Generation and Evaluation of an African Swine Fever Virus Mutant with Deletion of the CD2v and UK Genes
Abstract
1. Introduction
2. Materials and Methods
2.1. Cells and Viruses
2.2. Construction of Transfer Vectors
2.3. Generation of ASFV-SY18-∆CD2v/UK
2.4. Identification of ASFV-SY18-∆CD2v/UK
2.4.1. PCR
2.4.2. Hemadsorption (HAD) Assay
2.4.3. Fluorescence Assay
2.4.4. In Vitro Growth Kinetics
2.5. Animal Experiments
2.5.1. Detection of ASFV-Specific Antibodies
2.5.2. Real-Time PCR (qPCR)
2.5.3. Examination of Gross Lesions
2.6. Statistical Analysis
3. Results
3.1. Generation of CD2v/UK Gene-Deleted ASFV-SY18
3.2. In Vitro Replication and Hemadsorption of ASFV-SY18-∆CD2v/UK
3.3. The Virulence of ASFV-SY18-∆CD2v/UK in Pigs
3.4. Protective Efficacy of ASFV-SY18-∆CD2v/UK against ASFV-SY18 Challenge in Pigs
3.5. Analysis of the Immune Response in ASFV-SY18-∆CD2v/UK-Inoculated Pigs
3.6. Gross Pathological Lesions in the Inoculated Pigs Following the Challenge with ASFV-SY18
4. Discussion
5. Conclusions
Author Contributions
Funding
Conflicts of Interest
References
- Sánchez-Vizcaíno, J.M.; Mur, L.; Gomez-Villamandos, J.C.; Carrasco, L. An update on the epidemiology and pathology of African swine fever. J. Comp. Pathol. 2015, 152, 9–21. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Sánchez-Vizcaíno, J.M.; Mur, L.; Bastos, A.D.; Penrith, M.L. New insights into the role of ticks in African swine fever epidemiology. Rev. Sci. Tech. Off. Int. Epiz. 2015, 34, 503–511. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Jori, F.; Vial, L.; Penrith, M.L.; Pérez-Sánchez, R.; Etter, E.; Albina, E.; Michaud, V.; Roger, F. Review of the sylvatic cycle of African swine fever in sub-Saharan Africa and the Indian Ocean. Virus Res. 2013, 173, 212–227. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Alonso, C.; Borca, M.; Dixon, L.; Revilla, Y.; Rodriguez, F.; Escribano, J.M. ICTV virus taxonomy profile: Asfarviridae. J. Gen. Virol. 2018, 99, 613–614. [Google Scholar] [CrossRef] [Scilit]
- Mazur-Panasiuk, N.; Żmudzki, J.; Woźniakowski, G. African swine fever virus-persistence in different environmental conditions and the possibility of its indirect transmission. J. Vet. Res. 2019, 63, 303–310. [Google Scholar] [CrossRef] [Scilit]
- Dixon, L.K.; Chapman, D.A.; Netherton, C.L.; Upton, C. African swine fever virus replication and genomics. Virus Res. 2013, 173, 3–14. [Google Scholar] [CrossRef] [Scilit]
- Bastos, A.D.; Penrith, M.L.; Cruciere, C.; Edrich, J.L.; Hutchings, G.; Roger, F.; Couacy-Hymann, E.G.; Thomson, G.R. Genotyping field strains of African swine fever virus by partial p72 gene characterisation. Arch. Virol. 2003, 148, 693–706. [Google Scholar] [CrossRef] [Scilit]
- Achenbach, J.E.; Gallardo, C.; Nieto-Pelegrín, E.; Rivera-Arroyo, B.; Degefa-Negi, T.; Arias, M.; Jenberie, S.; Mulisa, D.D.; Gizaw, D.; Gelaye, E.; et al. Identification of a new genotype of African swine fever virus in domestic pigs from Ethiopia. Transbound. Emerg. Dis. 2017, 64, 1393–1404. [Google Scholar] [CrossRef] [Scilit]
- Quembo, C.J.; Jori, F.; Vosloo, W.; Heath, L. Genetic characterization of African swine fever virus isolates from soft ticks at the wildlife/domestic interface in Mozambique and identification of a novel genotype. Transbound. Emerg. Dis. 2018, 65, 420–431. [Google Scholar] [CrossRef] [Scilit]
- Zhou, X.; Li, N.; Luo, Y.; Liu, Y.; Miao, F.; Chen, T.; Zhang, S.; Cao, P.; Li, X.; Tian, K.; et al. Emergence of African swine fever in China, 2018. Transbound. Emerg. Dis. 2018, 65, 1482–1484. [Google Scholar] [CrossRef] [Scilit]
- Chenais, E.; Depner, K.; Guberti, V.; Dietze, K.; Viltrop, A.; Ståhl, K. Epidemiological considerations on African swine fever in Europe 2014-2018. Porc. Health Manag. 2019, 5, 1–10. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Reis, A.L.; Abrams, C.C.; Goatley, L.C.; Netherton, C.; Chapman, D.G.; Sanchez-Cordon, P.; Dixon, L.K. Deletion of African swine fever virus interferon inhibitors from the genome of a virulent isolate reduces virulence in domestic pigs and induces a protective response. Vaccine 2016, 34, 4698–4705. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Tulman, E.R.; Delhon, G.A.; Ku, B.K.; Rock, D.L. African swine fever virus. In Lesser Known Large dsDNA Viruses; Van Etten, J.L., Ed.; Springer: Berlin/Heidelberg, Germany, 2009; pp. 43–87. [Google Scholar]
- Revilla, Y.; Perez-Núñez, D.; Richt, A. African swine fever virus biology and vaccine approaches. Adv. Virus Res. 2018, 100, 41–74. [Google Scholar] [PubMed]
- Costard, S.; Mur, L.; Lubroth, J.; Sanchez-Vizcaino, J.M.; Pfeiffer, D.U. Epidemiology of African swine fever virus. Virus Res. 2013, 173, 191–197. [Google Scholar] [CrossRef] [Scilit]
- Rowlands, R.J.; Michaud, V.; Heath, L.; Hutchings, G.; Oura, C.; Vosloo, W.; Dwarka, R.; Onashvili, T.; Albina, E.; Dixon, L.K. African swine fever virus isolate, Georgia, 2007. Emerg. Infect. Dis. 2008, 14, 1870. [Google Scholar] [CrossRef] [Scilit]
- Sánchez-Cordón, P.J.; Montoya, A.L.; Reis, A.L.; Dixon, L.K. African swine fever: A re-emerging viral disease threatening the global pig industry. Vet. J. 2018, 41–48. [Google Scholar] [CrossRef] [Scilit]
- Heilmann, M.; Amarsanaa, L.; Tuvshinbayar, A.; Bodisaikhan, K.; Bayartungalag, B.; Ulaankhuu, A.; Guo, F.; Eran, R.; Klaas, D. African swine fever in Mongolia: Course of the epidemic and applied control measures. Vet. Sci. 2020, 7, 24. [Google Scholar] [CrossRef] [Scilit]
- Yoo, D.; Hyunil, K.; Joo, Y.L.; Han, S.Y. African swine fever: Etiology, epidemiological status in Korea, and perspective on control. J. Vet. Sci. 2020, 21, e38. [Google Scholar] [CrossRef] [Scilit]
- Li, X.; Tian, K. African swine fever in China. Vet. Rec. 2018, 183, 300. [Google Scholar] [CrossRef] [Scilit]
- Dixon, L.K.; Stahl, K.; Jori, F.; Vial, L.; Pfeiffer, D.U. African swine fever epidemiology and control. Annu. Rev. Anim. Biosci. 2019, 8, 221–246. [Google Scholar] [CrossRef] [Scilit]
- Lacasta, A.; Monteagudo, P.L.; Jiménez-Marín, Á.; Accensi, F.; Ballester, M.; Argilaguet, J.; Galindo-Cardiel, I.; Segalés, J.; Salas, M.L.; Domínguez, J.; et al. Live attenuated African swine fever viruses as ideal tools to dissect the mechanisms involved in viral pathogenesis and immune protection. Vet. Res. 2015, 46, 135. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Arias, M.; De la Torre, A.; Dixon, L.; Gallardo, C.; Jori, F.; Laddomada, A.; Martins, C.; Parkhouse, R.M.; Revilla, Y.; Rodriguez, F. Approaches and perspectives for development of African swine fever virus vaccines. Vaccines 2017, 5, 35. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Mebus, C.A. African swine fever. Adv. Virus Res. 1988, 35, 251–269. [Google Scholar] [PubMed]
- Kihm, U.; Ackermann, M.; Mueller, H.; Pool, R. Approaches to vaccination. In African Swine Fever; Yechiel, B., Ed.; Springer: Boston, MA, US, 1987; pp. 127–144. [Google Scholar]
- Blome, S.; Gabriel, C.; Beer, M. Modern adjuvants do not enhance the efficacy of an inactivated African swine fever virus vaccine preparation. Vaccine 2014, 32, 3879–3882. [Google Scholar] [CrossRef] [Scilit]
- Lacasta, A.; Ballester, M.; Monteagudo, P.L.; Rodríguez, J.M.; Salas, M.L.; Accensi, F.; Pina-Pedrero, S.; Bensaid, A.; Argilaguet, J.; López-Soria, S.; et al. Expression library immunization can confer protection against lethal challenge with African swine fever virus. J. Virol. 2014, 88, 13322–13332. [Google Scholar] [CrossRef] [Scilit]
- Dixon, L.K.; Abrams, C.C.; Bowick, G.; Goatley, L.C.; Kay-Jackson, P.C.; Chapman, D.; Liverani, E.; Nix, R.; Silk, R.; Zhang, F. African swine fever virus proteins involved in evading host defence systems. Vet. Immunol. Immunopathol. 2004, 100, 117–134. [Google Scholar] [CrossRef] [Scilit]
- Correia, S.; Ventura, S.; Parkhouse, R.M. Identification and utility of innate immune system evasion mechanisms of ASFV. Virus Res. 2013, 173, 87–100. [Google Scholar] [CrossRef] [Scilit]
- Takamatsu, H.H.; Denyer, M.S.; Lacasta, A.; Stirling, C.M.; Argilaguet, J.M.; Netherton, C.L.; Oura, C.A.; Martins, C.; Rodríguez, F. Cellular immunity in ASFV responses. Virus Res. 2013, 173, 110–121. [Google Scholar] [CrossRef] [Scilit]
- Reis, A.L.; Netherton, C.; Dixon, L.K. Unraveling the armor of a killer: Evasion of host defenses by African swine fever virus. J. Virol. 2017, 91, e02338-16. [Google Scholar] [CrossRef] [Scilit]
- Afonso, C.L.; Piccone, M.E.; Zaffuto, K.M.; Neilan, J.; Kutish, G.F.; Lu, Z.; Balinsky, C.A.; Gibb, T.R.; Bean, T.J.; Zsak, L.; et al. African swine fever virus multigene family 360 and 530 genes affect host interferon response. J. Virol. 2004, 78, 1858–1864. [Google Scholar] [CrossRef] [Scilit]
- Krug, P.W.; Holinka, L.G.; O’Donnell, V.; Reese, B.; Sanford, B.; Fernandez-Sainz, I.; Gladue, D.P.; Arzt, J.; Rodriguez, L.; Risatti, G.R.; et al. The progressive adaptation of a Georgian isolate of African swine fever virus to Vero cells leads to a gradual attenuation of virulence in swine corresponding to major modifications of the viral genome. J. Virol. 2015, 89, 2324–2332. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Chapman, D.A.; Tcherepanov, V.; Upton, C.; Dixon, L.K. Comparison of the genome sequences of non-pathogenic and pathogenic African swine fever virus isolates. J. Gen. Virol. 2008, 89, 397–408. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Sánchez-Cordón, P.J.; Jabbar, T.; Berrezaie, M.; Chapman, D.; Reis, A.; Sastre, P.; Rueda, P.; Goatley, L.; Dixon, L.K. Evaluation of protection induced by immunisation of domestic pigs with deletion mutant African swine fever virus BeninΔMGF by different doses and routes. Vaccine 2018, 36, 707–715. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Monteagudo, P.L.; Lacasta, A.; López, E.; Bosch, L.; Collado, J.; Pina-Pedrero, S.; Correa-Fiz, F.; Accensi, F.; Navas, M.J.; Vidal, E.; et al. BA71ΔCD2v: A new recombinant live attenuated African swine fever virus with cross-protective capabilities. J. Virol. 2017, 91, e01058-17. [Google Scholar] [CrossRef] [Scilit]
- O’Donnell, V.; Holinka, L.G.; Sanford, B.; Krug, P.W.; Carlson, J.; Pacheco, J.M.; Reese, B.; Risatti, G.R.; Gladue, D.P.; Borca, M.V. African swine fever virus Georgian isolate harboring deletion of 9GL and MGF360/505 gene is highly attenuated in swine but does not confer protection against parental virus challenge. Virus Res. 2016, 221, 8–14. [Google Scholar] [CrossRef] [Scilit]
- O’Donnell, V.; Risatti, G.R.; Holinka, L.G.; Krug, P.W.; Carlson, J.; Velazquez-Salinas, L.; Azzinaro, P.A.; Gladue, D.P.; Borca, M.V. Simultaneous deletion of the 9GL and UK genes from the African swine fever virus Georgia 2007 isolate offers increased safety and protection against homologous challenge. J. Virol. 2017, 91, e01760-16. [Google Scholar] [CrossRef] [Scilit]
- Borca, M.V.; Carrillo, C.; Zsak, L.; Laegreid, W.W.; Kutish, G.F.; Neilan, J.G.; Burrage, T.G.; Rock, D.L. Deletion of a CD2-like gene, 8-DR, from African swine fever virus affects viral infection in domestic swine. J. Virol. 1998, 72, 2881–2889. [Google Scholar] [CrossRef] [Scilit]
- Borca, M.V.; O’Donnell, V.; Holinka, L.G.; Risatti, G.R.; Ramirez-Medina, E.; Vuono, E.A.; Shi, J.; Pruitt, S.; Rai, A.; Silva, E.; et al. Deletion of CD2-like gene from the genome of African swine fever virus strain Georgia does not attenuate virulence in swine. Sci. Rep. 2020, 10, 1–8. [Google Scholar] [CrossRef] [Scilit]
- Rodriguez, J.M.; Yanez, R.J.; Almazan, F.; Vinuela, E.; Rodriguez, J.F. African swine fever virus encodes a CD2 homolog responsible for the adhesion of erythrocytes to infected cells. J. Virol. 1993, 67, 5312–5320. [Google Scholar] [CrossRef] [Scilit]
- Zsak, L.; Caler, E.; Lu, Z.; Kutish, G.F.; Neilan, J.G.; Rock, D.L. A Nonessential African swine fever virus gene UK is a significant virulence determinant in domestic swine. J. Virol. 1998, 72, 1028–1035. [Google Scholar] [CrossRef] [Scilit]
- Carrascosa, A.L.; Bustos, M.J.; de Leon, P. Methods for growing and titrating African swine fever virus: Field and laboratory samples. Curr. Protoc. Cell Biol. 2011, 53, 26.14.1–26.14.25. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Borca, M.V.; O’Donnell, V.; Holinka, L.G.; Sanford, B.; Azzinaro, P.A.; Risatti, G.R.; Gladue, D.P. Development of a fluorescent ASFV strain that retains the ability to cause disease in swine. Sci. Rep. 2017, 7, 46747. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Reed, L.J.; Muench, H.A. Simple method of estimating fifty percent endpoints. Am. J. Epidemiol. 1938, 27, 493–497. [Google Scholar] [CrossRef] [Scilit]
- Malmquist, W.A.; Hay, D. Hemadsorption and cytopathic effect produced by African swine fever virus in swine bone marrow and buffy coat cultures. Am. J. Vet. Res. 1960, 21, 104–108. [Google Scholar] [PubMed]
- MacArthur Clark, J.A.; Sun, D. Guidelines for the Ethical review of Laboratory Animal Welfare People’s Republic of China National Standard GB/T 35892-2018 [Issued 6 February 2018 Effective from 1 September 2018]. AMEM 2020, 3, 103–113. [Google Scholar] [PubMed]
- O’Donnell, V.; Holinka, L.G.; Gladue, D.P.; Sanford, B.; Krug, P.W.; Lu, X.; Arzt, J.; Reese, B.; Carrillo, C.; Risatti, G.R.; et al. African swine fever virus Georgia isolate harboring deletions of MGF360 and MGF505 genes is attenuated in swine and confers protection against challenge with virulent parental virus. J. Virol. 2015, 89, 11. [Google Scholar] [CrossRef] [Scilit]
- Zhao, D.; Liu, R.; Zhang, X.; Li, F.; Wang, J.; Zhang, J.; Liu, X.; Wang, L.; Zhang, J.; Wu, X.; et al. Replication and virulence in pigs of the first African swine fever virus isolated in China. Emerg. Microbes Infect. 2019, 8, 438–447. [Google Scholar] [CrossRef] [Scilit]
- King, D.P.; Reid, S.M.; Hutchings, G.H.; Grierson, S.S.; Wilkinson, P.J.; Dixon, L.K.; Bastos, A.D.S.; Drew, T.W. Development of a TaqMan® PCR assay with internal amplification control for the detection of African swine fever virus. J. Virol. Methods 2003, 107, 53–61. [Google Scholar] [CrossRef] [Scilit]
- Rosner, B. Fundamentals of Biostatistics, 8th ed.; Cenveo® Publisher Services: Boston, MA, USA, 2016; pp. 290–298. [Google Scholar]
- Daniel, W.W.; Cross, C.L. Biostatistics: A Foundation for Analysis in the Health Sciences, 10th ed.; Wiley: Hoboken, NJ, USA, 2013; pp. 751–757. [Google Scholar]
- Dixon, L.K.; Abrams, C.C.; Chapman, D.D.; Goatley, L.C.; Netherton, C.L.; Taylor, G.; Takamatsu, H.H. Prospects for development of African swine fever virus vaccines. In Vaccines and Diagnostics for Transboundary Animal Diseases; Roth, J.A., Richt, J.A., Morozov, I.A., Eds.; Karger Publishers: Basel, Switzerland, 2013; Volume 135, pp. 147–157. [Google Scholar]
- Borca, M.V.; Kutish, G.F.; Afonso, C.L.; Irusta, P.; Carrillo, C.; Brun, A.; Sussman, M.; Rock, D.L. An African swine fever virus gene with similarity to the T-lymphocyte surface antigen CD2 mediates hemadsorption. Virology 1994, 199, 463–468. [Google Scholar] [CrossRef] [Scilit]
- Goatley, L.C.; Dixon, L.K. Processing and localization of the African swine fever virus CD2v transmembrane protein. J. Virol. 2011, 85, 3294–3305. [Google Scholar] [CrossRef] [Scilit]
- Rowlands, R.J.; Duarte, M.M.; Boinas, F.; Hutchings, G.; Dixon, L.K. The CD2v protein enhances African swine fever virus replication in the tick vector. Ornithodoros Erraticus. Virol. 2009, 393, 319–328. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Barasona, J.A.; Gallardo, C.; Cadenas-Fernández, E.; Jurado, C.; Rivera, B.; Rodríguez-Bertos, A.; Arias, M.; Sánchez-Vizcaíno, J.M. First oral vaccination of Eurasian wild boar against African swine fever virus genotype II. Front. Vet. Sci. 2016, 6, 137. [Google Scholar] [CrossRef] [Scilit] [PubMed]





| Name | Sequence (5′–3′) | Description |
|---|---|---|
| CD2vd-LA-F | GGTACCCGGGAGCTCGAATTCGTCTAGTTATATATGTCGGTCA | Used to amplify the left arm |
| CD2vd-LA-R | GACTTTTCTCCGGCGACCCTTTATGAACATATGTTTTATA | |
| CD2vd-m-F | TATAAAACATATGTTCATAAAGGGTCGCCGGAGAAAAGTC | Used to amplify the EGFP marker gene |
| CD2vd-m-R | GGTTAAATAATTAATATATAGTTATCTAGATCCGGTGGATCCC | |
| CD2vd-RA-F | GGGATCCACCGGATCTAGATAACTATATATTAATTATTTAACC | Used to amplify the right arm |
| CD2vd-RA-R | GTCTGCAGAAGCTTCGAATTCGATATTTTGGCTATCATCGG | |
| CD2v-F | CACTAGCTACATGTGGAAAAGCAGG | Used to detect wild-type ASFV in CD2v-deleted ASFV purification |
| CD2v-R | GGGTAGATAATGGCGGGATATTG | |
| UKd-LA-F | CCCGGGAGCTCGAATTCGAAGCTTTTCACCTTTATGAAATGATC | Used to amplify the left arm |
| UKd-LA-R | GACTTTTCTCCGGCGACCCGCTAATAGTTACTATACAAAAATAG | |
| UKd-m-F | CTATTTTTGTATAGTAACTATTAGCGGGTCGCCGGAGAAAAGTC | Used to amplify the dsRed marker gene |
| UKd-m-R | GGATGGAGCGCATTAGGGATTACAGGAACAGGTGGTGGC | |
| UKd-RA-F | GCCACCACCTGTTCCTGTAATCCCTAATGCGCTCCATCC | Used to amplify the right arm |
| UKd-RA-R | GCCACGGCGATATCGGATCCAATAGAGTCATTATTTAATAATAGG | |
| UK-F | CCGCCTCCCCATTATTCTTC | Used to detect wild-type ASFV in UK-deleted ASFV purification |
| UK-R | GATGGAGCGCATTAGGGATCCC | |
| p72-F | GCTCGCCGAAGGGAATGGATAC | Used to detect ASFV DNA in recombinant virus isolation |
| p72-R | GGCCGACAAGATTATATTGG | |
| p72-F | CTGCTCATGGTATCAATCTTATCGA | Used in real-time PCR |
| p72-R | GATACCACAAGATCAGGCCGT | |
| eGFP-F | AGTCCGCCCTGAGCAAAGA | Used in real-time PCR to detect EGFP |
| eGFP-R | TCCAGCAGGACCATGTGATC |
| Group | CT Value of Real-Time PCR | ||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|
| Days Post-Inoculation | Days Post-Challenge | ||||||||||
| No. | 0 | 21 | 28 | 3 | 6 | 9 | 12 | 15 | 18 | 21 | |
| A1 | N | N | N | N | N | N | N | N | 36.50 | 36.60 | |
| ASFV-SY18-∆CD2v/UK | A2 | N | N | N | N | N | N | N | N | 36.90 | 37.10 |
| A3 | N | N | N | N | N | N | N | N | 36.70 | 36.80 | |
| A4 | N | N | N | N | N | N | N | N | 37.01 | 37.06 | |
| A5 | N | N | N | N | N | N | N | N | 36.92 | 36.78 | |
| B1 | N | N | N | 25.6 | 18.0 | / | |||||
| PBS | B2 | N | N | N | 26.7 | 23.4 | / | ||||
| B3 | N | N | N | 26.9 | 23.1 | 21.4 | / | ||||
| B4 | N | N | N | 26.7 | 23.4 | / | |||||
| B5 | N | N | N | 26.9 | 24.1 | 21.4 | / | ||||
| CT Values of Real-Time PCR | |||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|
| Group | Days Post-Inoculation | Days post-challenge | |||||||||
| No. | 0 | 21 | 28 | 3 | 6 | 9 | 12 | 15 | 18 | 21 | |
| A1 | N | N | N | N | 35.70 | 36.80 | 35.40 | 37.90 | 36.60 | 36.80 | |
| A2 | N | N | N | N | 36.10 | 36.80 | 36.90 | 37.10 | 35.60 | 36.20 | |
| ASFV-SY18-∆CD2v/UK | A3 | N | N | N | N | 36.40 | 35.80 | 37.10 | 38.00 | 37.76 | 37.80 |
| A4 | N | N | N | N | 35.50 | 35.30 | 36.30 | 36.10 | 39.52 | 39.00 | |
| A5 | N | N | N | N | 36.10 | 37.20 | 35.10 | 35.40 | 35.83 | 36.00 | |
| B1 | N | N | N | 36.40 | 21.00 | / | |||||
| B2 | N | N | N | N | 35.00 | 28.10 | / | ||||
| PBS | B3 | N | N | N | 33.50 | 23.00 | 22.70 | / | |||
| B4 | N | N | N | 33.10 | / | ||||||
| B5 | N | N | N | 33.40 | / | ||||||
| Group | CT Value of Real-time PCR | ||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|
| No. | Heart | Lung | Spleen | Liver | Kidney | Bladder | Ig. ln | Ms. ln | Tonsil | Sub. m ln | |
| ASFV-SY18- ∆CD2v/UK | A1 | N | N | N | N | N | N | 36.50 | N | 36.70 | 37.50 |
| A2 | N | N | N | N | N | N | N | N | 37.20 | 36.80 | |
| A3 | N | N | N | N | N | N | N | N | N | 39.19 | |
| A4 | N | N | N | N | N | N | 36.73 | 37.80 | 36.48 | 36.29 | |
| A5 | N | N | N | N | N | N | N | N | 37.20 | 37.10 | |
| PBS | B1 | 16.50 | 18.90 | 25.40 | 18.70 | 23.50 | 27.00 | 17.20 | 19.50 | 22.00 | 19.00 |
| B2 | 25.00 | 23.00 | 22.80 | 18.90 | 26.50 | 24.80 | 26.00 | 22.00 | 22.00 | 24.00 | |
| B3 | 24.80 | 16.20 | 23.80 | 19.30 | 21.00 | 25.50 | 22.00 | 20.70 | 22.20 | 22.20 | |
| B4 | 18.33 | 18.70 | 17.50 | 21.50 | 19.00 | 27.00 | 18.40 | 20.50 | 23.00 | 15.00 | |
| B5 | 19.30 | 19.70 | 25.20 | 20.90 | 18.94 | 24.80 | 24.77 | 20.50 | 22.70 | 22.00 | |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2020 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Teklue, T.; Wang, T.; Luo, Y.; Hu, R.; Sun, Y.; Qiu, H.-J. Generation and Evaluation of an African Swine Fever Virus Mutant with Deletion of the CD2v and UK Genes. Vaccines 2020, 8, 763. https://doi.org/10.3390/vaccines8040763
Teklue T, Wang T, Luo Y, Hu R, Sun Y, Qiu H-J. Generation and Evaluation of an African Swine Fever Virus Mutant with Deletion of the CD2v and UK Genes. Vaccines. 2020; 8(4):763. https://doi.org/10.3390/vaccines8040763
Chicago/Turabian StyleTeklue, Teshale, Tao Wang, Yuzi Luo, Rongliang Hu, Yuan Sun, and Hua-Ji Qiu. 2020. "Generation and Evaluation of an African Swine Fever Virus Mutant with Deletion of the CD2v and UK Genes" Vaccines 8, no. 4: 763. https://doi.org/10.3390/vaccines8040763
APA StyleTeklue, T., Wang, T., Luo, Y., Hu, R., Sun, Y., & Qiu, H.-J. (2020). Generation and Evaluation of an African Swine Fever Virus Mutant with Deletion of the CD2v and UK Genes. Vaccines, 8(4), 763. https://doi.org/10.3390/vaccines8040763

