Prenatal Melatonin Modulates Cardiovascular Function and Oxidative Stress in Guinea Pig Neonates Under Normoxic and Hypoxic Gestation
Abstract
1. Introduction
2. Methods
2.1. Animal Model
2.2. Experimental Design
2.3. In Vivo Approaches
2.3.1. Monitoring of Maternal Body Weight
2.3.2. Ultrasound Assessment
2.4. Ex Vivo Approaches
2.4.1. Euthanasia and Cardiovascular Tissue Collection
2.4.2. Vascular Reactivity Assessment
2.5. In Vitro Approaches
2.5.1. Neonatal Cardiovascular Structure
2.5.2. Immunohistochemistry Assays
2.5.3. Transcriptional Expression Evaluations
2.5.4. Immunoblot Assays
2.5.5. Antioxidant Enzyme Activity
2.6. Statistical Analyses
2.6.1. Sample Size
2.6.2. In Vivo Data—Ultrasound Measurements
2.6.3. Ex Vivo Data—Wire Myography
2.6.4. In Vitro Data—General Analyses
3. Results
3.1. Gestational Hypoxia Alters Neonatal Body Weight
3.2. Gestational Hypoxia and Melatonin Alter Fetal Cardiac Structure
3.3. Melatonin Modulates Fetal Cardiovascular Function over Time
3.4. Melatonin Alters Neonatal Cardiac Structure
3.5. Melatonin Compensates Gestational Hypoxia-Induced Neonatal Cardiac Oxidative Stress
3.6. Melatonin Compensates Gestational Hypoxia-Induced Neonatal Vascular Dysfunction
4. Discussion
4.1. Prenatal Melatonin Effects in the Gestational Hypoxia Context
4.2. Prenatal Melatonin Effects in the Non-Pathological Context
4.3. Limitations
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
Appendix A



| mRNA Target | Gene Symbol | Forward Primer (5′ ► 3′) | Reverse Primer (5′ ► 3′) | Product Length (bp) | NCBI RefSeq |
|---|---|---|---|---|---|
| Catalase | Cat | GACAAAATGCTTCAGGGCCG | ACCTTGGTTGTCAGTCACGC | 156 | NM_001439566.1 |
| Glutathione Peroxidase 1 | Gpx1 | TCATTGAGAATGTGGCCTCCC | GGACGTACTTGAGCGAATGC | 177 | XM_003476448.5 |
| Glutathione Peroxidase 2 | Gpx2 | ACAGCCGCACCTTTCATACC | GCAAGGCTATTGGGTGAACG | 163 | XM_005004774.4 |
| Glutathione Peroxidase 3 | Gpx3 | TGTGAGCGGAACCATCTACG | TCTCCCGGCTCTTGTTTTCC | 228 | XM_003464498.5 |
| Glutathione Peroxidase 4 | Gpx4 | CTCCATGCACGAGTTCTCCG | CAGACCACACTCAGCGTACC | 169 | NM_001256319.1 |
| Superoxide Dismutase 1 | Sod1 | CCGTTGTGGTAAAGGGACGC | AGTCCTCGATGGATACATTGGC | 222 | XM_003467248.5 |
| Superoxide Dismutase 2 | Sod2 | CCTCCCCGATTTACCCTACG | CCGTTGAACTTCAGTGCAGG | 195 | XM_003466367.5 |
| Heme Oxigenase 1 | Hmox1 | GCTGGTGATGGCCTCACTGTACC | CGTACCAGAAGGCCATGTCCTGC | 149 | XM_023561275.2 |
| β-Actin | Actb | ATGGGCCAGAAGGACTCCTACG | TCAGGGGCCACACGCAATTC | 158 | NM_001172909.1 |
| Protein Target | Abbreviation | Dilution Factor | Product Reference | NCBI GeneID |
|---|---|---|---|---|
| Catalase | CAT | 1:5000 | #ab1877, Abcam, Cambridge, UK | 100135492 |
| Glutathione Peroxidase 1/2 | GPX1/2 | 1:2000 | #sc-133160, Santa Cruz Biotechnology, Dallas, USA | 100729115; 100714682 |
| Superoxide Dismutase 1 | SOD1 | 1:2000 | #sc-17767, Santa Cruz Biotechnology, Dallas, USA | 100135622 |
| Superoxide Dismutase 2 | SOD2 | 1:2000 | #06-984, Millipore, Burlington, USA | 100135623 |
| Heme Oxigenase 1 | HMOX1/HO-1 | 1:2000 | #MA-1-112, Invitrogen, Carlsbad, USA | 100715748 |
| αβ-Tubulin | TUBA | 1:2000 | #2148, Cell Signaling, Danvers, USA | 100716481; 100718713 |
References
- Di Cesare, M.; McGhie, D.V.; Perel, P.; Mwangi, J.; Taylor, S.; Pervan, B.; Kabudula, C.; Narula, J.; Bixby, H.; Pineiro, D.; et al. The Heart of the World. Glob. Heart 2024, 19, 11. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Mocumbi, A.O. Cardiovascular Health Care in Low- and Middle-Income Countries. Circulation 2024, 149, 557–559. [Google Scholar] [CrossRef] [Scilit]
- Mensah, G.A.; Habtegiorgis Abate, Y.; Abbasian, M.; Abd-Allah, F.; Abdollahi, A.; Abdollahi, M.; Morad Abdulah, D.; Abdullahi, A.; Abebe, A.M.; Abedi, A.; et al. Global Burden of Cardiovascular Diseases and Risks, 1990–2022. J. Am. Coll. Cardiol. 2023, 82, 2350. [Google Scholar] [CrossRef] [Scilit]
- Adhikary, D.; Barman, S.; Ranjan, R.; Stone, H. A Systematic Review of Major Cardiovascular Risk Factors: A Growing Global Health Concern. Cureus 2022, 14, e30119. [Google Scholar] [CrossRef] [Scilit]
- Giussani, D.A.; Giussani, D.A. Breath of Life: Heart Disease Link to Developmental Hypoxia. Circulation 2021, 144, 1429. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ducsay, C.A.; Goyal, R.; Pearce, W.J.; Wilson, S.; Hu, X.Q.; Zhang, L. Gestational Hypoxia and Developmental Plasticity. Physiol. Rev. 2018, 98, 1241–1334. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Gonzalez-Candia, A.; Herrera, E.A. High Altitude Pregnancies and Vascular Dysfunction: Observations from Latin American Studies. Front. Physiol. 2021, 12, 786038. [Google Scholar] [CrossRef] [Scilit]
- Giussani, D.A. The Fetal Brain Sparing Response to Hypoxia: Physiological Mechanisms. J. Physiol. 2016, 594, 1215–1230. [Google Scholar] [CrossRef] [Scilit]
- Crispi, F.; Miranda, J.; Gratacós, E. Long-Term Cardiovascular Consequences of Fetal Growth Restriction: Biology, Clinical Implications, and Opportunities for Prevention of Adult Disease. Am. J. Obs. Gynecol. 2018, 218, S869–S879. [Google Scholar] [CrossRef] [Scilit]
- Ream, M.; Ray, A.M.; Chandra, R.; Chikaraishi, D.M. Early Fetal Hypoxia Leads to Growth Restriction and Myocardial Thinning. Am. J. Physiol. Regul. Integr. Comp. Physiol. 2008, 295, R583–R595. [Google Scholar] [CrossRef] [Scilit]
- Turan, S.; Aberdeen, G.W.; Thompson, L.P. Chronic Hypoxia Alters Maternal Uterine and Fetal Hemodynamics in the Full-Term Pregnant Guinea Pig. Am. J. Physiol. Regul. Integr. Comp. Physiol. 2017, 313, R330. [Google Scholar] [CrossRef] [Scilit]
- Ruijtenbeek, K.; Kessels, C.G.A.; Villamor, E.; Blanco, C.E.; De Mey, J.G.R. Direct Effects of Acute Hypoxia on the Reactivity of Peripheral Arteries of the Chicken Embryo. Am. J. Physiol. Regul. Integr. Comp. Physiol. 2002, 283, R331–R338. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Krause, B.J.; Paz, A.A.; Garrud, T.A.C.; Peñaloza, E.; Vega-Tapia, F.; Ford, S.G.; Niu, Y.; Giussani, D.A. Epigenetic Regulation by Hypoxia, N-Acetylcysteine and Hydrogen Sulphide of the Fetal Vasculature in Growth Restricted Offspring: A Study in Humans and Chicken Embryos. J. Physiol. 2024, 602, 3833–3852. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Thakor, A.S.; Allison, B.J.; Niu, Y.; Botting, K.J.; Serõn-Ferré, M.; Herrera, E.A.; Giussani, D.A. Melatonin Modulates the Fetal Cardiovascular Defense Response to Acute Hypoxia. J. Pineal Res. 2015, 59, 80. [Google Scholar] [CrossRef] [Scilit]
- Herrera, E.A.; Rojas, R.T.; Krause, B.J.; Ebensperger, G.; Reyes, R.V.; Giussani, D.A.; Parer, J.T.; Llanos, A.J. Cardiovascular Function in Term Fetal Sheep Conceived, Gestated and Studied in the Hypobaric Hypoxia of the Andean Altiplano. J. Physiol. 2015, 594, 1231. [Google Scholar] [CrossRef] [Scilit]
- Herrera, E.A.; Cifuentes-Zúñiga, F.; Figueroa, E.; Villanueva, C.; Hernández, C.; Alegría, R.; Arroyo-Jousse, V.; Peñaloza, E.; Farías, M.; Uauy, R.; et al. N-Acetylcysteine, a Glutathione Precursor, Reverts Vascular Dysfunction and Endothelial Epigenetic Programming in Intrauterine Growth Restricted Guinea Pigs. J. Physiol. 2016, 595, 1077. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Paz, A.A.; Arenas, G.A.; Castillo-Galán, S.; Peñaloza, E.; Cáceres-Rojas, G.; Suazo, J.; Herrera, E.A.; Krause, B.J. Premature Vascular Aging in Guinea Pigs Affected by Fetal Growth Restriction. Int. J. Mol. Sci. 2019, 20, 3474. [Google Scholar] [CrossRef] [Scilit]
- Zhao, M.; Lei, J.; Deng, F.; Zhao, C.; Xu, T.; Ji, B.; Fu, M.; Wang, X.; Sun, M.; Zhang, M.; et al. Gestational Hypoxia Impaired Endothelial Nitric Oxide Synthesis Via MiR-155-5p/NADPH Oxidase/Reactive Oxygen Species Axis in Male Offspring Vessels. J. Am. Heart Assoc. Cardiovasc. Cerebrovasc. Dis. 2024, 13, e032079. [Google Scholar] [CrossRef] [Scilit]
- Krause, B.J.; Peñaloza, E.; Candia, A.; Cañas, D.; Hernández, C.; Arenas, G.A.; Peralta-Scholz, M.J.; Valenzuela, R.; García-Herrera, C.; Herrera, E.A. Adult Vascular Dysfunction in Foetal Growth-Restricted Guinea-Pigs Is Associated with a Neonate-Adult Switching in Nos3 DNA Methylation. Acta Physiol. 2019, 227, e13328. [Google Scholar] [CrossRef] [Scilit]
- Paz, A.A.; Jiménez, T.A.; Ibarra-Gonzalez, J.; Astudillo-Maya, C.; Beñaldo, F.A.; Figueroa, E.G.; Llanos, A.J.; Gonzalez-Candia, A.; Herrera, E.A. Gestational Hypoxia Elicits Long-Term Cardiovascular Dysfunction in Female Guinea Pigs. Life Sci. 2025, 361, 123282. [Google Scholar] [CrossRef] [Scilit]
- Berman, M.N.; Tupper, C.; Bhardwaj, A. Physiology, Left Ventricular Function. In StatPearls; StatPearls Publishing: Orlando, FL, USA, 2022. [Google Scholar]
- Sies, H. Oxidative Stress: Concept and Some Practical Aspects. Antioxidants 2020, 9, 852. [Google Scholar] [CrossRef] [Scilit]
- Pall, M.L. The NO/ONOO-Cycle as the Central Cause of Heart Failure. Int. J. Mol. Sci. 2013, 14, 22274. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- He, F.; Ru, X.; Wen, T. NRF2, a Transcription Factor for Stress Response and Beyond. Int. J. Mol. Sci. 2020, 21, 4777. [Google Scholar] [CrossRef] [Scilit]
- Engineer, A.; Saiyin, T.; Greco, E.R.; Feng, Q. Say NO to ROS: Their Roles in Embryonic Heart Development and Pathogenesis of Congenital Heart Defects in Maternal Diabetes. Antioxidants 2019, 8, 436. [Google Scholar] [CrossRef] [Scilit]
- Evans, L.C.; Liu, H.; Pinkas, G.A.; Thompson, L.P. Chronic Hypoxia Increases Peroxynitrite, MMP9 Expression, and Collagen Accumulation in Fetal Guinea Pig Hearts. Pediatr. Res. 2012, 71, 25–31. [Google Scholar] [CrossRef] [Scilit]
- Al-Hasan, Y.M.; Evans, L.C.; Pinkas, G.A.; Dabkowski, E.R.; Stanley, W.C.; Thompson, L.P. Chronic Hypoxia Impairs Cytochrome Oxidase Activity via Oxidative Stress in Selected Fetal Guinea Pig Organs. Reprod. Sci. 2013, 20, 299–307. [Google Scholar] [CrossRef] [Scilit]
- Smith, K.L.M.; Swiderska, A.; Lock, M.C.; Graham, L.; Iswari, W.; Choudhary, T.; Thomas, D.; Kowash, H.M.; Desforges, M.; Cottrell, E.C.; et al. Chronic Developmental Hypoxia Alters Mitochondrial Oxidative Capacity and Reactive Oxygen Species Production in the Fetal Rat Heart in a Sex-Dependent Manner. J. Pineal Res. 2022, 73, e12821. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Giussani, D.A.; Camm, E.J.; Niu, Y.; Richter, H.G.; Blanco, C.E.; Gottschalk, R.; Blake, E.Z.; Horder, K.A.; Thakor, A.S.; Hansell, J.A.; et al. Developmental Programming of Cardiovascular Dysfunction by Prenatal Hypoxia and Oxidative Stress. PLoS ONE 2012, 7, e31017. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Tobeiha, M.; Jafari, A.; Fadaei, S.; Mirazimi, S.M.A.; Dashti, F.; Amiri, A.; Khan, H.; Asemi, Z.; Reiter, R.J.; Hamblin, M.R.; et al. Evidence for the Benefits of Melatonin in Cardiovascular Disease. Front. Cardiovasc. Med. 2022, 9, 888319. [Google Scholar] [CrossRef] [Scilit]
- Hacışevki, A.; Baba, B.; Hacışevki, A.; Baba, B. An Overview of Melatonin as an Antioxidant Molecule: A Biochemical Approach. In Melatonin—Molecular Biology, Clinical and Pharmaceutical Approaches; IntechOpen: London, UK, 2018. [Google Scholar] [CrossRef] [Scilit]
- Santofimia-Castaño, P.; Clea Ruy, D.; Garcia-Sanchez, L.; Jimenez-Blasco, D.; Fernandez-Bermejo, M.; Bolaños, J.P.; Salido, G.M.; Gonzalez, A. Melatonin Induces the Expression of Nrf2-Regulated Antioxidant Enzymes via PKC and Ca2+ Influx Activation in Mouse Pancreatic Acinar Cells. Free Radic. Biol. Med. 2015, 87, 226–236. [Google Scholar] [CrossRef] [Scilit]
- Chen, S.; Li, Y.; Fu, S.; Li, Y.; Wang, C.; Sun, P.; Li, H.; Tian, J.; Du, G.Q. Melatonin Alleviates Arginine Vasopressin-Induced Cardiomyocyte Apoptosis via Increasing Mst1-Nrf2 Pathway Activity to Reduce Oxidative Stress. Biochem. Pharmacol. 2022, 206, 115265. [Google Scholar] [CrossRef] [Scilit]
- Boutin, J.A.; Liberelle, M.; Yous, S.; Ferry, G.; Nepveu, F. Melatonin Facts: Lack of Evidence That Melatonin Is a Radical Scavenger in Living Systems. J. Pineal Res. 2024, 76, e12926. [Google Scholar] [CrossRef] [Scilit]
- Verteramo, R.; Pierdomenico, M.; Greco, P.; Milano, C. The Role of Melatonin in Pregnancy and the Health Benefits for the Newborn. Biomedicines 2022, 10, 3252. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Morrison, J.L.; Botting, K.J.; Darby, J.R.T.; David, A.L.; Dyson, R.M.; Gatford, K.L.; Gray, C.; Herrera, E.A.; Hirst, J.J.; Kim, B.; et al. Guinea Pig Models for Translation of the Developmental Origins of Health and Disease Hypothesis into the Clinic. J. Physiol. 2018, 596, 5535–5569. [Google Scholar] [CrossRef] [Scilit]
- Candia, A.A.; Jiménez, T.; Navarrete, Á.; Beñaldo, F.; Silva, P.; García-Herrera, C.; Sferruzzi-Perri, A.N.; Krause, B.J.; González-Candia, A.; Herrera, E.A. Developmental Ultrasound Characteristics in Guinea Pigs: Similarities with Human Pregnancy. Vet. Sci. 2023, 10, 144. [Google Scholar] [CrossRef] [Scilit]
- Chevalier, R.L. Functional Adaptation to Reduced Renal Mass in Early Development. Am. J. Physiol.-Ren. Physiol. 1982, 242, F190–F196. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Murphy, J.D.; Aronovitz, M.J.; Reid, L.M. Effects of Chronic in Utero Hypoxia on the Pulmonary Vasculature of the Newborn Guinea Pig. Pediatr. Res. 1986, 20, 292–295. [Google Scholar] [CrossRef] [Scilit]
- Feldman, A.T.; Wolfe, D. Tissue Processing and Hematoxylin and Eosin Staining. Methods Mol. Biol. 2014, 1180, 31–43. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Suvarna, S.K.; Layton, C.; Bancroft, J.D. Bancroft’s Theory and Practice of Histological Techniques, 8th ed.; Elsevier Health Sciences: Amsterdam, The Netherlands, 2018; pp. 1–557. [Google Scholar] [CrossRef] [Scilit]
- Schindelin, J.; Arganda-Carreras, I.; Frise, E.; Kaynig, V.; Longair, M.; Pietzsch, T.; Preibisch, S.; Rueden, C.; Saalfeld, S.; Schmid, B.; et al. Fiji: An Open-Source Platform for Biological-Image Analysis. Nat. Methods 2012, 9, 676–682. [Google Scholar] [CrossRef] [Scilit]
- Gerard, G.F.; Fox, D.K.; Nathan, M.; D’Alessio, J.M. Reverse Transcriptase. The Use of Cloned Moloney Murine Leukemia Virus Reverse Transcriptase to Synthesize DNA from RNA. Mol. Biotechnol. 1997, 8, 61–77. [Google Scholar] [CrossRef] [Scilit]
- Rao, X.; Lai, D.; Huang, X. A New Method for Quantitative Real-Time Polymerase Chain Reaction Data Analysis. J. Comput. Biol. 2013, 20, 703–711. [Google Scholar] [CrossRef] [Scilit]
- Jurczuk, M.; Brzóska, M.M.; Moniuszko-Jakoniuk, J.; Gałazyn-Sidorczuk, M.; Kulikowska-Karpińska, E. Antioxidant Enzymes Activity and Lipid Peroxidation in Liver and Kidney of Rats Exposed to Cadmium and Ethanol. Food Chem. Toxicol. 2004, 42, 429–438. [Google Scholar] [CrossRef] [Scilit]
- Kielkopf, C.L.; Bauer, W.; Urbatsch, I.L. Bradford Assay for Determining Protein Concentration. Cold Spring Harb. Protoc. 2020, 2020, 136–138. [Google Scholar] [CrossRef] [Scilit]
- Benjamini, Y.; Hochberg, Y. Controlling the False Discovery Rate: A Practical and Powerful Approach to Multiple Testing. J. R. Stat. Soc. Ser. B (Methodol.) 1995, 57, 289–300. [Google Scholar] [CrossRef] [Scilit]
- Aban, I.B.; George, B. Statistical Considerations for Preclinical Studies. Exp. Neurol. 2015, 270, 82. [Google Scholar] [CrossRef] [Scilit]
- Määttä, J.; Sissala, N.; Dimova, E.Y.; Serpi, R.; Moore, L.G.; Koivunen, P. Hypoxia Causes Reductions in Birth Weight by Altering Maternal Glucose and Lipid Metabolism. Sci. Rep. 2018, 8, 13583, Correction in Sci. Rep. 2020, 10, 4260. https://doi.org/10.1038/s41598-020-61220-x. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Rockwell, L.C.; Dempsey, E.C.; Moore, L.G. Chronic Hypoxia Diminishes the Proliferative Response of Guinea Pig Uterine Artery Vascular Smooth Muscle Cells in Vitro. High Alt. Med. Biol. 2006, 7, 237–244. [Google Scholar] [CrossRef] [Scilit]
- Mateev, S.; Sillau, A.H.; Mouser, R.; McCullough, R.E.; White, M.M.; Young, D.A.; Moore, L.G. Chronic Hypoxia Opposes Pregnancy-Induced Increase in Uterine Artery Vasodilator Response to Flow. Am. J. Physiol. Heart Circ. Physiol. 2003, 284. [Google Scholar] [CrossRef] [Scilit]
- Zhu, R.; Hu, X.Q.; Xiao, D.; Yang, S.; Wilson, S.M.; Longo, L.D.; Zhang, L. Chronic Hypoxia Inhibits Pregnancy-Induced Upregulation of SKCa Channel Expression and Function in Uterine Arteries. Hypertension 2013, 62, 367. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ibrahim, A.; Khoo, M.I.; Ismail, E.H.E.; Hussain, N.H.N.; Zin, A.A.M.; Noordin, L.; Abdullah, S.; Mahdy, Z.A.; Lah, N.A.Z.N. Oxidative Stress Biomarkers in Pregnancy: A Systematic Review. Reprod. Biol. Endocrinol. 2024, 22, 93. [Google Scholar] [CrossRef] [Scilit]
- Tintu, A.; Rouwet, E.; Verlohren, S.; Brinkmann, J.; Ahmad, S.; Crispi, F.; van Bilsen, M.; Carmeliet, P.; Staff, A.C.; Tjwa, M.; et al. Hypoxia Induces Dilated Cardiomyopathy in the Chick Embryo: Mechanism, Intervention, and Long-Term Consequences. PLoS ONE 2009, 4, e5155. [Google Scholar] [CrossRef] [Scilit]
- Cruz-Lemini, M.; Crispi, F.; Valenzuela-Alcaraz, B.; Figueras, F.; Sitges, M.; Bijnens, B.; Gratacós, E. Fetal Cardiovascular Remodeling Persists at 6 Months in Infants with Intrauterine Growth Restriction. Ultrasound Obstet. Gynecol. 2016, 48, 349–356. [Google Scholar] [CrossRef] [Scilit]
- Semmler, J.; Garcia-Gonzalez, C.; Sanchez Sierra, A.; Gallardo Arozena, M.; Nicolaides, K.H.; Charakida, M. Fetal Cardiac Function at 35–37 Weeks’ Gestation in Pregnancies That Subsequently Develop Pre-Eclampsia. Ultrasound Obstet. Gynecol. 2021, 57, 417–422. [Google Scholar] [CrossRef] [Scilit]
- Cinar, B.; Sert, A.; Gokmen, Z.; Aypar, E.; Aslan, E.; Odabas, D. Left Ventricular Dimensions, Systolic Functions, and Mass in Term Neonates with Symmetric and Asymmetric Intrauterine Growth Restriction. Cardiol. Young 2015, 25, 301–307. [Google Scholar] [CrossRef] [Scilit]
- Thakor, A.S.; Richter, H.G.; Kane, A.D.; Dunster, C.; Kelly, F.J.; Poston, L.; Giussani, D.A. Redox Modulation of the Fetal Cardiovascular Defence to Hypoxaemia. J. Physiol. 2010, 588, 4235. [Google Scholar] [CrossRef] [Scilit]
- Hansell, J.A.; Richter, H.G.; Camm, E.J.; Herrera, E.A.; Blanco, C.E.; Villamor, E.; Patey, O.V.; Lock, M.C.; Trafford, A.W.; Galli, G.L.J.; et al. Maternal Melatonin: Effective Intervention against Developmental Programming of Cardiovascular Dysfunction in Adult Offspring of Complicated Pregnancy. J. Pineal Res. 2022, 72, e12766. [Google Scholar] [CrossRef] [Scilit]
- Zhu, C.; Li, M.; Xu, C.J.; Ding, M.J.; Xiong, Y.; Liu, R.; Ren, Y.Y. Comparison of the Left and Right Ventricular Size and Systolic Function of Low-Risk Fetuses in the Third Trimester: Which Is More Dominant? Front. Cardiovasc. Med. 2023, 10, 1052178. [Google Scholar] [CrossRef] [Scilit]
- Remien, K.; Majmundar, S.H. Physiology, Fetal Circulation. In StatPearls; StatPearls Publishing: Orlando, FL, USA, 2023. [Google Scholar]
- Nakamura, M.; Sadoshima, J. Mechanisms of Physiological and Pathological Cardiac Hypertrophy. Nat. Rev. Cardiol. 2018, 15, 387–407. [Google Scholar] [CrossRef] [Scilit]
- MacIver, D.H. The Relative Impact of Circumferential and Longitudinal Shortening on Left Ventricular Ejection Fraction and Stroke Volume. Exp. Clin. Cardiol. 2012, 17, 5. [Google Scholar] [PubMed]
- Rodríguez-López, M.; Cruz-Lemini, M.; Valenzuela-Alcaraz, B.; Garcia-Otero, L.; Sitges, M.; Bijnens, B.; Gratacós, E.; Crispi, F. Descriptive Analysis of Different Phenotypes of Cardiac Remodeling in Fetal Growth Restriction. Ultrasound Obstet. Gynecol. 2017, 50, 207–214. [Google Scholar] [CrossRef] [Scilit]
- Crispi, F.; Sepúlveda-Martínez, Á.; Crovetto, F.; Gómez, O.; Bijnens, B.; Gratacós, E. Main Patterns of Fetal Cardiac Remodeling. Fetal Diagn. Ther. 2020, 47, 337–344. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Bijnens, B.; Cikes, M.; Butakoff, C.; Sitges, M.; Crispi, F. Myocardial Motion and Deformation: What Does It Tell Us and How Does It Relate to Function? Fetal Diagn. Ther. 2012, 32, 5–16. [Google Scholar] [CrossRef] [Scilit]
- Anand, I.S.; Chandrashekhar, Y.; Wander, G.S.; Chawla, L.S. Endothelium-Derived Relaxing Factor Is Important in Mediating the High Output State in Chronic Severe Anemia. J. Am. Coll. Cardiol. 1995, 25, 1402–1407. [Google Scholar] [CrossRef] [Scilit]
- Melenovsky, V. Cardiac Adaptation to Volume Overload. Card. Adapt. Mol. Mech. 2013, 4, 167–199. [Google Scholar] [CrossRef] [Scilit]
- Cook, J.S.; Sauder, C.L.; Ray, C.A. Melatonin Differentially Affects Vascular Blood Flow in Humans. Am. J. Physiol. Heart Circ. Physiol. 2010, 300, H670. [Google Scholar] [CrossRef] [Scilit]
- Cvikova, D.; Sutovska, H.; Babarikova, K.; Molcan, L. Hypotensive Effects of Melatonin in Rats: Focus on the Model, Measurement, Application, and Main Mechanisms. Hypertens. Res. 2022, 45, 1929–1944. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Figueroa, H.; Alvarado, C.; Cifuentes, J.; Lozano, M.; Rocco, J.; Cabezas, C.; Illanes, S.E.; Eixarch, E.; Hernández-Andrade, E.; Gratacós, E.; et al. Oxidative Damage and Nitric Oxide Synthase Induction by Surgical Uteroplacental Circulation Restriction in the Rabbit Fetal Heart. Prenat. Diagn. 2017, 37, 453–459. [Google Scholar] [CrossRef] [Scilit]
- Thompson, L.P.; Chen, L.; Polster, B.M.; Pinkas, G.; Song, H. Prenatal Hypoxia Impairs Cardiac Mitochondrial and Ventricular Function in Guinea Pig Offspring in a Sex-Related Manner. Am. J. Physiol. Regul. Integr. Comp. Physiol. 2018, 315, R1232–R1241. [Google Scholar] [CrossRef] [Scilit]
- Thompson, L.; Dong, Y.; Evans, L. Chronic Hypoxia Increases Inducible NOS-Derived Nitric Oxide in Fetal Guinea Pig Hearts. Pediatr. Res. 2009, 65, 188–192. [Google Scholar] [CrossRef] [Scilit]
- Canning, P.; Sorrell, F.J.; Bullock, A.N. Structural Basis of Keap1 Interactions with Nrf2. Free Radic. Biol. Med. 2015, 88, 101–107. [Google Scholar] [CrossRef] [Scilit]
- Ngo, V.; Duennwald, M.L. Nrf2 and Oxidative Stress: A General Overview of Mechanisms and Implications in Human Disease. Antioxidants 2022, 11, 2345. [Google Scholar] [CrossRef] [Scilit]
- Fang, Y.; Zhao, Y.; He, S.; Guo, T.; Song, Q.; Guo, N.; Yuan, Z. Overexpression of FGF19 Alleviates Hypoxia/Reoxygenation-Induced Injury of Cardiomyocytes by Regulating GSK-3β/Nrf2/ARE Signaling. Biochem. Biophys. Res. Commun. 2018, 503, 2355–2362. [Google Scholar] [CrossRef] [Scilit]
- Yan, L.; Cheng, G.; Yang, G. GSKIP Protects Cardiomyocytes from Hypoxia/Reoxygenation-Induced Injury by Enhancing Nrf2 Activation via GSK-3β Inhibition. Biochem. Biophys. Res. Commun. 2020, 532, 68–75. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Gonzaléz-Candia, A.; Arias, P.V.; Aguilar, S.A.; Figueroa, E.G.; Reyes, R.V.; Ebensperger, G.; Llanos, A.J.; Herrera, E.A. Melatonin Reduces Oxidative Stress in the Right Ventricle of Newborn Sheep Gestated under Chronic Hypoxia. Antioxidants 2021, 10, 1658. [Google Scholar] [CrossRef] [Scilit]
- Alfonso-Prieto, M.; Vidossich, P.; Rovira, C. The Reaction Mechanisms of Heme Catalases: An Atomistic View by Ab Initio Molecular Dynamics. Arch. Biochem. Biophys. 2012, 525, 121–130. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kikuchi, G.; Yoshida, T.; Noguchi, M. Heme Oxygenase and Heme Degradation. Biochem. Biophys. Res. Commun. 2005, 338, 558–567. [Google Scholar] [CrossRef] [Scilit]
- Karakus, Y.Y.; Karakus, Y.Y. Typical Catalases: Function and Structure. In Glutathione System and Oxidative Stress in Health and Disease; IntechOpen: London, UK, 2020. [Google Scholar] [CrossRef] [Scilit]
- Diaz-Del Cerro, E.; Martinez de Toda, I.; Félix, J.; Baca, A.; De la Fuente, M. Components of the Glutathione Cycle as Markers of Biological Age: An Approach to Clinical Application in Aging. Antioxidants 2023, 12, 1529. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Morvaridzadeh, M.; Sadeghi, E.; Agah, S.; Nachvak, S.M.; Fazelian, S.; Moradi, F.; Persad, E.; Heshmati, J. Effect of Melatonin Supplementation on Oxidative Stress Parameters: A Systematic Review and Meta-Analysis. Pharmacol. Res. 2020, 161, 105210. [Google Scholar] [CrossRef] [Scilit]
- Karwat, P.; Klimonda, Z.; Styczyński, G.; Szmigielski, C.; Litniewski, J. Aortic Root Movement Correlation with the Function of the Left Ventricle. Sci. Rep. 2021, 11, 4473. [Google Scholar] [CrossRef] [Scilit]
- Cañas, D.; Herrera, E.A.; García-Herrera, C.; Celentano, D.; Krause, B.J. Fetal Growth Restriction Induces Heterogeneous Effects on Vascular Biomechanical and Functional Properties in Guinea Pigs (Cavia porcellus). Front. Physiol. 2017, 8, 252900. [Google Scholar] [CrossRef] [Scilit]
- Numata, G.; Takimoto, E. Cyclic GMP and PKG Signaling in Heart Failure. Front. Pharmacol. 2022, 13, 792798. [Google Scholar] [CrossRef] [Scilit]
- Itani, N.; Skeffington, K.L.; Beck, C.; Niu, Y.; Giussani, D.A. Melatonin Rescues Cardiovascular Dysfunction during Hypoxic Development in the Chick Embryo. J. Pineal Res. 2015, 60, 16. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Yawno, T.; Mahen, M.; Li, J.; Fahey, M.C.; Jenkin, G.; Miller, S.L. The Beneficial Effects of Melatonin Administration Following Hypoxia-Ischemia in Preterm Fetal Sheep. Front. Cell Neurosci. 2017, 11, 281650. [Google Scholar] [CrossRef] [Scilit]
- Sales, F.; Peralta, O.A.; Narbona, E.; Mccoard, S.; González-Bulnes, A.; Parraguez, V.H. Rapid Communication: Maternal Melatonin Implants Improve Fetal Oxygen Supply and Body Weight at Term in Sheep Pregnancies. J. Anim. Sci. 2019, 97, 839–845. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Vine, T.; Brown, G.M.; Frey, B.N. Melatonin Use during Pregnancy and Lactation: A Scoping Review of Human Studies. Braz. J. Psychiatry 2021, 44, 342. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Pan, J.; Yuan, H.; Zhang, X.; Zhang, H.; Xu, Q.; Zhou, Y.; Tan, L.; Nagawa, S.; Huang, Z.X.; Tan, X. Probing the Molecular Mechanism of Human Soluble Guanylate Cyclase Activation by NO in Vitro and in Vivo. Sci. Rep. 2017, 7, 43112. [Google Scholar] [CrossRef] [Scilit]
- Bełtowski, J.; Jamroz-Wiśniewska, A. Hydrogen Sulfide and Endothelium-Dependent Vasorelaxation. Molecules 2014, 19, 21183–21199. [Google Scholar] [CrossRef] [Scilit]
- Ivanov, D.; Mazzoccoli, G.; Anderson, G.; Linkova, N.; Dyatlova, A.; Mironova, E.; Polyakova, V.; Kvetnoy, I.; Evsyukova, I.; Carbone, A.; et al. Melatonin, Its Beneficial Effects on Embryogenesis from Mitigating Oxidative Stress to Regulating Gene Expression. Int. J. Mol. Sci. 2021, 22, 5885. [Google Scholar] [CrossRef] [Scilit]
- Kudová, J.; Vašíček, O.; Číž, M.; Kubala, L. Melatonin Promotes Cardiomyogenesis of Embryonic Stem Cells via Inhibition of HIF-1α Stabilization. J. Pineal Res. 2016, 61, 493–503. [Google Scholar] [CrossRef] [Scilit]
- Ma, W.Y.; Song, R.J.; Xu, B.B.; Xu, Y.; Wang, X.X.; Sun, H.Y.; Li, S.N.; Liu, S.Z.; Yu, M.X.; Yang, F.; et al. Melatonin Promotes Cardiomyocyte Proliferation and Heart Repair in Mice with Myocardial Infarction via MiR-143-3p/Yap/Ctnnd1 Signaling Pathway. Acta Pharmacol. Sin. 2020, 42, 921–931. [Google Scholar] [CrossRef] [Scilit]
- Domínguez Rubio, A.P.; Correa, F.; Aisemberg, J.; Dorfman, D.; Bariani, M.V.; Rosenstein, R.E.; Zorrilla Zubilete, M.; Franchi, A.M. Maternal Administration of Melatonin Exerts Short- and Long-Term Neuroprotective Effects on the Offspring from Lipopolysaccharide-Treated Mice. J. Pineal Res. 2017, 63, e12439. [Google Scholar] [CrossRef] [Scilit]
- Singh, H.J.; Keah, L.S.; Kumar, A.; Sirajudeen, K.N.S. Adverse Effects of Melatonin on Rat Pups of Wistar–Kyoto Dams Receiving Melatonin Supplementation during Pregnancy. Exp. Toxicol. Pathol. 2012, 64, 751–752. [Google Scholar] [CrossRef] [Scilit]
- González-Candia, A.; Veliz, M.; Araya, C.; Quezada, S.; Ebensperger, G.; Serón-Ferré, M.; Reyes, R.V.; Llanos, A.J.; Herrera, E.A. Potential Adverse Effects of Antenatal Melatonin as a Treatment for Intrauterine Growth Restriction: Findings in Pregnant Sheep. Am. J. Obs. Gynecol. 2016, 215, 245.e1–245.e7. [Google Scholar] [CrossRef] [Scilit]
- Chellappa, S.L.; Vujovic, N.; Williams, J.S.; Scheer, F.A.J.L. Impact of Circadian Disruption on Cardiovascular Function and Disease. Trends Endocrinol. Metab. 2019, 30, 767. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Buccitelli, C.; Selbach, M. MRNAs, Proteins and the Emerging Principles of Gene Expression Control. Nat. Rev. Genet. 2020, 21, 630–644. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Sakamoto, T.; Kelly, D.P. Cardiac Maturation. J. Mol. Cell Cardiol. 2024, 187, 38–50. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kannan, S.; Kwon, C. Regulation of Cardiomyocyte Maturation during Critical Perinatal Window. J. Physiol. 2019, 598, 2941–2956. [Google Scholar] [CrossRef] [Scilit]





| Vehicle | Melatonin | ||||
|---|---|---|---|---|---|
| Parameter (mm) | Ultrasound Examination | Normoxia | Hypoxia | Normoxia | Hypoxia |
| Total Length | Initial | 7.129 ± 0.296 | 7.633 ± 0.183 | 10.28 ± 0.250 # | 8.771 ± 0.354 #* |
| Final | 13.01 ± 0.743 & | 13.55 ± 0.420 & | 15.51 ± 0.550 &# | 15.08 ± 0.444 &# | |
| RV Length | Initial | 3.500 ± 0.192 | 3.780 ± 0.142 | 5.066 ± 0.142 # | 4.006 ± 0.213 * |
| Final | 6.344 ± 0.449 & | 6.200 ± 0.291 & | 7.576 ± 0.266 &# | 6.952 ± 0.274 &#* | |
| LV Length | Initial | 3.764 ± 0.135 | 3.845 ± 0.139 | 5.329 ± 0.182 # | 4.553 ± 0.297 * |
| Final | 6.175 ± 0.340 & | 6.679 ± 0.357 & | 8.255 ± 0.295 &# | 7.931 ± 0.305 &# | |
| Total Width | Initial | 5.871 ± 0.283 | 6.327 ± 0.163 | 7.703 ± 0.220 # | 7.082 ± 0.247 |
| Final | 10.20 ± 0.436 & | 10.99 ± 0.250 & | 10.91 ± 0.293 & | 10.96 ± 0.292 & | |
| RV Width | Initial | 1.907 ± 0.097 | 2.408 ± 0.107 | 2.042 ± 0.100 | 1.903 ± 0.131 # |
| Final | 3.569 ± 0.193 & | 3.922 ± 0.219 & | 3.157 ± 0.177 & | 3.270 ± 0.135 &# | |
| LV Width | Initial | 2.143 ± 0.132 | 2.487 ± 0.126 | 2.063 ± 0.126 | 2.050 ± 0.148 |
| Final | 3.244 ± 0.156 & | 4.232 ± 0.265 &* | 3.045 ± 0.206 & | 3.575 ± 0.186 &#* | |
| LV EDT | Initial | 0.859 ± 0.059 | 0.714 ± 0.036 | 0.776 ± 0.052 | 0.756 ± 0.027 |
| Final | 1.114 ± 0.053 & | 1.048 ± 0.049 & | 1.048 ± 0.056 & | 1.033 ± 0.044 & | |
| LV EST | Initial | 1.086 ± 0.061 | 0.971 ± 0.035 | 0.828 ± 0.057 # | 0.866 ± 0.030 |
| Final | 1.623 ± 0.085 & | 1.629 ± 0.065 & | 1.202 ± 0.055 &# | 1.203 ± 0.051 &# | |
| LV EDD | Initial | 2.062 ± 0.120 | 2.033 ± 0.125 | 2.887 ± 0.142 | 2.692 ± 0.179 |
| Final | 3.310 ± 0.307 & | 3.490 ± 0.154 & | 3.930 ± 0.195 & | 3.897 ± 0.152 & | |
| LV ESD | Initial | 1.179 ± 0.144 | 1.079 ± 0.100 | 2.221 ± 0.194 # | 1.943 ± 0.128 # |
| Final | 1.846 ± 0.194 & | 1.960 ± 0.111 & | 3.168 ± 0.195 &# | 2.845 ± 0.127 &# | |
| Vehicle | Melatonin | ||||
|---|---|---|---|---|---|
| Parameter | Ultrasound | Normoxia | Hypoxia | Normoxia | Hypoxia |
| Mitral E/A Index | Initial | 0.517 ± 0.023 | 0.568 ± 0.021 | 0.652 ± 0.045 | 0.622 ± 0.025 |
| Final | 0.609 ± 0.028 | 0.643 ± 0.032 | 0.719 ± 0.093 | 0.718 ± 0.040 | |
| MAPSE (mm) | Initial | 1.146 ± 0.067 | 1.348 ± 0.112 | 1.325 ± 0.122 | 1.380 ± 0.102 |
| Final | 1.561 ± 0.129 & | 1.979 ± 0.078 &* | 2.267 ± 0.328 &# | 1.960 ± 0.129 & | |
| LV Tei Index | Initial | 0.549 ± 0.027 | 0.566 ± 0.031 | 0.508 ± 0.052 | 0.572 ± 0.054 |
| Final | 0.601 ± 0.019 | 0.603 ± 0.020 | 0.573 ± 0.043 | 0.533 ± 0.030 | |
| Shortening Fraction (%) | Initial | 45.34 ± 4.004 | 49.57 ± 3.561 | 25.77 ± 3.282 # | 27.06 ± 2.418 # |
| Final | 42.64 ± 4.198 | 43.39 ± 2.514 | 18.77 ± 3.203 # | 25.32 ± 1.283 # | |
| Acceleration Time (ms) | Initial | 27.72 ± 2.601 | 24.58 ± 2.099 | 30.45 ± 1.248 | 29.10 ± 1.096 |
| Final | 20.76 ± 3.352 | 26.06 ± 2.831 | 35.92 ± 4.626 # | 32.029 ± 2.70 | |
| Aortic Vmean (cm/s) | Initial | 20.65 ± 2.142 | 22.75 ± 1.433 | 16.11 ± 0.921 | 16.68 ± 0.524 # |
| Final | 22.18 ± 2.220 | 27.19 ± 1.804 * | 17.61 ± 1.020 | 17.47 ± 0.955 # | |
| Aortic Vmax (cm/s) | Initial | 33.08 ± 3.189 | 31.98 ± 2.319 | 26.19 ± 1.479 | 24.53 ± 0.814 # |
| Final | 37.11 ± 3.063 | 40.33 ± 2.554 & | 27.36 ± 1.786 # | 27.78 ± 1.569 # | |
| LVOT (mm) | Initial | 1.157 ± 0.035 | 1.263 ± 0.040 # | 1.750 ± 0.073 | 1.417 ± 0.059 * |
| Final | 2.063 ± 0.076 & | 1.981 ± 0.049 & | 2.300 ± 0.138 &# | 2.254 ± 0.073 &# | |
| Vehicle | Melatonin | |||
|---|---|---|---|---|
| mRNA | Normoxia | Hypoxia | Normoxia | Hypoxia |
| Cat | 1.000 ± 0.444 | 1.198 ± 0.382 | 2.527 ± 1.044 | 1.514 ± 0.168 |
| Gpx1 | 1.000 ± 0.277 | 3.654 ± 1.395 | 12.086 ± 5.322 # | 4.275 ± 0.558 |
| Gpx2 | 1.000 ± 0.184 | 2.439 ± 0.782 | 3.188 ± 1.003 | 4.576 ± 2.68 |
| Gpx3 | 1.000 ± 0.372 | 2.870 ± 1.297 | 11.993 ± 5.904 | 1.513 ± 0.403 |
| Gpx4 | 1.000 ± 0.376 | 1.197 ± 0.415 | 6.041 ± 2.707 | 1.702 ± 0.593 |
| Sod1 | 1.000 ± 0.240 | 1.960 ± 1.001 | 6.895 ± 3.457 | 1.593 ± 0.477 |
| Sod2 | 1.000 ± 0.393 | 3.106 ± 0.908 | 5.134 ± 2.350 | 3.831 ± 1.383 |
| Hmox1 | 1.000 ± 0.182 | 2.807 ± 0.783 | 5.512 ± 2.084 # | 1.819 ± 0.635 * |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2026 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license.
Share and Cite
Paz, A.A.; Jiménez, T.A.; Herrera, P.; Carreño, J.; Cornejo, D.; Ibarra-González, J.; Ponce, J.N.; Beñaldo, F.A.; Salamanca, M.; Jeria, R.; et al. Prenatal Melatonin Modulates Cardiovascular Function and Oxidative Stress in Guinea Pig Neonates Under Normoxic and Hypoxic Gestation. Antioxidants 2026, 15, 162. https://doi.org/10.3390/antiox15020162
Paz AA, Jiménez TA, Herrera P, Carreño J, Cornejo D, Ibarra-González J, Ponce JN, Beñaldo FA, Salamanca M, Jeria R, et al. Prenatal Melatonin Modulates Cardiovascular Function and Oxidative Stress in Guinea Pig Neonates Under Normoxic and Hypoxic Gestation. Antioxidants. 2026; 15(2):162. https://doi.org/10.3390/antiox15020162
Chicago/Turabian StylePaz, Adolfo A., Tamara A. Jiménez, Pedro Herrera, Josefa Carreño, Damaris Cornejo, Julieta Ibarra-González, Javiera N. Ponce, Felipe A. Beñaldo, Mario Salamanca, Rodrigo Jeria, and et al. 2026. "Prenatal Melatonin Modulates Cardiovascular Function and Oxidative Stress in Guinea Pig Neonates Under Normoxic and Hypoxic Gestation" Antioxidants 15, no. 2: 162. https://doi.org/10.3390/antiox15020162
APA StylePaz, A. A., Jiménez, T. A., Herrera, P., Carreño, J., Cornejo, D., Ibarra-González, J., Ponce, J. N., Beñaldo, F. A., Salamanca, M., Jeria, R., Figueroa, E. G., González-Candia, A., & Herrera, E. A. (2026). Prenatal Melatonin Modulates Cardiovascular Function and Oxidative Stress in Guinea Pig Neonates Under Normoxic and Hypoxic Gestation. Antioxidants, 15(2), 162. https://doi.org/10.3390/antiox15020162

