Immunization Against a Conserved Short 13-Amino Acid Receptor-Binding Epitope of FSHβ Reduces Spermatogenesis and Sperm Motility in Male Mice

Abstract

Background: Follicle-stimulating hormone (FSH)-based vaccines show the potential to disrupt spermatogenesis without disturbing sexual function and libido in males. Herein, we developed a novel FSH vaccine based on the tandem of a conserved 13-amino acid receptor-binding epitope of FSHβ (FSHβ13AA-T) and tested its effect on reproductive physiology and function using the male mouse as a model. Methods: Serum reproductive hormone levels, testicular histology, daily sperm production, sperm motility, libido and fertility of male mice following FSH vaccination were determined. Results: Compared to placebo-immunized controls, FSH vaccination triggered (p < 0.05) marked antibody generation, inhibited spermatogenesis and reduced sperm motility (p < 0.05), without adverse effects on serum LH and testosterone levels as well as the libido of male mice. Mechanistically, FSH vaccination suppressed (p < 0.05) testicular local estrogen production by downregulated aromatase encoding gene Cyp19a1 expression and also downregulated (p < 0.05) expression of key spermatogenic genes in testes, including Creb, INHα, Wnt2, Aqp8, Cmtm2a and Spata19, thus disrupting and impairing spermatogenesis and sperm motility. Conclusions: These results demonstrate that immunization of male mice against FSHβ13AA could substantially inhibit spermatogenesis and reduce sperm motility. Thus, FSHβ13AA-based vaccines hold potential for development as male contraceptives that do not compromise libido in species including men in which FSH is essential for spermatogenesis.

1. Introduction

Spermatogenesis is a precisely concerted cascade of events during the development of spermatogonia into functionally competent mature spermatozoa. This highly regulated biological process is tightly orchestrated by two pituitary gonadotropins, luteinizing hormone (LH) and follicle-stimulating hormone (FSH). Specifically, LH binds to its cognate receptor (LHR) expressed on Leydig cells within the testicular interstitial interstitium to drive testosterone biosynthesis, and testosterone in turn activates the androgen receptor (AR) on Sertoli cells to propagate lineage-specific signals indispensable for spermatogenic progression [1]. In contrast, FSH acts independently and also in concert with testosterone, to promote Sertoli cell proliferation and to induce regulatory signals and nutritive factors that are required for the maintenance of developing germ cells [2]. Notably, defects in either steroidogenesis or spermatogenesis would lead to subfertility/infertility in males [2].

Men harboring loss-of-function mutation of FSHβ present as profoundly azoospermic and infertile despite intact testosterone production [3], suggesting the necessary role of FSH in spermatogenesis in humans. It is unlikely that rodents are able to complete spermatogenesis without FSH stimulus, but FSH deficiency significantly decreases sperm quantity [4]. Intriguingly, recent studies indicated that robust constitutive FSHR activation alone is sufficient to sustain spermatogenesis and fertility in mice, even when testosterone signaling is fully abrogated [2]. Given the crucial role of FSH in male fertility regulation, it has long been used as a promising immunogen to develop contraceptive vaccines. Very excitingly, such type of vaccine has the unique advantage that it can selectively block spermatogenesis to induce subfertility or infertility without impairing sexual function and libido [5,6,7], a key attribute of an ideal male contraceptive. Decades ago, attempts were made to develop FSH vaccines based on native ovine FSH αβ heterodimer or isolated β-chain, and their efficacy was widely tested in nonhuman primates [5,6,7] and men [8,9]. These studies confirmed that vaccination with ovine FSH based vaccines can block spermatogenesis, decrease sperm activities, and thus cause subfertility or in males [5,6,7,8]. Nevertheless, none of these candidates have progressed to clinical applications, primarily due to inconsistent immunological potency and suboptimal biological activity [9]. This is possibly due to the fact that the isolated native ovine αβ heterodimer or β-chain is big with a long peptide chain and thus cannot form native-like teritiary conformations in vitro, thus compromising the induction of endogenous FSH-specific neutralizing antibodies. Additionally, the existence of N-glycosylation and sialic acid residues in the FSH β-subunit may aggravate the difficulty in forming the right conformation in vitro. Excepting the above, more unacceptably, vaccination against the native ovine αβ heterodimer can induce cross-reaction with LH and consequently influence testosterone production [10], thus disturbing sexual function and libido in males.

Although it is well established that FSH induces the regulatory signals and nutritive factors essential for the maintenance of developing germ cells [2], the specific mechanisms underlying immunoneutralization of endogenous FSH-induced azoospermia and infertility remain incompletely elucidated. Beyond androgen (i.e., testosterone) synthesis, testes also produce estrogen hormones, a process involving the aromatization of androgens catalyzed by aromatase, a cytochrome P450 enzyme encoded by the Cyp19a1 gene [11]. Recent studies in male rabbits have demonstrated that loss of testicular estrogen leads to spermatogenic defects and an increased incidence of seminal abnormalities [12]. Notably, FSH plays a crucial role in stimulating Cyp19a1 gene expression and thereby estrogen biosynthesis in the testes [13]. However, whether FSH vaccination induces azoospermia and infertility partly through abrogating testicular local estrogen production remains to be experimentally determined.

Recently, a short, 13-amino acid motif within FSHβ <LVYKDPARPNIQK> was newly identified as the FSH receptor-binding epitope in both humans and mice [14]. Antibodies raised against this core peptide could effectively block FSH-FSHR interaction, thereby abrogating FSHR downstream signaling cascades [14]. Through conservation analysis, we found this short 13-amino acid FSHβ peptide is highly conserved across species [15]. Accordingly, we designed and developed a novel FSH vaccine based on this short 13-amino acid epitope peptide of FSHβ [15]. Using a mouse model, we previously validated its robust efficacy in inducing antibody responses and attenuating high FSH-driven adiposity in ovariectomized mice [15]. However, its efficacy as an antifertility agent in male fertility regulation remains to be elucidated. Thus, the present study aimed to test its potential as an antifertility/contraceptive vaccine in fertility control in male mice. Consequently, we found that immunization of male mice against FSHβ13AA could substantially inhibit spermatogenesis and reduce sperm motility. These findings offer a solid basis for facilitating the development of FSH-based immunocontraceptives and expanding their application in animal fertility management and human male contraception.

2. Materials and Methods

2.1. FSH Vaccine Formulation

The FSH vaccine formulation was prepared strictly in accordance with our previous report [15]. Briefly, a tandem repeat epitope peptide (designated as FSHβ13AA-T) was synthesized, which corresponds to the 13-amino acid sequence of the FSH β-subunit receptor-binding domain: YKDPARPNIQK (Figure 1A). This synthetic peptide was then covalently conjugated to ovalbumin (OVA), a commonly used carrier protein, yielding the conjugate FSHβ13AA-T-OVA. Finally, the conjugate was emulsified in Specol adjuvant (ID-Lelystad formula) to obtain the final FSH vaccine formulation.

2.2. Animals and Experimental Design

Healthy male C57BL/6 mice were purchased from Sichuan University Animal center (Chengdu, China). Mice were maintained at Sichuan Agricultural University animal center in 12 h light/dark cycles at 25 ± 0.5 °C and 50–60% humidity, and they were fed ad libitum with a standard chow (Shenyang Maohua Biotechnology Co., Ltd., Shenyang, China) and water. The animal care and experimental procedures were in accordance with the institutional guidelines for laboratory animals established by the animal Care and Use Committee of Sichuan Agricultural University.

2.2.1. Experiment 1: Effects of FSH Vaccination on Reproductive Physiology in Male Mice

Twenty male mice (7 weeks old, with comparable body weights) were randomly assigned to two groups (n = 10 per group). Specifically, the FSH-immunized group received active immunization with the FSH vaccine emulsion at 7 weeks of age, followed by a booster vaccination (same administration route and dosage) at 11 weeks of age. For each immunization, each mouse received an intramuscular (IM) injection into the hind legs with 0.5 mL of the vaccine emulsion, which contained the conjugate equivalent to 200 μg of the FSHβ13AA-T peptide. The control group mice were administered a placebo injection consisting of all vaccine components except the FSHβ13AA-T-OVA conjugate. Serum samples for anti-FSH antibody titer quantification were collected from the tail tip every four weeks. At 15 weeks of age, all mice were deeply anesthetized with isoflurane (Fluriso; VetOne, Boise, ID, USA) and euthanized by decapitation.

After sacrifice, brains were immediately excised, and the hypothalamus and pituitary were isolated. Both testes were excised, dissected free of epididymides, and weighed as a pair. The hypothalamus, pituitary and one half of the right testis were immediately frozen in liquid nitrogen and stored at −80 °C for RT-qPCR analysis of gene expressions, and the remaining half testis was fixed in Bouin’s solution for histology evaluation. The other testis was used for daily sperm production and motility testing as described in below section.

2.2.2. Experiment 2: Effects of FSHβ13AA-T Vaccination on the Libido and Fertility of Male Mice

Thirty male mice (8 weeks old, with analogous body weights) were randomly divided into two groups (n = 15 per group): the FSH-immunized group and the control group. Mice in the FSH-immunized group received the primary vaccination at 8 weeks of age, with a booster immunization administered at 12 weeks of age (consistent with the primary vaccination in terms of administration route and dosage). For each immunization, each mouse received an intramuscular (IM) injection into the hind legs with 0.5 mL of the vaccine emulsion, wherein the conjugate content was equivalent to 200 μg of the FSHβ13AA-T peptide. The 15 mice in the control group were given placebo injections, which included all components of the vaccine emulsion except the FSHβ13AA-T-OVA conjugate. Four weeks following the booster vaccination, a mating study was conducted on both the FSH-immunized and control male mice to evaluate their fertility. Each male mouse was caged with one female mouse of confirmed fertility for a 2-week cohabitation period, after which the male mice were removed from the breeding cages. Latency to impregnate a female (reflecting libido of male mice) and litter size were recorded. And, if the male was fertile, the body weight of their offspring from birth to weaning was recorded weekly to check whether paternal FSH vaccination had adverse effects on progeny health.

2.3. Daily Sperm Production

The left testes were dissected, weighed and stored at −20 °C until use. Daily sperm production (DSP) was assayed as described previously [16] with minor modifications. Namely, the left testis of each mouse was homogenized in 500 µL DSP buffer (0.9% NaCl, 0.01% NaN₃ and 0.05 (v/v) Triton X-100 in water). Each sample was further diluted 1:4 in DSP buffer. Ten-microliter diluted samples were loaded on the hemocytometer, and the elongated spermatids were counted for each testis. The counts obtained from five chambers were averaged to yield the final spermatid count. DSP was calculated by dividing the total number of elongated spermatids per testis by 4.84, which corresponds to the duration (in days) that developing spermatids reside in stages 14–16 of mouse spermatogenesis [17].

2.4. Sperm Motility Testing

The computer-assisted sperm motility analysis (CASA) system (HT CASA-Ceros II; Hamilton Thome, Beverly, MA, USA) was used to evaluate sperm motility [18]. Briefly, the left epididymis of each mouse was immediately dissected and placed in mineral oil pre-warmed at 37 °C when mice were sacrificed. And the sperm were back-flushed from the cauda epididymis of each mouse into 2 mL of equilibrated modified Tyrode’s (MT6) medium [16] by incubating for 90 min in an incubator at 37 °C with 5% CO₂. After 90 min incubation, a 5 μL aliquot of each sample was placed on the analyzer’s Makler chamber maintained at 37 °C during the analysis. Sperm tracks (0.5 s, 45 frames) were captured at 60 Hz using a CASA system. Total motility of sperm was recorded and analyzed.

2.5. Serum Antibody Titer and Hormones Assays

Circulating anti-FSH antibody titers were determined using an enzyme-linked immunosorbent assay (ELISA) exactly the same as our previous descriptions [15]. Serum LH (MBS041300), testosterone (MBS494055), inhibin B (MBS163902) and 17β-estradiol (MBS843418) levels were assayed using commercially available enzyme-linked immunosorbent assay kits (MyBioSource, San Diego, CA, USA), according to the manufacturer’s instructions. The sensitivity is 0.1 mIU/mL for LH, 0.066 ng/mL for testosterone, 0.24 ng/L for inhibin B, and 0.002 ng/mL for 17β-estradiol.

2.6. Testis Histology Analysis

For checking the impacts of FSH vaccination on testicular spermatogenesis, testis tissues were fixed in 10% buffered formalin solution, dehydrated in ethanol and then embedded in paraffin wax, sectioned (5 μm), and stained with hematoxylin and eosin (H & E) for histologic analysis.

2.7. Quantitative Analysis of mRNA Expression

Total RNA was extracted from mouse testis, pituitary, and hypothalamus tissues using a commercial kit (Invitrogen Co., Carlsbad, CA, USA) in strict accordance with the manufacturer’s recommended protocols. The quantity and quality of the isolated RNA were evaluated via two approaches: the absorbance ratio at 260 nm/280 nm (for quantitative assessment) and agarose gel electrophoresis (for qualitative verification). A total of 500 ng of RNA per sample was reverse-transcribed into first-strand cDNA using the PrimeScript^® RT reagent kit with gDNA Eraser (TaKaRa Bio Co., Ltd., Dalian, China), which effectively eliminates genomic DNA contamination. Quantitative real-time PCR (qPCR) was performed on a CFX96 Real-Time PCR Detection System (Bio-Rad, Hercules, CA, USA). The 20 μL PCR reaction mixture consisted of 1 μL cDNA template, 500 nmol/L each of forward and reverse primers, and 10 μL of 2× SYBR^® Premix Taq™ (TaKaRa Bio Co., Ltd., Dalian, China). The sequences of primers targeting the genes of interest and the reference gene are listed in

Table 1. qPCR primer sequences for tissue genes.

Gene	Genbank Accession No.	Primer Sequence (5′-3′)	Amplification Length (bp)
Fshr	NM_013523.3	F: GTGCATTCAACGGAACCCAG R: TCTAAGCCATGGTTGGGCAG	154
Inh α	X69618.1	F: TGAACCAGAGGAGGAAGATGTCTC R: TCTGGCAGCTGGCTGGTC	82
Lhr	M81310.1	F: CTGAAAACTCTGCCCTCCAG R: AATCGTAATCCCAGCCACTG	281
Star	NM_011485.5	F: TCCCTCGCAGGACCTTGATCT R: TGGATGGGTCAAGTTCGACG	337
Cyp11a1	AF195119.1	F: AGGTCCTTCAATGAGATCCCTT R: TCCCTGTAAATGGGGCCATAC	131
Hsd3b1	AK147114.1	F: GCGGCTGCTGCACAGGAATA R: GACGCATGCCTGCTTCGTGA	99
Cyp17a1	NM_007809.3	F: GATCGGTTTATGCCTGAGCG R: TCCGAAGGGCAAATAACTGG	81
Cyp19a1	BC103670.1	F: CGGGCTACGTGGATGTGTT R: GAGCTTGCCAGGCGTTAAAG	135
Creb	X67728.1	F: ACTGGCTTGGCACAACCAGA R: GGCAGAAGTCTCTTCATGATT	202
Gata1	NM_008089.2	F: AGCATCAGCACTGGCCTACT R: AGGCCCAGCTAGCATAAGGT	125
Phox5	NM_008818.2	F: AATGGAAATCCTGGGGGTAG R: CACACAGGCATCCATCAGTC	147
Tjp1	NM_009386.2	F: GTCTGCCATTACACGGTCCT R: TGGAGATGAGGCTTCTGCTT	172
Eppin	NM_029325.2	F: GGCTGCCAAGGAAACAATAA R: TGGAGCAGAAGCCAAATTCT	127
Wnt2	NM_023653.5	F: GCTGAAGTCCTGCTCCTGTG R: CGGTTGTTGTGGAGGTTCAT	183
Ar	NM_013476.4	F: GGCAGTCATTCAGTATTCC R: AGTAGAGCATCCTAGAGTTG	89
Drd4	NM_007878.3	F: CGTCTCTGTGACACGCTCAT R: CACTGACCCTGCTGGTTGTA	131
Aqp8	AF018952.1	F: TTGCTACCTTGGGGAACATC R: CCAAATAGCTGGGAGATCCA	121
Klf4	JF277566.1	F: TGGTGCAGCTTGCAGCAGT R: TGGGTTAGCGAGTTGGAAAGG	108
Nectin2	NM_001159724.1	F: AGTGACCTGGCTCAGAGTCA R: TAGGTACCAGTTGTCATCAT	367
Hey1	NM_010423.2	F: GGGACAGAGATCGGAGCTTTCT R: GCGACTTTAGGGTGGTGTTGAC	108
Cmtm2a	NM_027022.4	F: ATGGAAGCGGCAATCTGCAT R: ATGCCACCTCCAAGGAACAC	134
Spata19	BC049742.1	F: GTCCATCAACGACTCTCCCAC R: TACGGGTGTGGCTCCATCTTA	158
Gnrh	BC116899.1	F: GGGAAAGAGAAACACTGAACAC R: AGTACATTCGAAGTGCTGGG	94
Gnrhr	L01119.1	F: TCAGCATTGTCTTTGCAGGA R: TCACACATTGCGAGAAGACTG	93
Lhb	NM_008497.2	F: CCAGTCTGCATCACCTTCAC R: GAGGCACAGGAGGCAAAG	91
Fshb	NM_008045.3	F: TTCAGCTTTCCCCAGAAGAG R: TCCAGCACCAGAATAAGATGC	104
18S	NR_003278.3	F: TGACTCAACACGGGAAACCT R: AACCAGACAAATCGCTCCAC	125

Abbreviations: Fshr, follicle-stimulating hormone receptor; Inh α, inhibit alpha subunit; Lhr, luteinizing hormone receptor; Star, Steroidogenic acute regulatory protein; Cyp11a1, cytochrome P450 side chain cleavage enzyme 11a1; Hsd3b1, hydroxy-delta-5-steroid dehydrogenase, 3 beta- and steroid delta-isomerase 1; Cyp17a1, cytochrome P450, family 17, subfamily a, polypeptide 1; Cyp19a1, cytochrome P450, family 19, subfamily a, polypeptide 1; Creb, cAMP response element-binding protein; Gata1, GATA binding protein 1; Rhox5, reproductive homeobox 5; Tjp1, tight junction protein 1; Eppin, epididymal peptidase inhibitor; Wnt2, wingless-type MMTV integration site family, member 2; Ar, androgen receptor; Drd4, dopamine receptor D4; Aqp8, aquaporin 8; Klf4, Kruppel-like factor 4; Nectin2, nectin cell adhesion molecule 2; Hey1, hairy/enhancer-of-split related with YRPW motif 1; Cmtm2a, CKLF-like MARVEL transmembrane domain containing 2A; Spata19, spermatogenesis-associated protein 19; Gnrh, Gonadotropin-releasing hormone; Gnrhr, gonadotropin-releasing hormone receptor; Lhb, luteinizing hormone β subunit; Fshb, follicle-stimulating hormone β subunit; 18S, 18S ribosomal RNA.

. The qPCR cycling program was set as follows: initial denaturation at 95 °C for 1 min, followed by 40 cycles of denaturation at 95 °C for 5 s and annealing at 60 °C for 25 s; a final melting curve analysis was conducted to confirm the specificity of the PCR products. The 18S ribosomal RNA (18S rRNA) gene was used as the housekeeping reference gene for normalizing gene expression levels across samples. The relative fold change in mRNA expression between the treatment and control groups was calculated using the 2^−ΔΔCt method.

2.8. Statistical Analysis

Sample size calculation and power analysis were performed using G*Power 3.1 software. A priori power analysis for two-tailed t-tests was conducted with an effect size of 0.8, a type I error rate (α) of 0.05, and a power (1−β) of 0.90. The calculated sample sizes were n = 10 for Experiment 1 and n = 15 for Experiment 2, which were sufficient to detect biologically relevant differences in the present study. All experimental data were analyzed using the Statistical Analysis System (SAS) Version 9.2 (SAS Institute Inc., Cary, NC, USA). The effects of the treatment group on serum antibody titers and body weight profile were assessed via a mixed-models analysis of variance (ANOVA). The statistical model incorporated fixed effects of treatment, sampling occasion/body weight measurement time and their interaction, as well as random effects of individual mice nested within the treatment group. Given the repeated nature of serum analyses and body weight monitoring, sampling occasion or body weight measurement time was included as a repeated measure using the REPEATED statement, with various covariance structure alternatives tested. The model with the smallest Akaike’s Information Criterion (AIC) value was selected for final analysis. For serum anti-FSH antibody titers, the Autoregressive order 1 covariance structure was adopted; for body weight growth profile, the Variance Components covariance structure was used. All remaining parameters were analyzed using the unpaired 2-tailed Student’s t test. Prior to statistical analysis, all data were subjected to normality testing via the PROC UNIVARIATE procedure with the NORMAL statement in SAS. Serum anti-FSH antibody titers were log-transformed to achieve normal distribution, and back-transformed means (without correction) are reported. Differences were considered statistically significant at p < 0.05. All data are presented as mean ± standard deviation (SD).

3. Results

3.1. FSHβ13AA-T Vaccination Triggered a Good Antibody Response in Male Mice

The male mice were immunized against the conserved FSH receptor-binding sequence of the FSH β subunit (Figure 1A), and the serum anti-FSH antibody titers were monitored during the treatment. Compared to the placebo-immunized males, vaccination of male mice with our newly developed FSH vaccine triggered a good antibody response, especially after the booster vaccination (p < 0.05; Figure 1B), while the body weight profile of male mice was not affected by FSH immunization (p > 0.05; Figure 1C).

3.2. FSHβ13AA-T Vaccination Reduced Serum FSH, Inhibin B and 17β-Estradiol Levels in Male Mice

Serum Inhibin B, 17β-estradiol, and LH as well as testosterone concentrations were determined at decapitation. In response to the sharp increase in serum FSH specific antibody titters, serum levels of inhibin B and 17β-estradiol were substantially decreased in FSH-immunized males compared to placebo-immunized controls at decapitation (p < 0.05; Figure 2A,B). In contrast, FSH vaccination had minimal effects on serum levels of LH and testosterone of male mice at decapitation (Figure 2C,D).

3.3. FSHβ13AA-T Vaccination Decreased Daily Sperm Production and Sperm Motility but Had No Effects on Fertility of Male Mice

Compared to placebo-immunized controls, FSHβ13AA-T vaccination had no effects on either paired testis or epididymis weight (p > 0.05; Figure 3A,B). Additionally, no difference in testis gross morphology was observed between placebo-immunized controls and FSH-immunized mice, but FSH vaccination obviously reduced the production of mature elongated spermatids (Figure 3C; arrows mark germ cells). Indeed, daily testis sperm production (DSP), as directly quantified using a hemocytometer, was significantly reduced by 10.61% following FSH vaccination (p < 0.05; Figure 3D). In addition, total sperm motility and progressive motility were also markedly decreased by 14% and 20%, respectively, in male mice after FSH immunization (p < 0.05; Figure 3E).

3.4. FSHβ13AA-T Vaccination Downregulated Gene Expression Involved in Testicular Spermatogenesis and Sperm Activity

To elucidate the mechanism of FSH vaccination on male reproductive function, we detected mRNA expression changes of key reproduction-associated genes in the hypothalamic–pituitary–testis axis by quantitative reverse-transcription PCR (RT-qPCR). In the hypothalamus and pituitary gland, compared to placebo-immunized males, FSHβ13AA-T vaccination had minimal effects on mRNA expressions of hypothalamic Gnrh (p > 0.05; Figure 4A) and pituitary Gnrhr, Fshb and Lhb (p > 0.05; Figure 4B). In testes, in parallel with no alterations in serum testosterone, FSH vaccination had no effects on mRNA expressions of genes involved in androgen biosynthesis including Lhr, Star, Hsd3b1 and Cyp17a1 (p > 0.05; Figure 4C). In contrast, FSH vaccination markedly decreased (p < 0.05) mRNA expressions of aromatase gene, Cyp19a1, which was in accordance with the drop of serum 17β-estradiol in FSH-immunized males compared to controls. In accordance with the drop in daily sperm production and sperm motility, mRNA expressions of genes involved in testicular spermatogenesis and sperm motility including Inhα, Creb, Wnt2, Aqp8, Cmtm2a and Sptata19 were markedly downregulated by FSH vaccination (Figure 4C; p < 0.05). In addition, FSH vaccination also showed a trend to downregulate mRNA expression of Tjp1 and Hey1 in testis (p < 0.1).

3.5. FSHβ13AA-T Vaccination Exerted No Effects on Libido of Male Mice

Both the latency and capacity (as reflected by litter size) to impregnate a female were comparable between placebo-immunized controls and FSH-immunized males (p > 0.05; Figure 5A,B), indicating that FSH vaccination exerted no effects on the libido or fertility of male mice. And, vaccination of male mice against FSHβ13AA-T also had no effects on their offspring growth from birth to weaning (age of 21 days) (p > 0.05; Figure 5C).

3.6. Distinct Biological Responses to FSH Vaccination Between Human/Non-Human Primates and Mice

Rodents can complete spermatogenesis in the absence of FSH stimulation [4], whereas men harboring loss-of-function mutations in FSHβ exhibit azoospermia and infertility [3], indicating clear species differences in response to FSH intervention. To clarify these differences and guide the further development and clinical translation of FSH-based contraceptive vaccines in humans, we summarized the distinct biological responses to FSH vaccination between human/non-human primates and mice (

Table 2. Distinct biological responses to FSH vaccination between human/non-human primates and mice.

Parameters	Human/Non-Human Primates	Mouse
Spermatogenesis	Azoospermia/Oligospermia [5,6,7,8]	Oligospermia
Sperm activity	Deficient or reduced [5,6,7,8]	Reduced
Circulating LH	Not affected [5,6,7,8]	Not affected
Circulating testosterone	Not affected [5,6,7,8]	Not affected
Libido	Not affected [5,6,7,8]	Not affected
Fertility	Infertility/subfertility [5,6,7,8]	Not affected

). In general, FSH vaccination did not alter circulating LH or testosterone levels and thus did not affect male libido in human/non-human primates or mice. In stark contrast, FSH vaccination induced azoospermia and infertility in human/non-human primates, but it only caused oligospermia and reduced sperm motility in mice, with no impairment to overall fertility.

4. Discussion

Antifertility/contraceptive vaccines have been proposed for controlling population explosion and unintended pregnancies in humans, and for population management of domestic animals and wildlife [19,20]. Multiple components of the reproductive axis could be used as the targets to develop antifertility/contraceptive vaccines such as gonadotropin-releasing hormone (GnRH), LH, FSH, sex steroids, etc. [21]. Among those target hormones, FSH-based contraceptive vaccines have a unique advantage: they can block spermatogenesis and cause subfertility or infertility without compromising normal sexual function and libido [4,5,6,7,8,9]. Therefore, such vaccines would be ideal for contraception in men. However, to date, still no vaccine based on FSH has entered into practical application, largely due to lack of appropriate antigens [21,22].

In the present study, we confirmed that vaccination with a novel FSH vaccine based on a conserved short 13-amino acid receptor-binding epitope of FSHβ <LVYKDPARPNIQK> could efficiently inhibit spermatogenesis and reduce sperm motility in male mice. On the other hand, as a good marker of spermatogenesis [23], serum concentrations of inhibin B were also substantially decreased by FSH vaccination, reinforcing the impaired spermatogenesis in FSH-immunized males. This was identical to that observed in ovine FSH-vaccinated monkey and men [5,6,7,8,9], as well as FSHR-immunized male rats [24]. Additionally, as desired, LH and testosterone concentrations in circulation as well as the gene expression of GnRH in the hypothalamus, LHβ in the pituitary gland and steroidogenic genes in the testes were comparable between FSH-and placebo-immunized males. And, the weight of testis and epididymis, gross morphology of testis and latency to impregnate a female all remained changeless in male mice after FSHβ13AA-T vaccination. Those results indicate that vaccination of males with this novel FSH vaccine could indeed disrupt spermatogenesis but not compromise normal sexual function or libido in males.

FSH acts independently and also in concert with testosterone to stimulate Sertoli cells to nourish and maintain spermatogenesis [25]. To further illustrate the molecular mechanism by which FSHβ13AA-T vaccination disrupted spermatogenesis, we quantified the mRNA expression of genes involved in testicular steroidogenesis and spermatogenesis. For steroidogenesis, we found that FSHβ13AA-T vaccination did not affect any key genes involved in androgen biosynthesis (Star, Cyp11a1, HSD3β1 and Cyp17a1), which was also evidenced by no alterations in serum testosterone in male mice after FSH vaccination, as in agreement with previous studies using ovine FSH as immunogens [5,6,7,8,9]. In contrast, expression of Cyp19a1, which encodes aromatase, the enzyme responsible for converting androgens to estrogens, was substantially downregulated by FSHβ13AA-T vaccination. Indeed, serum 17β-estradiol concentrations in mice significantly declined after FSHβ13AA-T vaccination. It is not surprising that FSHβ13AA-T vaccination caused a sharp drop in estrogen in males, as previous studies have evidenced that FSH-stimulated Sertoli cells in testes are important and even primary sources of estrogen in males [26]. Testicular local expression of aromatase has been demonstrated to be essential for spermatogenesis, as spermatogenesis of male mice deficient in aromatase was arrested at early spermatogenic stages [27]. Thus, the downregulation of Cyp19a1 and decline in estrogen should be an important cause of disrupted spermatogenesis in FSH-immunized males. To the best of our knowledge, this is the first study to report that FSH vaccination caused disruption to spermatogenesis through suppressing testicular local estrogen production.

Excepting testicular local estrogen production, we also found that the mRNA expression of key genes involved in spermatogenesis and sperm motility including Creb, INHα, Aqp8, Tjp1, Cmtm2a, Hey1, Spata19 and Wnt2 were substantially downregulated in testes by FSHβ13AA-T vaccination. Of those, cAMP-responsive element-binding protein (Creb), as a transcription factor, plays a critical role in integrating and mediating multiple signaling pathways of FSH in regulating spermatogenesis [25]; Inha plays an important role in the formation of round spermatid [28]; Aqp8 is required for the differentiation of spermatids into spermatozoa during spermatogenesis [29]; Tjp1, encoding tight junction protein 1, participates in the development of the blood-testis barrier, which is essential for spermatogenesis [30]; Cmtm2 is essential for spermatogenesis, and mice deficient in Cmtm2 cannot produce sperm and are infertile [31]; and Hey1 acts as a transcriptional target of Notch signaling in Sertoli cells to regulate germ cell differentiation [32,33]. Downregulation of these genes should be associated with decreased bioactivities and/or levels of FSH, as Cre [25], INHα [25] and Wnt2 [34] are all FSH-dependent Sertoli cell genes, and Tjp1 [30] and Hey1 [33] are also Sertoli cell-expressed genes. Given the essential roles of these above genes in regulating spermatogenesis, their downregulation would certainly disrupt spermatogenesis in males, while Spata19 [35] and Wnt2 [34] were both reported to play important roles in regulating sperm motility. In particular, Spata19 exerts an essential role in regulating sperm mitochondria organization and function, and germ cell-specific knockout of Spata19 reduced sperm motility and caused infertility in male mice due to disorganized mitochondrial structure in sperm [35], suggesting the decline in sperm motility in males after FSH vaccination might be associated with dysfunction of sperm mitochondria. In contrast, the expression of androgen-dependent Sertoli cell genes such as Drd4, Rhox5 and Eppin [4] was unaffected by FSHβ13AA-T vaccination, reinforcing that FSH vaccination works mainly through blocking FSH signaling but not testosterone signaling to disrupt spermatogenesis/sperm motility in males.

One of the main functions of FSH in stimulating spermatogenesis is realized through promoting Sertoli cell proliferation in testes [2,36]. However, it has been established that FSH regulates Sertoli cell proliferation only during fetal and early postnatal life [36], suggesting that disrupted spermatogenesis in FSH-immunized mice was unlikely attributable to the decreased number of Sertoli cells in the testis. Thus, dysfunction of Sertoli cells appeared to be main cause of disrupted spermatogenesis in male mice following FSH vaccination. Indeed, FSH-dependent Sertoli cell genes, such as Cyp19a1 [26], Creb, INHα [25] and Wnt2 were downregulated, but androgen-dependent Sertoli cell genes such as Drd4, Rhox5 and Eppin [4] were unaffected by FSHβ13AA-T vaccination, also suggesting dysfunction but not decreased number of Sertoli cells in males following FSH vaccination.

Although it disrupted spermatogenesis and decreased sperm motility, FSHβ13AA-T vaccination did not cause subfertility or infertility in male mice in the present study. Unlike humans or non-human primate species [7,8,9,37], it has been evidenced that rodents are able to complete spermatogenesis without FSH stimulus [4]; thus, our novel FSH vaccine immunization did not cause infertility in male mice. However, men carrying loss-of-function mutations of FSHβ were azoospermic and infertile [3], and men and non-human primates with FSH vaccination were oligospermia and infertile [8,9]. Therefore, this novel FSHβ-13AA–based vaccine theoretically retains potential as a male contraceptive or antifertility vaccine in humans and other species in which FSH is indispensable for spermatogenesis and fertility, although further validation is required. Furthermore, additional studies focusing on its immunogenicity, reversibility, and safety are warranted, as these are key prerequisites for a human contraceptive vaccine. Finally, although the present study employed immunization as a proof-of-concept strategy, clinical application would likely benefit from more convenient delivery routes, such as oral or topical administration, rather than injectable vaccination. Future studies may explore the feasibility of developing non-invasive formulations to improve safety, patient compliance, and clinical practicality for male contraception.

5. Conclusions

In summary, our results clearly show that vaccination with the novel FSH vaccine based on a conserved short 13-amino acid receptor-binding epitope of FSHβ <LVYKDPARPNIQK> could disrupt spermatogenesis and reduce sperm motility, without compromising normal sexual function and libido in males. Given that FSH is not mandatory for the completion of spermatogenesis in rodents, mice are suboptimal for assessing the contraceptive efficacy of our novel FSH vaccine. Nevertheless, this model remains highly informative for mechanistic dissection. Further studies are needed to confirm the contraceptive effects of this vaccine in relevant target species, such as humans and other animals in which FSH is essential for spermatogenesis and fertility.