Enhanced Immunogenicity of Foot-and-Mouth Disease Virus-like Particles Using a Water-in-Oil-in-Water Adjuvant
Abstract
:1. Introduction
2. Materials and Methods
2.1. Materials
2.2. Vaccine Preparation
2.3. Physical and Chemical Property Evaluation
2.4. Mice Immunization
2.5. Safety Assay
2.6. Detection of Antibodies and Cytokines
2.7. Lymphoproliferation Assay
2.8. Flow Cytometry Analysis
2.9. Western Blot
2.10. Transcriptome Sequencing
2.11. Validation of Gene Expression by RT-qPCR
2.12. Statistical Analysis
3. Results
3.1. Characterization of VLPs+WT Vaccine
3.2. Safety Assessment
3.3. Evaluation of IgG and Cytokine Responses
3.4. Activation of Splenic T Cells
3.5. Induction of PI3K-AKT and NF-κB Signaling Pathways
3.6. Differentially Expressed Genes (DEGs) and Functional Enrichment Analysis
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Diaz-San Segundo, F.; Medina, G.N.; Stenfeldt, C.; Arzt, J.; de Los Santos, T. Foot-and-mouth disease vaccines. Vet. Microbiol. 2017, 206, 102–112. [Google Scholar] [CrossRef] [PubMed]
- Jamal, S.M.; Belsham, G.J. Foot-and-mouth disease: Past, present and future. Vet. Res. 2013, 44, 116. [Google Scholar] [CrossRef] [PubMed]
- Weaver, G.V.; Domenech, J.; Thiermann, A.R.; Karesh, W.B. Foot and mouth disease: A look from the wild side. J. Wildl. Dis. 2013, 49, 759–785. [Google Scholar] [CrossRef] [PubMed]
- Stenfeldt, C.; Pacheco, J.M.; Rodriguez, L.L.; Arzt, J. Infection dynamics of foot-and-mouth disease virus in pigs using two novel simulated-natural inoculation methods. Res. Vet. Sci. 2014, 96, 396–405. [Google Scholar] [CrossRef]
- Knight-Jones, T.J.D.; Rushton, J. The economic impacts of foot and mouth disease—What are they, how big are they and where do they occur? Prev. Vet. Med. 2013, 112, 161–173. [Google Scholar] [CrossRef]
- Kamel, M.; El-Sayed, A.; Castañeda Vazquez, H. Foot-and-mouth disease vaccines: Recent updates and future perspectives. Arch. Virol. 2019, 164, 1501–1513. [Google Scholar] [CrossRef]
- Mignaqui, A.C.; Ruiz, V.; Durocher, Y.; Wigdorovitz, A. Advances in novel vaccines for foot and mouth disease: Focus on recombinant empty capsids. Crit. Rev. Biotechnol. 2019, 39, 306–320. [Google Scholar] [CrossRef]
- Blanco, E.; Guerra, B.; de la Torre, B.G.; Defaus, S.; Dekker, A.; Andreu, D.; Sobrino, F. Full protection of swine against foot-and-mouth disease by a bivalent B-cell epitope dendrimer peptide. Antivir. Res. 2016, 129, 74–80. [Google Scholar] [CrossRef]
- Duan, X.; Sun, P.; Lan, Y.; Shen, C.; Zhang, X.; Hou, S.; Chen, J.; Ma, B.; Xia, Y.; Su, C. IFN-α Modulates Memory Tfh Cells and Memory B Cells in Mice, Following Recombinant FMDV Adenoviral Challenge. Front. Immunol. 2020, 11, 701. [Google Scholar] [CrossRef]
- Fernandez-Sainz, I.; Medina, G.N.; Ramirez-Medina, E.; Koster, M.J.; Grubman, M.J.; de los Santos, T. Adenovirus-vectored foot-and-mouth disease vaccine confers early and full protection against FMDV O1 Manisa in swine. Virology 2017, 502, 123–132. [Google Scholar] [CrossRef]
- Bidart, J.; Mignaqui, A.; Kornuta, C.; Lupi, G.; Gammella, M.; Soria, I.; Galarza, R.; Ferella, A.; Cardillo, S.; Langellotti, C.; et al. FMD empty capsids combined with the Immunostant Particle Adjuvant -ISPA or ISA206 induce protective immunity against foot and mouth disease virus. Virus Res. 2021, 297, 198339. [Google Scholar] [CrossRef] [PubMed]
- Donaldson, B.; Lateef, Z.; Walker, G.F.; Young, S.L.; Ward, V.K. Virus-like particle vaccines: Immunology and formulation for clinical translation. Expert Rev. Vaccines 2018, 17, 833–849. [Google Scholar] [CrossRef] [PubMed]
- Qian, C.; Liu, X.; Xu, Q.; Wang, Z.; Chen, J.; Li, T.; Zheng, Q.; Yu, H.; Gu, Y.; Li, S.; et al. Recent progress on the versatility of virus-Like particles. Vaccines 2020, 8, 139. [Google Scholar] [CrossRef] [PubMed]
- Kim, W.S.; Zhi, Y.; Guo, H.; Byun, E.-B.; Lim, J.H.; Seo, H.S. Promotion of cellular and humoral immunity against foot-and-mouth disease virus by immunization with virus-like particles encapsulated in monophosphoryl lipid A and liposomes. Vaccines 2020, 8, 633. [Google Scholar] [CrossRef]
- Teng, Z.; Sun, S.; Chen, H.; Huang, J.; Du, P.; Dong, H.; Xu, X.; Mu, S.; Zhang, Z.; Guo, H. Golden-star nanoparticles as adjuvant effectively promotes immune response to foot-and-mouth disease virus-like particles vaccine. Vaccine 2018, 36, 6752–6760. [Google Scholar] [CrossRef]
- Teng, Z.; Hou, F.; Bai, M.; Li, J.; Wang, J.; Wu, J.; Ru, J.; Ren, M.; Sun, S.; Guo, H. Bio-mineralization of virus-like particles by metal-organic framework nanoparticles enhances the thermostability and immune responses of the vaccines. J. Mater. Chem. B 2022, 10, 2853–2864. [Google Scholar] [CrossRef]
- Yang, K.; Song, H.; Shi, X.; Ru, J.; Tan, S.; Teng, Z.; Dong, H.; Guo, H.; Wei, F.; Sun, S. Preparation of a polysaccharide adjuvant and its application in the production of a foot-and-mouth disease virus-like particles vaccine. Biochem. Eng. J. 2022, 184, 108479. [Google Scholar] [CrossRef]
- Shi, X.; Yang, K.; Song, H.; Teng, Z.; Zhang, Y.; Ding, W.; Wang, A.; Tan, S.; Dong, H.; Sun, S.; et al. Development and efficacy evaluation of a novel nano-emulsion adjuvant for a foot-and-mouth disease virus-like particles vaccine based on squalane. Nanomaterials 2022, 12, 3934. [Google Scholar] [CrossRef]
- O’Hagan, D.T.; van der Most, R.; Lodaya, R.N.; Coccia, M.; Lofano, G. “World in motion”—Emulsion adjuvants rising to meet the pandemic challenges. npj Vaccines 2021, 6, 158. [Google Scholar] [CrossRef]
- Lin, X.; Yang, Y.; Li, S.; Li, Z.; Sheng, Y.; Su, Z.; Zhang, S. Oil-in-ionic liquid nanoemulsion-based adjuvant simultaneously enhances the stability and immune responses of inactivated foot-and-mouth disease virus. Int. J. Pharm. 2022, 625, 122083. [Google Scholar] [CrossRef]
- Khorasani, A.; Madadgar, O.; Soleimanjahi, H.; Keyvanfar, H.; Mahravani, H. Evaluation of the efficacy of a new oil-based adjuvant ISA 61 VG FMD vaccine as a potential vaccine for cattle. Iran. J. Vet. Res. 2016, 17, 8–12. [Google Scholar] [PubMed]
- Cao, Y. Adjuvants for foot-and-mouth disease virus vaccines: Recent progress. Expert Rev. Vaccines 2014, 13, 1377–1385. [Google Scholar] [CrossRef]
- Chen, Z.; Zhang, S.; Li, Z.; Ma, G.; Su, Z. Construction of a stable w/o nano-emulsion as a potential adjuvant for foot and mouth disease virus vaccine. Artif. Cells Nanomed. Biotechnol. 2016, 45, 897–906. [Google Scholar] [CrossRef]
- Ibrahim, E.E.-S.; Gamal, W.M.; Hassan, A.I.; Mahdy, S.E.-D.; Hegazy, A.Z.; Abdel-Atty, M.M. Comparative study on the immunopotentiator effect of ISA 201, ISA 61, ISA 50, ISA 206 used in trivalent foot and mouth disease vaccine. Vet. World 2015, 8, 1189. [Google Scholar] [CrossRef]
- Dar, P.; Kalaivanan, R.; Sied, N.; Mamo, B.; Kishore, S.; Suryanarayana, V.V.; Kondabattula, G. Montanide ISA 201 adjuvanted FMD vaccine induces improved immune responses and protection in cattle. Vaccine 2013, 31, 3327–3332. [Google Scholar] [CrossRef]
- Li, D.; Zhou, C.; She, D.; Li, P.; Sun, P.; Bai, X.; Chen, Y.; Xie, B.; Liu, Z. The comparison of the efficacy of swine FMD vaccine emulsified with oil adjuvant of ISA 201 VG or ISA 206 VG. J. Biosci. Med. 2013, 1, 22–25. [Google Scholar] [CrossRef]
- Zhou, Y.; Lu, Y.; Xu, Z.; Tang, J.; Qian, Y.; Deng, B. Effect of W/O/W adjuvant added with two immunopotentiator on inactivated foot-and-mouth disease vaccine. Chin. Vet. Sci. 2024, 54, 300–307. [Google Scholar] [CrossRef]
- Guo, H.-C.; Sun, S.-Q.; Jin, Y.; Yang, S.-L.; Wei, Y.-Q.; Sun, D.-H.; Yin, S.-H.; Ma, J.-W.; Liu, Z.-X.; Guo, J.-H.; et al. Foot-and-mouth disease virus-like particles produced by a SUMO fusion protein system in Escherichia coli induce potent protective immune responses in guinea pigs, swine and cattle. Vet. Res. 2013, 44, 48. [Google Scholar] [CrossRef]
- Golde, W.T.; Pacheco, J.M.; Duque, H.; Doel, T.; Penfold, B.; Ferman, G.S.; Gregg, D.R.; Rodriguez, L.L. Vaccination against foot-and-mouth disease virus confers complete clinical protection in 7 days and partial protection in 4 days: Use in emergency outbreak response. Vaccine 2005, 23, 5775–5782. [Google Scholar] [CrossRef]
- Zhou, M.; Li, Y.; Chen, X.; Zhou, H.; Yang, S.; Qu, X. Preparation and characterization of polyoxyethylene dehydrated mannitol mono oleate as hydrophilic emulsifier potentially used in w/o/w type adjuvants. J. Dispers. Sci. Technol. 2019, 42, 614–621. [Google Scholar] [CrossRef]
- Xu, H.; Niu, Y.; Hong, W.; Liu, W.; Zuo, X.; Bao, X.; Guo, C.; Lu, Y.; Deng, B. Development of a water-in-oil-in-water adjuvant for foot-and-mouth disease vaccine based on ginseng stem-leaf saponins as an immune booster. Comp. Immunol. Microbiol. Infect. Dis. 2020, 71, 101499. [Google Scholar] [CrossRef] [PubMed]
- Tadros, T.; Izquierdo, P.; Esquena, J.; Solans, C. Formation and stability of nano-emulsions. Adv. Colloid Interface Sci. 2004, 108–109, 303–318. [Google Scholar] [CrossRef] [PubMed]
- Ke, X.; Howard, G.P.; Tang, H.; Cheng, B.; Saung, M.T.; Santos, J.L.; Mao, H.-Q. Physical and chemical profiles of nanoparticles for lymphatic targeting. Adv. Drug Deliv. Rev. 2019, 151–152, 72–93. [Google Scholar] [CrossRef] [PubMed]
- Howard, G.P.; Verma, G.; Ke, X.; Thayer, W.M.; Hamerly, T.; Baxter, V.K.; Lee, J.E.; Dinglasan, R.R.; Mao, H.-Q. Critical size limit of biodegradable nanoparticles for enhanced lymph node trafficking and paracortex penetration. Nano Res. 2019, 12, 837–844. [Google Scholar] [CrossRef]
- Ko, E.Y.; Jung, S.; Jeong, H.K.; Han, J.H.; Son, J.H. Effects of foot-and-mouth disease vaccination location and injection device on the incidence of site lesions in pork. Korean J. Food. SCI. An. 2018, 38, 498–505. [Google Scholar] [CrossRef]
- Kuroda, E.; Coban, C.; Ishii, K.J. Particulate Adjuvant and Innate Immunity: Past Achievements, Present Findings, and Future Prospects. Int. Rev. Immunol. 2013, 32, 209–220. [Google Scholar] [CrossRef]
- Gnazzo, V.; Quattrocchi, V.; Soria, I.; Pereyra, E.; Langellotti, C.; Pedemonte, A.; Lopez, V.; Marangunich, L.; Zamorano, P. Mouse model as an efficacy test for foot-and-mouth disease vaccines. Transbound. Emerg. Dis. 2020, 67, 2507–2520. [Google Scholar] [CrossRef]
- Batista, A.; Quattrocchi, V.; Olivera, V.; Langellotti, C.; Pappalardo, J.; Di Giacomo, S.; Mongini, C.; Portuondo, D.; Zamorano, P. Adjuvant effect of Cliptox™ on the protective immune response induced by an inactivated vaccine against foot and mouth disease virus in mice. Vaccine 2010, 28, 6361–6366. [Google Scholar] [CrossRef]
- Godfrey, D.I.; Uldrich, A.P.; McCluskey, J.; Rossjohn, J.; Moody, D.B. The burgeoning family of unconventional T cells. Nat. Immunol. 2015, 16, 1114–1123. [Google Scholar] [CrossRef]
- Zhou, C.-X.; Li, D.; Chen, Y.-L.; Lu, Z.-J.; Sun, P.; Cao, Y.-M.; Bao, H.-F.; Fu, Y.-F.; Li, P.-H.; Bai, X.-W.; et al. Resiquimod and polyinosinic–polycytidylic acid formulation with aluminum hydroxide as an adjuvant for foot-and-mouth disease vaccine. BMC Veter.-Res. 2014, 10, 2. [Google Scholar] [CrossRef]
- Yuan, L.; Wang, Y.; Ma, X.; Cui, X.; Lu, M.; Guan, R.; Chi, X.; Xu, W.; Hu, S. Sunflower seed oil combined with ginseng stem-leaf saponins as an adjuvant to enhance the immune response elicited by Newcastle disease vaccine in chickens. Vaccine 2020, 38, 5343–5354. [Google Scholar] [CrossRef] [PubMed]
- Woyach, J.A.; Johnson, A.J.; Byrd, J.C. The B-cell receptor signaling pathway as a therapeutic target in CLL. Blood 2012, 120, 1175–1184. [Google Scholar] [CrossRef] [PubMed]
- Khezri, M.R. PI3K/AKT signaling pathway: A possible target for adjuvant therapy in COVID-19. Hum. Cell 2021, 34, 700–701. [Google Scholar] [CrossRef] [PubMed]
Gene | Primer Sequence (5′ to 3′) |
---|---|
Ifit1 | F: CTGAGATGTCACTTCACATGGAA |
R: GTGCATCCCCAATGGGTTCT | |
Ifit3 | F: CCTACATAAAGCACCTAGATGGC |
R: ATGTGATAGTAGATCCAGGCGT | |
Ifih1 | F: ACTTGCTTCGAGAAGGGACTA |
R: AGCTCTCTTACACCTGACTCATT | |
Ifi202b | F: GACCCCTTCCAGTGATTCATCT |
R: ACAGCACCTTTGCTAATGTTCT | |
Ifi204 | F: GACAACCAAGAGCAATACACCA |
R: ATCAGTTTGCCCAATCCAGAAT | |
Irf7 | F: GAGACTGGCTATTGGGGGAG |
R: GACCGAAATGCTTCCAGGG | |
Oas2 | F: TTGAAGAGGAATACATGCGGAAG |
R: GGGTCTGCATTACTGGCACTT | |
Oas1a | F: GCCTGATCCCAGAATCTATGC |
R: GAGCAACTCTAGGGCGTACTG | |
Oas3 | F: TCTGGGGTCGCTAAACATCAC |
R: GATGACGAGTTCGACATCGGT | |
Oasl1 | F: CAGGAGCTGTACGGCTTCC |
R: CCTACCTTGAGTACCTTGAGCAC | |
Gapdh | F: AGGTCGGTGTGAACGGATTTG |
R: TGTAGACCATGTAGTTGAGGTCA |
Day Post-Immunization | PBS | VLPs | VLPs+WT | VLPs+201 |
---|---|---|---|---|
0 | 21.49 ± 0.26 | 20.94 ± 0.27 | 21.18 ± 0.18 | 21.11 ± 0.18 |
7 | 22.20 ± 0.21 | 22.29 ± 0.23 | 22.42 ± 0.19 | 22.25 ± 0.24 |
14 | 22.81 ± 0.16 | 22.94 ± 0.20 | 23.08 ± 0.19 | 23.03 ± 0.12 |
21 | 23.33 ± 0.25 | 23.40 ± 0.21 | 23.58 ± 0.27 | 23.48 ± 0.08 |
28 | 23.62 ± 0.10 | 23.81 ± 0.28 | 23.88 ± 0.20 | 24.00 ± 0.23 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Zhou, Y.; Yin, W.; Teng, Z.; Zhao, Y.; Lu, Y.; Qian, Y.; Deng, B. Enhanced Immunogenicity of Foot-and-Mouth Disease Virus-like Particles Using a Water-in-Oil-in-Water Adjuvant. Vaccines 2025, 13, 24. https://doi.org/10.3390/vaccines13010024
Zhou Y, Yin W, Teng Z, Zhao Y, Lu Y, Qian Y, Deng B. Enhanced Immunogenicity of Foot-and-Mouth Disease Virus-like Particles Using a Water-in-Oil-in-Water Adjuvant. Vaccines. 2025; 13(1):24. https://doi.org/10.3390/vaccines13010024
Chicago/Turabian StyleZhou, Yujie, Wenzhu Yin, Zhidong Teng, Yanyan Zhao, Yu Lu, Yingjuan Qian, and Bihua Deng. 2025. "Enhanced Immunogenicity of Foot-and-Mouth Disease Virus-like Particles Using a Water-in-Oil-in-Water Adjuvant" Vaccines 13, no. 1: 24. https://doi.org/10.3390/vaccines13010024
APA StyleZhou, Y., Yin, W., Teng, Z., Zhao, Y., Lu, Y., Qian, Y., & Deng, B. (2025). Enhanced Immunogenicity of Foot-and-Mouth Disease Virus-like Particles Using a Water-in-Oil-in-Water Adjuvant. Vaccines, 13(1), 24. https://doi.org/10.3390/vaccines13010024