C.; Uematsu, S.; Kawai, T.; Akira, S. Differential Role of TLR- and RLR-Signaling in the Immune Responses to Influenza A Virus Infection and Vaccination. J. Immunol. 2007, 179, 4711–4720. [Google Scholar] [CrossRef] [Scilit]
- Geeraedts, F.; Goutagny, N.; Hornung, V.; Severa, M.; De Haan, A.; Pool, J.; Wilschut, J.; Fitzgerald, K.A.; Huckriede, A. Superior immunogenicity of inactivated whole virus h5n1 influenza vaccine is primarily controlled by toll-like receptor signalling. PLoS Pathog. 2008, 4, e1000138. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ichinohe, T. Respective roles of TLR, RIG-I and NLRP3 in influenza virus infection and immunity: Impact on vaccine design. Expert Rev. Vaccines 2010, 9, 1315–1324. [Google Scholar] [CrossRef] [Scilit]
- Signorazzi, A.; Etna, M.P.; Coccia, E.M.; Huckriede, A. In vitro assessment of tick-borne encephalitis vaccine: Suitable human cell platforms and potential biomarkers. ALTEX-Altern. Anim. Exp. 2021. [Google Scholar] [CrossRef]
- Akkermans, A.; Chapsal, J.M.; Coccia, E.M.; Depraetere, H.; Dierick, J.F.; Duangkhae, P.; Goel, S.; Halder, M.; Hendriksen, C.; Levis, R.; et al. Animal testing for vaccines. Implementing replacement, reduction and refinement: Challenges and priorities. Biologicals 2020, 68, 92–107. [Google Scholar] [CrossRef] [Scilit]
- Orlinger, K.K.; Hofmeister, Y.; Fritz, R.; Holzer, G.W.; Falkner, F.G.; Unger, B.; Loew-Baselli, A.; Poellabauer, E.-M.; Ehrlich, H.J.; Noel Barrett, P.; et al. A Tick-borne Encephalitis Virus Vaccine Based on the European Prototype Strain Induces Broadly Reactive Cross-neutralizing Antibodies in Humans. J. Infect. Dis. 2011, 203, 1556–1564. [Google Scholar] [CrossRef] [Scilit]
- RIVM. Tick-Borne Encephalitis (TBE). Available online: https://www.rivm.nl/tekenencefalitis (accessed on 1 December 2020).
- Tapia-Calle, G.; Stoel, M.; de Vries-Idema, J.; Huckriede, A. Distinctive Responses in an In Vitro Human Dendritic Cell-Based System upon Stimulation with Different Influenza Vaccine Formulations. Vaccines 2017, 5, 21. [Google Scholar] [CrossRef] [Scilit]
- Schmittgen, T.D.; Livak, K.J. Analyzing real-time PCR data by the comparative CT method. Nat. Protoc. 2008, 3, 1101–1108. [Google Scholar] [CrossRef] [Scilit]
- Huang, D.W.; Sherman, B.T.; Lempicki, R.A. Systematic and integrative analysis of large gene lists using DAVID bioinformatics resources. Nat. Protoc. 2009, 4, 44–57. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Bindea, G.; Mlecnik, B.; Hackl, H.; Charoentong, P.; Tosolini, M.; Kirilovsky, A.; Fridman, W.H.; Pagès, F.; Trajanoski, Z.; Galon, J. ClueGO: A Cytoscape plug-in to decipher functionally grouped gene ontology and pathway annotation networks. Bioinformatics 2009, 25, 1091–1093. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Shannon, P.; Markiel, A.; Ozier, O.; Baliga, N.S.; Wang, J.T.; Ramage, D.; Amin, N.; Schwikowski, B.; Ideker, T. Cytoscape: A software Environment for integrated models of biomolecular interaction networks. Genome Res. 2003, 13, 2498–2504. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Fabregat, A.; Sidiropoulos, K.; Viteri, G.; Forner, O.; Marin-Garcia, P.; Arnau, V.; D’Eustachio, P.; Stein, L.; Hermjakob, H. Reactome pathway analysis: A high-performance in-memory approach. BMC Bioinform. 2017, 18, 142. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Dörrbecker, B.; Dobler, G.; Spiegel, M.; Hufert, F.T. Tick-borne encephalitis virus and the immune response of the mammalian host. Travel Med. Infect. Dis. 2010, 8, 213–222. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Miorin, L.; Albornoz, A.; Baba, M.M.; D’Agaro, P.; Marcello, A. Formation of membrane-defined compartments by tick-borne encephalitis virus contributes to the early delay in interferon signaling. Virus Res. 2012, 163, 660–666. [Google Scholar] [CrossRef] [Scilit]
- Miorin, L.; Romero-Brey, I.; Maiuri, P.; Hoppe, S.; Krijnse-Locker, J.; Bartenschlager, R.; Marcello, A. Three-Dimensional Architecture of Tick-Borne Encephalitis Virus Replication Sites and Trafficking of the Replicated RNA. J. Virol. 2013, 87, 6469–6481. [Google Scholar] [CrossRef] [Scilit]
- Niederberger, E.; Moser, C.; Kynast, K.; Geisslinger, G. The non-canonical IκB kinases IKKε and TBK1 as potential targets for the development of novel therapeutic drugs. Curr. Mol. Med. 2013, 13, 1089–1097. [Google Scholar] [CrossRef] [Scilit]
- Feldman, R.I.; Wu, J.M.; Polokoff, M.A.; Kochanny, M.J.; Dinter, H.; Zhu, D.; Biroc, S.L.; Alicke, B.; Bryant, J.; Yuan, S.; et al. Novel small molecule inhibitors of 3-phosphoinositide-dependent kinase-1. J. Biol. Chem. 2005, 280, 19867–19874. [Google Scholar] [CrossRef] [Scilit]
- Pham, A.M.; TenOever, B.R. The IKK kinases: Operators of ativiral signaling. Viruses 2010, 2, 55–72. [Google Scholar] [CrossRef] [Scilit]
- Etna, M.P.; Signorazzi, A.; Ricci, D.; Severa, M.; Rizzo, F.; Giacomini, E.; Gaggioli, A.; Bekeredjian-Ding, I.; Huckriede, A.; Coccia, E.M. Human plasmacytoid dendritic cells at the crossroad of type I interferon-regulated B cell differentiation and antiviral response to tick-borne encephalitis virus. PLoS Pathog. 2021, 17, e1009505. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Loiarro, M.; Sette, C.; Gallo, G.; Ciacci, A.; Fantó, N.; Mastroianni, D.; Carminati, P.; Ruggiero, V. Peptide-mediated interference of TIR domain dimerization in MyD88 inhibits interleukin-1-dependent activation of NF-κB. J. Biol. Chem. 2005, 280, 15809–15814. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Heil, F.; Hemmi, H.; Hochrein, H.; Ampenberger, F.; Kirschning, C.; Akira, S.; Lipford, G.; Wagner, H.; Bauer, S. Species-Specific Recognition of Single-Stranded RNA via Till-like Receptor 7 and 8. Science 2004, 303, 1526–1529. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Duffy, D.; Rouilly, V.; Libri, V.; Hasan, M.; Beitz, B.; David, M.; Urrutia, A.; Bisiaux, A.; LaBrie, S.T.; Dubois, A.; et al. Functional analysis via standardized whole-blood stimulation systems defines the boundaries of a healthy immune response to complex stimuli. Immunity 2014, 40, 436–450. [Google Scholar] [CrossRef] [Scilit]
- Biffen, M.; Matsui, H.; Edwards, S.; Leishman, A.; Eiho, K.; Holness, E.; Satterthwaite, G.; Doyle, I.; Wada, H.; Fraser, N.; et al. Biological characterization of a novel class of toll-like receptor 7 agonists designed to have reduced systemic activity. Br. J. Pharmacol. 2012, 166, 573–586. [Google Scholar] [CrossRef] [Scilit]
- Zhang, J.; Shao, J.; Wu, X.; Mao, Q.; Wang, Y.; Gao, F.; Kong, W.; Liang, Z. Type I interferon related genes are common genes on the early stage after vaccination by meta-analysis of microarray data. Hum. Vaccin. Immunother. 2015, 11, 739. [Google Scholar] [CrossRef] [Scilit]
- Stoel, M.; Pool, J.; de Vries-Idema, J.; Zaaraoui-Boutahar, F.; Bijl, M.; Andeweg, A.C.; Wilschut, J.; Huckriede, A. Innate responses induced by whole inactivated virus or subunit influenza vaccines in cultured dendritic cells correlate with immune responses in vivo. PLoS ONE 2015, 10, e0125228. [Google Scholar] [CrossRef] [Scilit]
- Geeraedts, F.; Bungener, L.; Pool, J.; ter Veer, W.; Wilschut, J.; Huckriede, A. Whole inactivated virus influenza vaccine is superior to subunit vaccine in inducing immune responses and secretion of proinflammatory cytokines by DCs. Influenza Other Respi. Viruses 2008, 2, 41–51. [Google Scholar] [CrossRef] [Scilit]
- Nakaya, H.I.; Wrammert, J.; Lee, E.K.; Racioppi, L.; Marie-Kunze, S.; Haining, W.N.; Means, A.R.; Kasturi, S.P.; Khan, N.; Li, G.M.; et al. Systems biology of vaccination for seasonal influenza in humans. Nat. Immunol. 2011, 12, 786–795. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Obermoser, G.; Presnell, S.; Domico, K.; Xu, H.; Wang, Y.; Anguiano, E.; Thompson-Snipes, L.A.; Ranganathan, R.; Zeitner, B.; Bjork, A.; et al. Systems scale interactive exploration reveals quantitative and qualitative differences in response to influenza and pneumococcal vaccines. Immunity 2013, 38, 831–844. [Google Scholar] [CrossRef] [Scilit]
- Gaucher, D.; Therrien, R.; Kettaf, N.; Angermann, B.R.; Boucher, G.; Filali-Mouhim, A.; Moser, J.M.; Mehta, R.S.; Drake, D.R.; Castro, E.; et al. Yellow fever vaccine induces integrated multilineage and polyfunctional immune responses. J. Exp. Med. 2008, 205, 3119–3131. [Google Scholar] [CrossRef] [Scilit]
- Overby, A.K.; Popov, V.L.; Niedrig, M.; Weber, F. Tick-borne encephalitis virus delays interferon induction and hides its double-stranded RNA in intracellular membrane vesicles. J. Virol. 2010, 84, 8470–8483. [Google Scholar] [CrossRef] [Scilit]
- Robertson, S.J.; Lubick, K.J.; Freedman, B.A.; Carmody, A.B.; Best, S.M. Tick-Borne Flaviviruses Antagonize Both IRF-1 and Type I IFN Signaling To Inhibit Dendritic Cell Function. J. Immunol. 2014, 192, 2744–2755. [Google Scholar] [CrossRef] [Scilit]
- Yang, Q.; You, J.; Zhou, Y.; Wang, Y.; Pei, R.; Chen, X.; Yang, M.; Chen, J. Tick-borne encephalitis virus NS4A ubiquitination antagonizes type I interferon-stimulated STAT1/2 signalling pathway. Emerg. Microbes Infect. 2020, 9, 714–726. [Google Scholar] [CrossRef] [Scilit]
- Ye, J.; Zhu, B.; Fu, Z.F.; Chen, H.; Cao, S. Immune evasion strategies of flaviviruses. Vaccine 2013, 31, 461–471. [Google Scholar] [CrossRef] [Scilit]
- Lubick, K.J.; Robertson, S.J.; McNally, K.L.; Freedman, B.A.; Rasmussen, A.L.; Taylor, R.T.; Tsuruda, S.; Sakai, M.; Ishizuka, M.; Boer, E.F.; et al. Flavivirus antagonism of type i interferon signaling reveals prolidase as a regulator of IFNAR1 surface expression. Cell Host Microbe 2015, 18, 61–74. [Google Scholar] [CrossRef] [Scilit]
- Carletti, T.; Zakaria, M.K.; Marcello, A. The host cell response to tick-borne encephalitis virus. Biochem. Biophys. Res. Commun. 2017. [Google Scholar] [CrossRef] [Scilit]
- Krylova, N.V.; Smolina, T.P.; Leonova, G.N. Molecular mechanisms of interaction between human immune cells and far eastern tick-borne encephalitis virus strains. Viral Immunol. 2015, 28, 272–281. [Google Scholar] [CrossRef] [Scilit]
- Palus, M.; Vancova, M.; Sirmarova, J.; Elsterova, J.; Perner, J.; Ruzek, D. Tick-borne encephalitis virus infects human brain microvascular endothelial cells without compromising blood-brain barrier integrity. Virology 2017, 507, 110–122. [Google Scholar] [CrossRef] [Scilit]
- Chang, T.H.; Liao, C.L.; Lin, Y.L. Flavivirus induces interferon-beta gene expression through a pathway involving RIG-I-dependent IRF-3 and PI3K-dependent NF-κB activation. Microbes Infect. 2006, 8, 157–171. [Google Scholar] [CrossRef] [Scilit]
- Kato, H.; Takeuchi, O.; Sato, S.; Yoneyama, M.; Yamamoto, M.; Matsui, K.; Uematsu, S.; Jung, A.; Kawai, T.; Ishii, K.J.; et al. Differential roles of MDA5 and RIG-I helicases in the recognition of RNA viruses. Nature 2006, 441, 101–105. [Google Scholar] [CrossRef] [Scilit]
- Fares, M.; Cochet-Bernoin, M.; Gonzalez, G.; Montero-Menei, C.N.; Blanchet, O.; Benchoua, A.; Boissart, C.; Lecollinet, S.; Richardson, J.; Haddad, N.; et al. Pathological modeling of TBEV infection reveals differential innate immune responses in human neurons and astrocytes that correlate with their susceptibility to infection. J. Neuroinflamm. 2020, 17, 76. [Google Scholar] [CrossRef] [Scilit]
- Carletti, T.; Zakaria, M.K.; Faoro, V.; Reale, L.; Kazungu, Y.; Licastro, D.; Marcello, A. Viral priming of cell intrinsic innate antiviral signaling by the unfolded protein response. Nat. Commun. 2019, 10, 3889. [Google Scholar] [CrossRef] [Scilit]
- Loo, Y.-M.; Fornek, J.; Crochet, N.; Bajwa, G.; Perwitasari, O.; Martinez-Sobrido, L.; Akira, S.; Gill, M.A.; García-Sastre, A.; Katze, M.G.; et al. Distinct RIG-I and MDA5 Signaling by RNA Viruses in Innate Immunity. J. Virol. 2008, 82, 335–345. [Google Scholar] [CrossRef] [Scilit]
- Mazeaud, C.; Freppel, W.; Chatel-Chaix, L. The Multiples Fates of the Flavivirus RNA Genome During Pathogenesis. Front. Genet. 2018, 9, 595. [Google Scholar] [CrossRef] [Scilit]
- Lee, M.K.; Kim, H.E.; Park, E.B.; Lee, J.; Kim, K.H.; Lim, K.; Yum, S.; Lee, Y.H.; Kang, S.J.; Lee, J.H.; et al. Structural features of influenza A virus panhandle RNA enabling the activation of RIG-I independently of 5′-triphosphate. Nucleic Acids Res. 2016, 44, 8407–8416. [Google Scholar] [CrossRef] [Scilit]
- Kofler, R.M.; Hoenninger, V.M.; Thurner, C.; Mandl, C.W. Functional Analysis of the Tick-Borne Encephalitis Virus Cyclization ElementsIndicates Major Differences between Mosquito-Borne and Tick-Borne Flaviviruses. J. Virol. 2006, 80, 4099–4113. [Google Scholar] [CrossRef] [Scilit]
- Gritsun, T.S.; Gould, E.A. Origin and evolution of flavivirus 5′UTRs and panhandles: Trans-terminal duplications? Virology 2007, 366, 8–15. [Google Scholar] [CrossRef] [Scilit]
- Martikainen, M.-V.; Roponen, M. Cryopreservation affected the levels of immune responses of PBMCs and antigen-presenting cells. Toxicol. In Vitro 2020, 67, 104918. [Google Scholar] [CrossRef] [Scilit]
- Chowdhury, F.; Johnson, P.; Williams, A.P. Enumeration and phenotypic assessment of human plasmacytoid and myeloid dendritic cells in whole blood. Cytom. Part A 2010, 77, 328–337. [Google Scholar] [CrossRef] [Scilit]
- Meijerink, M.; Ulluwishewa, D.; Anderson, R.C.; Wells, J.M. Cryopreservation of monocytes or differentiated immature DCs leads to an altered cytokine response to TLR agonists and microbial stimulation. J. Immunol. Methods 2011, 373, 136–142. [Google Scholar] [CrossRef] [Scilit]
- Anderson, J.; Toh, Z.Q.; Reitsma, A.; Do, L.A.H.; Nathanielsz, J.; Licciardi, P.V. Effect of peripheral blood mononuclear cell cryopreservation on innate and adaptive immune responses. J. Immunol. Methods 2019, 465, 61–66. [Google Scholar] [CrossRef] [Scilit]
- Herrera-Rodriguez, J.; Signorazzi, A.; Holtrop, M.; de Vries-Idema, J.; Huckriede, A. Inactivated or damaged? Comparing the effect of inactivation methods on influenza virions to optimize vaccine production. Vaccine 2019, 37, 1630–1637. [Google Scholar] [CrossRef] [Scilit]
- Talbot, H.K.; Nian, H.; Zhu, Y.; Chen, Q.; Williams, J.V.; Griffin, M.R. Clinical effectiveness of split-virion versus subunit trivalent influenza vaccines in older adults. Clin. Infect. Dis. 2015, 60, 1170–1175. [Google Scholar] [CrossRef] [Scilit]
- Lu, F.; HogenEsch, H. Kinetics of the inflammatory response following intramuscular injection of aluminum adjuvant. Vaccine 2013, 31, 3979–3986. [Google Scholar] [CrossRef] [Scilit]
- Stephen, J.; Scales, H.E.; Benson, R.A.; Erben, D.; Garside, P.; Brewer, J.M. Neutrophil swarming and extracellular trap formation play a significant role in Alum adjuvant activity. NPJ Vaccines 2017, 2, 1–9. [Google Scholar] [CrossRef] [Scilit]
- Ghimire, T.R.; Benson, R.A.; Garside, P.; Brewer, J.M. Alum increases antigen uptake, reduces antigen degradation and sustains antigen presentation by DCs in vitro. Immunol. Lett. 2012, 147, 55–62. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zlatkovic, J.; Tsouchnikas, G.; Jarmer, J.; Koessl, C.; Stiasny, K.; Heinz, F.X. Aluminum Hydroxide Influences Not Only the Extent but Also the Fine Specificity and Functional Activity of Antibody Responses to Tick-Borne Encephalitis Virus in Mice. J. Virol. 2013, 87, 12187–12195. [Google Scholar] [CrossRef] [Scilit]
- Pokorna Formanova, P.; Palus, M.; Salat, J.; Hönig, V.; Stefanik, M.; Svoboda, P.; Ruzek, D. Changes in cytokine and chemokine profiles in mouse serum and brain, and in human neural cells, upon tick-borne encephalitis virus infection. J. Neuroinflamm. 2019, 16, 205. [Google Scholar] [CrossRef] [Scilit]
- Panayiotou, C.; Lindqvist, R.; Kurhade, C.; Vonderstein, K.; Pasto, J.; Edlund, K.; Upadhyay, A.S.; Överby, A.K. Viperin Restricts Zika Virus and Tick-Borne Encephalitis Virus Replication by Targeting NS3 for Proteasomal Degradation. J. Virol. 2018, 92, 2054–2071. [Google Scholar] [CrossRef] [Scilit]
- Lepej, S.Ž.; Mišić-Majerus, L.; Jeren, T.; Rode, O.D.; Remenar, A.; Šporec, V.; Vince, A. Chemokines CXCL10 and CXCL11 in the cerebrospinal fluid of patients with tick-borne encephalitis. Acta Neurol. Scand. 2007, 115, 109–114. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Waickman, A.T.; Victor, K.; Li, T.; Hatch, K.; Rutvisuttinunt, W.; Medin, C.; Gabriel, B.; Jarman, R.G.; Friberg, H.; Currier, J.R. Dissecting the heterogeneity of DENV vaccine-elicited cellular immunity using single-cell RNA sequencing and metabolic profiling. Nat. Commun. 2019, 10, 3666. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Luciani, F.; Bull, R.A.; Lloyd, A.R. Next generation deep sequencing and vaccine design: Today and tomorrow. Trends Biotechnol. 2012, 30, 443–452. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kennedy, R.B.; Poland, G.A. The Top Five “Game Changers” in Vaccinology: Toward Rational and Directed Vaccine Development. OMICS A J. Integr. Biol. 2011, 15, 533–537. [Google Scholar] [CrossRef] [Scilit]





Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Signorazzi, A.; Pennings, J.L.A.; Etna, M.P.; Noya, M.; Coccia, E.M.; Huckriede, A. In Vitro Characterization of the Innate Immune Pathways Engaged by Live and Inactivated Tick-Borne Encephalitis Virus. Vaccines 2021, 9, 664. https://doi.org/10.3390/vaccines9060664
Signorazzi A, Pennings JLA, Etna MP, Noya M, Coccia EM, Huckriede A. In Vitro Characterization of the Innate Immune Pathways Engaged by Live and Inactivated Tick-Borne Encephalitis Virus. Vaccines. 2021; 9(6):664. https://doi.org/10.3390/vaccines9060664
Chicago/Turabian StyleSignorazzi, Aurora, Jeroen L. A. Pennings, Marilena P. Etna, Malou Noya, Eliana M. Coccia, and Anke Huckriede. 2021. "In Vitro Characterization of the Innate Immune Pathways Engaged by Live and Inactivated Tick-Borne Encephalitis Virus" Vaccines 9, no. 6: 664. https://doi.org/10.3390/vaccines9060664
APA StyleSignorazzi, A., Pennings, J. L. A., Etna, M. P., Noya, M., Coccia, E. M., & Huckriede, A. (2021). In Vitro Characterization of the Innate Immune Pathways Engaged by Live and Inactivated Tick-Borne Encephalitis Virus. Vaccines, 9(6), 664. https://doi.org/10.3390/vaccines9060664

