Eukarion-134 Attenuates Endoplasmic Reticulum Stress-Induced Mitochondrial Dysfunction in Human Skeletal Muscle Cells
Abstract
1. Introduction
2. Materials and Methods
2.1. Cell Culture and Treatments
2.2. RNA Isolation and Quantitative Real-Time Polymerase Chain Reaction (PCR)
2.3. Measurement of Mitochondrial Bioenergetics Using Seahorse Extracellular Flux Analyser
2.4. Quantification of Mitochondrial Morphology Parameters Using Confocal Microscopy
2.5. Measurement of ROS Generation and Oxidative Damage Markers
2.6. Assessment of Mitochondrial Membrane Potential
2.7. Measurement of Mitochondrial Mass/Volume
2.8. Immunofluorescence Staining
2.9. Western Blotting
2.10. Statistical Analyses
3. Results
3.1. ER Stress Pathway Activation
3.2. Mitochondrial Oxygen Consumption and Mitochondrial Unfolded Protein Response
3.3. Mitochondrial Membrane Potential and Mitochondrial Mass
3.4. Mitochondrial Morphology: Fusion and Fission Events
3.5. ROS Generation
4. Discussion
5. Conclusions
Author Contributions
Funding
Acknowledgments
Conflicts of Interest
References
- Walter, P.; Ron, D. The unfolded protein response: From stress pathway to homeostatic regulation. Science 2011, 334, 1081–1086. [Google Scholar] [CrossRef] [PubMed]
- Ellgaard, L.; Sevier, C.S.; Bulleid, N.J. How are proteins reduced in the endoplasmic reticulum? Trends Biochem. Sci. 2018, 43, 32–43. [Google Scholar] [CrossRef] [PubMed]
- Sicari, D.; Igbaria, A.; Chevet, E. Control of protein homeostasis in the early secretory pathway: Current status and challenges. Cells 2019, 8, 1347. [Google Scholar] [CrossRef] [PubMed]
- Senft, D.; Ze’ev, A.R. UPR, autophagy, and mitochondria crosstalk underlies the ER stress response. Trends Biochem. Sci. 2015, 40, 141–148. [Google Scholar] [CrossRef] [PubMed]
- Bhandary, B.; Marahatta, A.; Kim, H.R.; Chae, H.J. An involvement of oxidative stress in endoplasmic reticulum stress and its associated diseases. Int. J. Mol. Sci. 2012, 14, 434–456. [Google Scholar] [CrossRef]
- Xiang, C.; Wang, Y.; Zhang, H.; Han, F. The role of endoplasmic reticulum stress in neurodegenerative disease. Apoptosis 2017, 22, 1–26. [Google Scholar] [CrossRef]
- Pauly, M.; Angebault-Prouteau, C.; Dridi, H.; Notarnicola, C.; Scheuermann, V.; Lacampagne, A.; Matecki, S.; Fauconnier, J. ER stress disturbs SR/ER-mitochondria Ca2+ transfer: Implications in Duchenne muscular dystrophy. Biochim. Biophys. Acta Mol. Basis Dis. 2017, 1863, 2229–2239. [Google Scholar] [CrossRef]
- Hotamisligil, G.S. Endoplasmic reticulum stress and the inflammatory basis of metabolic disease. Cell 2010, 140, 900–917. [Google Scholar] [CrossRef]
- Nagaraju, K.; Casciola-Rosen, L.; Lundberg, I.; Rawat, R.; Cutting, S.; Thapliyal, R.; Chang, J.; Dwivedi, S.; Mitsak, M.; Chen, Y.W.; et al. Activation of the endoplasmic reticulum stress response in autoimmune myositis: Potential role in muscle fiber damage and dysfunction. Arthritis Rheum. 2005, 52, 1824–1835. [Google Scholar] [CrossRef]
- Cao, S.S.; Kaufman, R.J. Endoplasmic reticulum stress and oxidative stress in cell fate decision and human disease. Antioxid. Redox Signal. 2014, 21, 96–413. [Google Scholar] [CrossRef]
- Bravo, R.; Gutierrez, T.; Paredes, F.; Gatica, D.; Rodriguez, A.E.; Pedrozo, Z.; Chiong, M.; Parra, V.; Quest, A.F.; Rothermel, B.A.; et al. Endoplasmic reticulum: ER stress regulates mitochondrial bioenergetics. Int. J. Biochem. Cell Biol. 2012, 44, 16–20. [Google Scholar] [CrossRef] [PubMed]
- Bravo, R.; Vicencio, J.M.; Parra, V.; Troncoso, R.; Munoz, J.P.; Bui, M.; Quiroga, C.; Rodriguez, A.E.; Verdejo, H.E.; Ferreira, J.; et al. Increased ER–mitochondrial coupling promotes mitochondrial respiration and bioenergetics during early phases of ER stress. J. Cell Sci. 2011, 124, 2143–2152. [Google Scholar] [CrossRef] [PubMed]
- Jackisch, L.; Murphy, A.; Al-Daghri, N.; McTernan, P.; Randeva, H.; Tripathi, G. Tunicamycin-induced ER stress mediates mitochondrial dysfunction in human adipocytes. In Proceedings of the Society for Endocrinology BES 2016, Brighton, UK, 7–9 November 2016; Endocrine Abstracts: Bristol, UK, 2016; Volume 44, p. 193. [Google Scholar] [CrossRef]
- Madreiter-Sokolowski, C.T.; Waldeck-Weiermair, M.; Bourguignon, M.P.; Villeneuve, N.; Gottschalk, B.; Klec, C.; Stryeck, S.; Radulovic, S.; Parichatikanond, W.; Frank, S.; et al. Enhanced inter-compartmental Ca2+ flux modulates mitochondrial metabolism and apoptotic threshold during aging. Redox Biol. 2019, 20, 458–466. [Google Scholar] [CrossRef]
- Baker, K.; Marcus, C.B.; Huffman, K.; Kruk, H.; Malfroy, B.; Doctrow, S.R. Synthetic combined superoxide dismutase/catalase mimetics are protective as a delayed treatment in a rat stroke model: A key role for reactive oxygen species in ischemic brain injury. J. Pharmacol. Exp. Ther. 1998, 284, 215–221. [Google Scholar] [PubMed]
- Mamchaoui, K.; Trollet, C.; Bigot, A.; Negroni, E.; Chaouch, S.; Wolff, A.; Kandalla, P.K.; Marie, S.; Di Santo, J.; St Guily, J.L.; et al. Immortalized pathological human myoblasts: Towards a universal tool for the study of neuromuscular disorders. Skelet. Muscle 2011, 1, 34. [Google Scholar] [CrossRef]
- Wedgwood, S.; Black, S.M. Combined superoxide dismutase/catalase mimetics alter fetal pulmonary arterial smooth muscle cell growth. Antioxid. Redox Signal. 2004, 6, 191–197. [Google Scholar] [CrossRef] [PubMed]
- Zygmunt, D.A.; Singhal, N.; Kim, M.L.; Cramer, M.L.; Crowe, K.E.; Xu, R.; Jia, Y.; Adair, J.; Y Valenzuela, I.M.P.; Akaaboune, M.; et al. Deletion of Pofut1 in mouse skeletal myofibers induces muscle aging-related phenotypes in cis and in trans. Mol. Cell. Biol. 2017, 37, e00426-16. [Google Scholar] [CrossRef]
- Wang, J.; Tan, J.; Qi, Q.; Yang, L.; Wang, Y.; Zhang, C.; Hu, L.; Chen, H.; Fang, X. MiR-487b-3p suppresses the proliferation and differentiation of myoblasts by targeting IRS1 in skeletal muscle myogenesis. Int. J. Biol. Sci. 2018, 14, 760–774. [Google Scholar] [CrossRef]
- Debaud, C.; Salga, M.; Begot, L.; Holy, X.; Chedik, M.; De l’Escalopier, N.; Torossian, F.; Levesque, J.P.; Lataillade, J.J.; Le Bousse-Kerdiles, M.C.; et al. Peripheral denervation participates in heterotopic ossification in a spinal cord injury model. PLoS ONE 2017, 12, e0182454. [Google Scholar] [CrossRef]
- Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2−ΔΔCT method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef]
- Dagda, R.K.; Cherra, S.J.; Kulich, S.M.; Tandon, A.; Park, D.; Chu, C.T. Loss of PINK1 function promotes mitophagy through effects on oxidative stress and mitochondrial fission. J. Biol. Chem. 2009, 284, 13843–13855. [Google Scholar] [CrossRef] [PubMed]
- Sivandzade, F.; Bhalerao, A.; Cucullo, L. Analysis of the mitochondrial membrane potential using the cationic JC-1 dye as a sensitive fluorescent probe. Bio Protoc. 2019, 9, e3128. [Google Scholar] [CrossRef] [PubMed]
- Dott, W.; Mistry, P.; Wright, J.; Cain, K.; Herbert, K.E. Modulation of mitochondrial bioenergetics in a skeletal muscle cell line model of mitochondrial toxicity. Redox Biol. 2014, 2, 224–233. [Google Scholar] [CrossRef] [PubMed]
- Shirihai, O.S.; Song, M.; Dorn, G.W. How mitochondrial dynamism orchestrates mitophagy. Circ. Res. 2015, 116, 1835–1849. [Google Scholar] [CrossRef] [PubMed]
- Perry, S.W.; Norman, J.P.; Litzburg, A.; Zhang, D.; Dewhurst, S.; Gelbard, H.A. HIV-1 transactivator of transcription protein induces mitochondrial hyperpolarization and synaptic stress leading to apoptosis. J. Immunol. 2005, 174, 4333–4344. [Google Scholar] [CrossRef]
- Seo, A.Y.; Joseph, A.M.; Dutta, D.; Hwang, J.C.; Aris, J.P.; Leeuwenburgh, C. New insights into the role of mitochondria in aging: Mitochondrial dynamics and more. J. Cell Sci. 2010, 123, 2533–2542. [Google Scholar] [CrossRef]
- Bankapalli, K.; Vishwanathan, V.; Susarla, G.; Sunayana, N.; Saladi, S.; Peethambaram, D.; D’Silva, P. Redox-dependent regulation of mitochondrial dynamics by DJ-1 paralogs in Saccharomyces cerevisiae. Redox Biol. 2020, 32, 101451. [Google Scholar] [CrossRef]
- Westrate, L.M.; Drocco, J.A.; Martin, K.R.; Hlavacek, W.S.; MacKeigan, J.P. Mitochondrial morphological features are associated with fission and fusion events. PLoS ONE 2014, 9, e95265. [Google Scholar] [CrossRef]
- Pearson, T.; Kabayo, T.; Ng, R.; Chamberlain, J.; McArdle, A.; Jackson, M.J. Skeletal muscle contractions induce acute changes in cytosolic superoxide, but slower responses in mitochondrial superoxide and cellular hydrogen peroxide. PLoS ONE 2014, 9, e96378. [Google Scholar] [CrossRef]
- Ott, M.; Gogvadze, V.; Orrenius, S.; Zhivotovsky, B. Mitochondria, oxidative stress and cell death. Apoptosis 2007, 12, 913–922. [Google Scholar] [CrossRef]
- Kim, J.H.; Lawler, J.M. Amplification of proinflammatory phenotype, damage, and weakness by oxidative stress in the diaphragm muscle of mdx mice. Free Radic. Biol. Med. 2012, 52, 1597–1606. [Google Scholar] [CrossRef] [PubMed]
- Lawler, J.M.; Kunst, M.; Hord, J.M.; Lee, Y.; Joshi, K.; Botchlett, R.E.; Ramirez, A.; Martinez, D.A. EUK-134 ameliorates nNOSμ translocation and skeletal muscle fiber atrophy during short-term mechanical unloading. Am. J. Physiol. Regul. Integr. Comp. Physiol. 2014, 306, R470–R482. [Google Scholar] [CrossRef] [PubMed]
- Yamada, T.; Abe, M.; Lee, J.; Tatebayashi, D.; Himori, K.; Kanzaki, K.; Wada, M.; Bruton, J.D.; Westerblad, H.; Lanner, J.T. Muscle dysfunction associated with adjuvant-induced arthritis is prevented by antioxidant treatment. Skelet. Muscle 2015, 5, 20. [Google Scholar] [CrossRef] [PubMed]
- Himori, K.; Abe, M.; Tatebayashi, D.; Lee, J.; Westerblad, H.; Lanner, J.T.; Yamada, T. Superoxide dismutase/catalase mimetic EUK-134 prevents diaphragm muscle weakness in monocrotalin-induced pulmonary hypertension. PLoS ONE 2017, 12, e0169146. [Google Scholar] [CrossRef] [PubMed]
- Duksin, D.; Mahoney, W.C. Relationship of the structure and biological activity of the natural homologues of tunicamycin. J. Biol. Chem. 1982, 257, 3105–3109. [Google Scholar]
- Win, S.; Than, T.A.; Fernandez-Checa, J.C.; Kaplowitz, N. JNK interaction with Sab mediates ER stress induced inhibition of mitochondrial respiration and cell death. Cell Death Dis. 2014, 5, e989. [Google Scholar] [CrossRef]
- Quan, X.; Wang, J.; Liang, C.; Zheng, H.; Zhang, L. Melatonin inhibits tunicamycin-induced endoplasmic reticulum stress and insulin resistance in skeletal muscle cells. Biochem. Biophys. Res. Commun. 2015, 463, 1102–1107. [Google Scholar] [CrossRef]
- Hassan, R.H.; Hainault, I.; Vilquin, J.T.; Samama, C.; Lasnier, F.; Ferre, P.; Foufelle, F.; Hajduch, E. Endoplasmic reticulum stress does not mediate palmitate-induced insulin resistance in mouse and human muscle cells. Diabetologia 2012, 55, 204–214. [Google Scholar] [CrossRef]
- Deldicque, L.; Bertrand, L.; Patton, A.; Francaux, M.; Baar, K. ER stress induces anabolic resistance in muscle cells through PKB-induced blockade of mTORC1. PLoS ONE 2011, 6, e20993. [Google Scholar] [CrossRef]
- Knupp, J.; Arvan, P.; Chang, A. Increased mitochondrial respiration promotes survival from endoplasmic reticulum stress. Cell Death Differ. 2019, 26, 487–501. [Google Scholar] [CrossRef]
- Alam, S.; Abdullah, C.S.; Aishwarya, R.; Orr, A.W.; Traylor, J.; Miriyala, S.; Panchatcharam, M.; Pattillo, C.B.; Bhuiyan, M. Sigmar1 regulates endoplasmic reticulum stress-induced C/EBP-homologous protein expression in cardiomyocytes. Biosci. Rep. 2017, 37, BSR20170898. [Google Scholar] [CrossRef]
- Hill, B.G.; Benavides, G.A.; Lancaster, J.R.; Ballinger, S.; Dell’Italia, L.; Zhang, J.; Darley-Usmar, V.M. Integration of cellular bioenergetics with mitochondrial quality control and autophagy. Biol. Chem. 2012, 393, 1485–1512. [Google Scholar] [CrossRef] [PubMed]
- Pearson, T.; McArdle, A.; Jackson, M.J. Nitric oxide availability is increased in contracting skeletal muscle from aged mice, but does not differentially decrease muscle superoxide. Free Radic. Biol. Med. 2015, 78, 82–88. [Google Scholar] [CrossRef] [PubMed][Green Version]
- Guha, P.; Kaptan, E.; Gade, P.; Kalvakolanu, D.V.; Ahmed, H. Tunicamycin induced endoplasmic reticulum stress promotes apoptosis of prostate cancer cells by activating mTORC1. Oncotarget 2017, 8, 68191–68207. [Google Scholar] [CrossRef]
- Chatterjee, P.K.; Patel, N.S.; Kvale, E.O.; Brown, P.A.; Stewart, K.N.; Mota-Filipe, H.; Sharpe, M.A.; Di Paola, R.; Cuzzocrea, S.; Thiemermann, C. EUK-134 reduces renal dysfunction and injury caused by oxidative and nitrosative stress of the kidney. Am. J. Nephrol. 2004, 24, 165–177. [Google Scholar] [CrossRef] [PubMed]
- Daiber, A.; Daub, S.; Bachschmid, M.; Schildknecht, S.; Oelze, M.; Steven, S.; Schmidt, P.; Megner, A.; Wada, M.; Tanabe, T.; et al. Protein tyrosine nitration and thiol oxidation by peroxynitrite—Strategies to prevent these oxidative modifications. Int. J. Mol. Sci. 2013, 14, 7542–7570. [Google Scholar] [CrossRef] [PubMed]
- Trnka, J.; Elkalaf, M.; Anděl, M. Lipophilic triphenylphosphonium cations inhibit mitochondrial electron transport chain and induce mitochondrial proton leak. PLoS ONE 2015, 10, e0121837. [Google Scholar] [CrossRef]
- Wredenberg, A.; Wibom, R.; Wilhelmsson, H.; Graff, C.; Wiener, H.H.; Burden, S.J.; Oldfors, A.; Westerblad, H.; Larsson, N.G. Increased mitochondrial mass in mitochondrial myopathy mice. Proc. Natl Acad. Sci. USA 2002, 99, 15066–15071. [Google Scholar] [CrossRef]
- Jadiya, P.; Tomar, D. Mitochondrial Protein Quality Control Mechanisms. Genes 2020, 11, 563. [Google Scholar] [CrossRef]
- Marino Gammazza, A.; Macaluso, F.; Di Felice, V.; Cappello, F.; Barone, R. Hsp60 in skeletal muscle fiber biogenesis and homeostasis: From physical exercise to skeletal muscle pathology. Cells 2018, 7, 224. [Google Scholar] [CrossRef]
- Barone, R.; Macaluso, F.; Sangiorgi, C.; Campanella, C.; Gammazza, A.M.; Moresi, V.; Coletti, D.; De Macario, E.C.; Macario, A.J.; Cappello, F.; et al. Skeletal muscle Heat shock protein 60 increases after endurance training and induces peroxisome proliferator-activated receptor gamma coactivator 1 α1 expression. Sci. Rep. 2016, 6, 19781. [Google Scholar] [CrossRef]
- Xiao, T.; Liang, X.; Liu, H.; Zhang, F.; Meng, W.; Hu, F. Mitochondrial stress protein HSP60 regulates ER stress-induced hepatic lipogenesis. J. Mol. Endocrinol. 2020, 64, 67–75. [Google Scholar] [CrossRef] [PubMed]
- Iqbal, S.; Hood, D.A. Oxidative stress-induced mitochondrial fragmentation and movement in skeletal muscle myoblasts. Am. J. Physiol. Cell Physiol. 2014, 306, C1176–C1183. [Google Scholar] [CrossRef] [PubMed]
- Fan, X.; Hussien, R.; Brooks, G.A. H2O2-induced mitochondrial fragmentation in C2C12 myocytes. Free Radic. Biol. Med. 2010, 49, 1646–1654. [Google Scholar] [CrossRef] [PubMed]
- Lebeau, J.; Saunders, J.M.; Moraes, V.W.; Madhavan, A.; Madrazo, N.; Anthony, M.C.; Wiseman, R.L. The PERK arm of the unfolded protein response regulates mitochondrial morphology during acute endoplasmic reticulum stress. Cell Rep. 2018, 22, 2827–2836. [Google Scholar] [CrossRef]
- Gomes, L.C.; Di Benedetto, G.; Scorrano, L. During autophagy mitochondria elongate, are spared from degradation and sustain cell viability. Nat. Cell Biol. 2011, 13, 589–598. [Google Scholar] [CrossRef]







| Target mRNA | Annealing Temperature (°C) | Forward Primer Sequence (5′-3′) | Reverse Primer Sequence (5′-3′) |
|---|---|---|---|
| MFN2 | 58 | AGTTGGAGCGGAGACTTAGC | ATCGCCTTCTTAGCCAGCAC |
| HSP60 | 58 | GAACAGCTAACTCCAAGTCAGA | CAGCCGCTCTGAGAACTTCA |
| TFAM | 58 | CTGCACTCTGTCCCTCACTC | GGGTAACCGAAGCATTTCTGC |
| DRP1 | 58 | TCACCCGGAGACCTCTCATT | TCTGCTTCCACCCCATTTTCT |
| Citrate Synthase | 58 | TGATGAGGGCATCCGTTTCC | GTTCTTCCCCACCCTTAGCC |
| FIS1 | 58 | AGGCCTTAAAGTACGTCCGC | TGCCCACGAGTCCATCTTTC |
| UCP3 | 55.7 | GGGTCAACCTGGGATGTAGC | TCCCTAACCCTCCCCATCAG |
| HSPA9 | 58 | AGAAGACCGGCGAAAGAAGG | TGTTGCACTCATCAGCAGGT |
| Target mRNA | Annealing Temperature (°C) | Forward Primer Sequence (5′-3′) | Reverse Primer Sequence (5′-3′) |
|---|---|---|---|
| GRP78 | 59.3 | TGACATTGAAGACTTCAAAGCT | CTGCTGTATCCTCTTCACCAGT |
| Total XBP1 | 59.3 | GGCATCCTGGCTTGCCTCCA | GCCCCCTCAGCAGGTGTTCC |
| ERDJ4 | 59.3 | TCGGCATCAGAGCGCCAAATCA | ACCACTAGTAAAAGCACTGTGTCCAAG |
| CHOP | 59.3 | GGAGCATCAGTCCCCCACTT | TGTGGGATTGAGGGTCACATC |
| GADD34 | 59.3 | CCCAGAAACCCCTACTCATGATC | GCCCAGACAGCCAGGAAAT |
© 2020 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Thoma, A.; Lyon, M.; Al-Shanti, N.; Nye, G.A.; Cooper, R.G.; Lightfoot, A.P. Eukarion-134 Attenuates Endoplasmic Reticulum Stress-Induced Mitochondrial Dysfunction in Human Skeletal Muscle Cells. Antioxidants 2020, 9, 710. https://doi.org/10.3390/antiox9080710
Thoma A, Lyon M, Al-Shanti N, Nye GA, Cooper RG, Lightfoot AP. Eukarion-134 Attenuates Endoplasmic Reticulum Stress-Induced Mitochondrial Dysfunction in Human Skeletal Muscle Cells. Antioxidants. 2020; 9(8):710. https://doi.org/10.3390/antiox9080710
Chicago/Turabian StyleThoma, Anastasia, Max Lyon, Nasser Al-Shanti, Gareth A. Nye, Robert G. Cooper, and Adam P. Lightfoot. 2020. "Eukarion-134 Attenuates Endoplasmic Reticulum Stress-Induced Mitochondrial Dysfunction in Human Skeletal Muscle Cells" Antioxidants 9, no. 8: 710. https://doi.org/10.3390/antiox9080710
APA StyleThoma, A., Lyon, M., Al-Shanti, N., Nye, G. A., Cooper, R. G., & Lightfoot, A. P. (2020). Eukarion-134 Attenuates Endoplasmic Reticulum Stress-Induced Mitochondrial Dysfunction in Human Skeletal Muscle Cells. Antioxidants, 9(8), 710. https://doi.org/10.3390/antiox9080710

