The Extract from the Stem and Leaf of Paeonia lactiflora Pall Has Demonstrated an Anti-Oxidative Stress Effect in Alleviating Diarrhea by Regulating the Gut-Liver Axis
Abstract
1. Introduction
2. Materials and Methods
2.1. Plant Material
2.2. Extract Preparation
2.3. Animal Testing and Grouping
2.4. Sample Collection
2.5. Determination of Growth Performance and Organ Indices
2.6. Calculation of Diarrhea Rate
2.7. Morphologic Observation of Jejunal and Liver Tissues
2.8. Biochemical Analysis
2.9. Determination of Related mRNA Expression Levels
2.10. Detection of SCFAs in Cecum Contents
2.11. 16S rRNA Sequencing of Cecum Contents
2.12. Correlation Analysis
2.13. Statistical Analysis
3. Results
3.1. Effects of PLE on Broiler Growth Performance and Relative Organ Weights
3.2. Preventive Effect of PLE on Oxidative Stress Diarrhea in Broilers
3.2.1. Effect of PLE on Diarrhea Rate in Broilers
3.2.2. Effect of PLE on DQ-Induced Oxidative Stress Damage in Serum
3.2.3. Effect of PLE on DQ-Induced Oxidative Stress Damage in Liver Tissues
3.2.4. Effect of PLE on DQ-Induced Oxidative Stress Damage in the Intestinal Tissue
3.2.5. Effect of PLE on the Content of SCFAs
3.2.6. Effects of PLE on Gut Microbiota
3.3. Mechanism of PLE in Preventing Oxidative Stress-Induced Diarrhea
3.3.1. Network Pharmacology Predicts the Signaling Pathway of PLE Prevention of Oxidative Stress
3.3.2. Validation of Key Targets of the PI3K-Akt-Nrf2 Signaling Pathway
3.3.3. Correlation Analysis of Gut Bacteria, Oxidative Stress Biomarkers, Key Targets of the PI3K-AKT-Nrf2 Signal Pathway, and SCFAs
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Wang, K.; Tang, Y.; Wu, X.; Liang, H.; Chen, D.; Yu, B.; He, J.; Mao, X.; Huang, Z.; Yan, H.; et al. Eugenol Attenuates Transmissible Gastroenteritis Virus-Induced Oxidative Stress and Apoptosis Via ROS-NRF2-ARE Signaling. Antioxidants 2022, 11, 1838. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ringseis, R.; Eder, K. Heat stress in pigs and broilers: Role of gut dysbiosis in the impairment of the gut-liver axis and restoration of these effects by probiotics, prebiotics and synbiotics. J. Anim. Sci. Biotechnol. 2022, 13, 126. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zhang, H.Y.; Zhang, Y.; Zhang, Y.; Jiang, Z.P.; Cui, Y.L.; Wang, Q.S. ROS-responsive thioketal-linked alginate/chitosan carriers for irritable bowel syndrome with diarrhea therapy. Int. J. Biol. Macromol. 2022, 209 Pt A, 70–82. [Google Scholar] [CrossRef] [Scilit]
- Jeon, Y.D.; Lee, J.H.; Lee, Y.M.; Kim, D.K. Puerarin inhibits inflammation and oxidative stress in dextran sulfate sodium-induced colitis mice model. Biomed. Pharmacother. 2020, 124, 109847. [Google Scholar] [CrossRef] [Scilit]
- Tong, N.N.; Zhou, X.Y.; Peng, L.P.; Liu, Z.A.; Shu, Q.Y. A comprehensive study of three species of Paeonia stem and leaf phytochemicals, and their antioxidant activities. J. Ethnopharmacol. 2021, 273, 113985. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wu, Y.; Jiang, Y.; Zhang, L.; Zhou, J.; Yu, Y.; Zhou, Y.; Kang, T. Chemical Profiling and Antioxidant Evaluation of Paeonia lactiflora Pall. “Zhongjiang” by HPLC–ESI–MS Combined with DPPH Assay. J. Chromatogr. Sci. 2021, 59, 795–805. [Google Scholar] [CrossRef] [Scilit]
- Yuan, Y.; Zhai, Y.; Chen, J.; Xu, X.; Wang, H. Kaempferol Ameliorates Oxygen-Glucose Deprivation/Reoxygenation-Induced Neuronal Ferroptosis by Activating Nrf2/SLC7A11/GPX4 Axis. Biomolecules 2021, 11, 923. [Google Scholar] [CrossRef] [Scilit]
- Jia, Z.; He, J. Paeoniflorin ameliorates rheumatoid arthritis in rat models through oxidative stress, inflammation and cyclooxygenase 2. Exp. Ther Med. 2016, 11, 655–659. [Google Scholar] [CrossRef] [Scilit]
- Li, J.Z.; Yu, S.Y.; Wu, J.H.; Shao, Q.R.; Dong, X.M. Paeoniflorin protects myocardial cell from doxorubicin-induced apoptosis through inhibition of NADPH oxidase. Can. J. Physiol. Pharmacol. 2012, 90, 1569–1575. [Google Scholar] [CrossRef] [Scilit]
- Liu, M.; Zhou, J.; Li, Y.; Ding, Y.; Lian, J.; Dong, Q.; Qu, Q.; Lv, W.; Guo, S. Effects of dietary polyherbal mixtures on growth performance, antioxidant capacity, immune function and jejunal health of yellow-feathered broilers. Poult. Sci. 2023, 102, 102714. [Google Scholar] [CrossRef] [Scilit]
- Ruan, D.; Fan, Q.L.; Zhang, S.; Ei-Senousey, H.K.; Fouad, A.M.; Lin, X.J.; Dong, X.L.; Deng, Y.F.; Yan, S.J.; Zheng, C.T.; et al. Dietary isoleucine supplementation enhances growth performance, modulates the expression of genes related to amino acid transporters and protein metabolism, and gut microbiota in yellow-feathered chickens. Poult. Sci. 2023, 102, 102774. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Baek, J.; Lee, M.G. Oxidative stress and antioxidant strategies in dermatology. Redox Rep. 2016, 21, 164–169. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Li, X.; Wang, C.; Zhu, J.; Lin, Q.; Yu, M.; Wen, J.; Feng, J.; Hu, C. Sodium Butyrate Ameliorates Oxidative Stress-Induced Intestinal Epithelium Barrier Injury and Mitochondrial Damage through AMPK-Mitophagy Pathway. Oxid. Med. Cell Longev. 2022, 2022, 3745135. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Honda, M.; Kubes, P. Neutrophils and neutrophil extracellular traps in the liver and gastrointestinal system. Nat. Rev. Gastroenterol. Hepatol. 2018, 15, 206–221. [Google Scholar] [CrossRef] [Scilit]
- Diaz De Barboza, G.; Guizzardi, S.; Moine, L.; Tolosa de Talamoni, N. Oxidative stress, antioxidants and intestinal calcium absorption. World J. Gastroenterol. 2017, 23, 2841–2853. [Google Scholar] [CrossRef] [Scilit]
- Bai, D.H.; Chen, T.T.; Sun, Y.S.; Zhang, T.T.; Sheng, Y.J.; Hao, M.J. Effects of Diquat-Induced Oxidative Stress on Performance, Liver Function, Immune Function, and Antioxidant Capacity of Broilers. China Vet. J. 2024, 60, 58–65. [Google Scholar]
- Qin, W.; Xu, B.; Chen, Y.; Yang, W.; Xu, Y.; Huang, J.; Duo, T.; Mao, Y.; Zhou, G.; Yan, X.; et al. Dietary ellagic acid supplementation attenuates intestinal damage and oxidative stress by regulating gut microbiota in weanling piglets. Anim. Nutr. 2022, 11, 322–333. [Google Scholar] [CrossRef] [Scilit]
- Chen, D.; Chen, X.; Tu, Y.; Wang, B.; Lou, C.; Ma, T.; Diao, Q. Effects of mulberry leaf flavonoid and resveratrol on methane emission and nutrient digestion in sheep. Anim. Nutr. 2015, 1, 362–367. [Google Scholar] [CrossRef] [Scilit]
- Zhang, L.Z.; Gong, J.G.; Li, J.H.; Hao, Y.S.; Xu, H.J.; Liu, Y.C.; Feng, Z.H. Dietary resveratrol supplementation on growth performance, immune function and intestinal barrier function in broilers challenged with lipopolysaccharide. Poult. Sci. 2023, 102, 102968. [Google Scholar] [CrossRef] [Scilit]
- Shi, L.; Jin, X.; Xu, Y.; Xing, Y.; Yan, S.; Guo, Y.; Cheng, Y.; Shi, B. Effects of Total Flavonoids of Artemisia ordosica on Growth Performance, Oxidative Stress, and Antioxidant Status of Lipopolysaccharide-Challenged Broilers. Antioxidants 2022, 11, 1985. [Google Scholar] [CrossRef] [Scilit]
- Awad, W.A.; Hess, C.; Hess, M. Enteric Pathogens and Their Toxin-Induced Disruption of the Intestinal Barrier through Alteration of Tight Junctions in Chickens. Toxins 2017, 9, 60. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- An, J.; Liu, Y.; Wang, Y.; Fan, R.; Hu, X.; Zhang, F.; Yang, J.; Chen, J. The Role of Intestinal Mucosal Barrier in Autoimmune Disease: A Potential Target. Front. Immunol. 2022, 13, 871713. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Yang, G.; Bibi, S.; Du, M.; Suzuki, T.; Zhu, M.J. Regulation of the intestinal tight junction by natural polyphenols: A mechanistic perspective. Crit. Rev. Food Sci. Nutr. 2017, 57, 3830–3839. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ingegneri, M.; Braghini, M.R.; Piccione, M.; De Stefanis, C.; Mandrone, M.; Chiocchio, I.; Poli, F.; Imbesi, M.; Alisi, A.; Smeriglio, A.; et al. Citrus Pomace as a Source of Plant Complexes to Be Used in the Nutraceutical Field of Intestinal Inflammation. Antioxidants 2024, 13, 869. [Google Scholar] [CrossRef] [Scilit]
- Gāliņa, D.; Ansonska, L.; Valdovska, A. Effect of Probiotics and Herbal Products on Intestinal Histomorphological and Immunological Development in Piglets. Vet. Med. Int. 2020, 2020, 3461768. [Google Scholar] [CrossRef] [Scilit]
- Ismail, H.T.H.; Mahboub, H.H.H. Effect of acute exposure to nonylphenol on biochemical, hormonal, and hematological parameters and muscle tissues residues of Nile tilapia; Oreochromis niloticus. Vet. World 2016, 9, 616–625. [Google Scholar] [CrossRef] [Scilit]
- Huang, D.; Zhu, J.; Zhang, L.; Ge, X.; Ren, M.; Liang, H. Dietary Supplementation with Eucommia ulmoides Leaf Extract Improved the Intestinal Antioxidant Capacity, Immune Response, and Disease Resistance against Streptococcus agalactiae in Genetically Improved Farmed Tilapia (GIFT; Oreochromis niloticus). Antioxidants 2022, 11, 1800. [Google Scholar] [CrossRef] [Scilit]
- Brigelius-Flohé, R.; Flohé, L. Regulatory Phenomena in the Glutathione Peroxidase Superfamily. Antioxid. Redox Signal. 2020, 33, 498–516. [Google Scholar] [CrossRef] [Scilit]
- Wang, Y.; Branicky, R.; Noë, A.; Hekimi, S. Superoxide dismutases: Dual roles in controlling ROS damage and regulating ROS signaling. J. Cell Biol. 2018, 217, 1915–1928. [Google Scholar] [CrossRef] [Scilit]
- Circu, M.L.; Maloney, R.E.; Aw, T.Y. Diquat-induced cellular pyridine nucleotide redox changes and alteration of metabolic enzyme activities in colonic carcinoma cells. Chem. Biol. Interact. 2017, 264, 43–51. [Google Scholar] [CrossRef] [Scilit]
- Zhang, D.I.; Li, C.; Shi, R.; Zhao, F.; Yang, Z. Lactobacillus fermentum JX306 Restrain D-galactose-induced Oxidative Stress of Mice through its Antioxidant Activity. Pol. J. Microbiol. 2020, 69, 205–215. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Liu, L.; Yuan, Y.; Tao, J. Flavonoid-Rich Extract of Paeonia lactiflora Petals Alleviate d-Galactose-Induced Oxidative Stress and Restore Gut Microbiota in ICR Mice. Antioxidants 2021, 10, 1889. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zhang, X.F.; Tang, Y.J.; Guan, X.X.; Lu, X.; Li, J.; Chen, X.L.; Deng, J.L.; Fan, J.M. Flavonoid constituents of Amomum tsao-ko Crevost et Lemarie and their antioxidant and antidiabetic effects in diabetic rats—In vitro and in vivo studies. Food Funct. 2022, 13, 437–450. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Daud, M.; Majeed, W.; Awan, A.M.; Aslam, B.; Abdullah, M.; Syed, M.; Iqbal, H.; Roobi, A.; Kanwal, H.A.; Aslam, N. Antioxidant and Hepatoprotective Activities of Acacia jacquemontii Stem Extract against High-fat and CCl4-induced Liver Injury in Rat’s Model. Endocr. Metab. Immune Disord. Drug Targets 2023, 23, 77–85. [Google Scholar]
- Zhang, W.; Xiao, S.; Ahn, D.U. Protein oxidation: Basic principles and implications for meat quality. Crit. Rev. Food Sci. Nutr. 2013, 53, 1191–1201. [Google Scholar] [CrossRef] [Scilit]
- Broom, L.J.; Kogut, M.H. The role of the gut microbiome in shaping the immune system of chickens. Vet. Immunol. Immunopathol. 2018, 204, 44–51. [Google Scholar] [CrossRef] [Scilit]
- Wu, F.; Zhao, M.; Tang, Z.; Wang, F.; Han, S.; Liu, S.; Chen, B. Curcumin alleviates cecal oxidative injury in diquat-induced broilers by regulating the Nrf2/ARE pathway and microflora. Poult. Sci. 2024, 103, 103651. [Google Scholar] [CrossRef] [Scilit]
- Carlier, J.P.; Bedora-Faure, M.; K’ouas, G.; Alauzet, C.; Mory, F. Proposal to unify Clostridium orbiscindens Winter et al. 1991 and Eubacterium plautii (Séguin 1928) Hofstad and Aasjord 1982, with description of Flavonifractor plautii gen. nov., comb. nov., and reassignment of Bacteroides capillosus to Pseudoflavonifractor capillosus gen. nov., comb. nov. Int. J. Syst. Evol. Microbiol. 2010, 60 Pt 3, 585–590. [Google Scholar]
- Zhao, J.; Zhao, F.; Li, X.; Yuan, J.; Zhang, K.; Liu, H.; Wang, Y. Multi-omics reveals the mechanisms underlying Lactiplantibacillus plantarum P8-mediated attenuation of oxidative stress in broilers challenged with dexamethasone. Anim. Nutr. 2023, 14, 281–302. [Google Scholar] [CrossRef] [Scilit]
- Tan, C.; Wei, H.; Ao, J.; Long, G.; Peng, J. Inclusion of Konjac Flour in the Gestation Diet Changes the Gut Microbiota, Alleviates Oxidative Stress, and Improves Insulin Sensitivity in Sows. Appl. Environ. Microbiol. 2016, 82, 5899–5909. [Google Scholar] [CrossRef] [Scilit]
- Fiorucci, S.; Carino, A.; Baldoni, M.; Santucci, L.; Costanzi, E.; Graziosi, L.; Distrutti, E.; Biagioli, M. Bile Acid Signaling in Inflammatory Bowel Diseases. Dig. Dis. Sci. 2021, 66, 674–693. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Morrison, D.J.; Preston, T. Formation of short chain fatty acids by the gut microbiota and their impact on human metabolism. Gut Microbes 2016, 7, 189–200. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Cook, S.I.; Sellin, J.H. Review article: Short chain fatty acids in health and disease. Aliment. Pharmacol. Ther. 1998, 12, 499–507. [Google Scholar] [CrossRef] [Scilit]
- Hu, S.; Kuwabara, R.; De Haan, B.J.; Smink, A.M.; de Vos, P. Acetate and Butyrate Improve β-cell Metabolism and Mitochondrial Respiration under Oxidative Stress. Int. J. Mol. Sci. 2020, 21, 1542. [Google Scholar] [CrossRef] [Scilit]
- Liu, J.; Liang, S.; Qin, K.; Jia, B.; Ren, Z.; Yang, X.; Yang, X. Acer truncatum leaves extract modulates gut microbiota, improves antioxidant capacity, and alleviates lipopolysaccharide-induced inflammation in broilers. Poult. Sci. 2023, 102, 102951. [Google Scholar] [CrossRef] [Scilit]
- Galicia-Moreno, M.; Lucano-Landeros, S.; Monroy-Ramirez, H.C.; Silva-Gomez, J.; Gutierrez-Cuevas, J.; Santos, A.; Armendariz-Borunda, J. Roles of Nrf2 in Liver Diseases: Molecular, Pharmacological, and Epigenetic Aspects. Antioxidants 2020, 9, 980. [Google Scholar] [CrossRef] [Scilit]
- Kim, J.W.; Li, M.H.; Jang, J.H.; Na, H.K.; Song, N.Y.; Lee, C.; Johnson, J.A.; Surh, Y.J. 15-Deoxy-Delta(12,14)-prostaglandin J(2) rescues PC12 cells from H2O2-induced apoptosis through Nrf2-mediated upregulation of heme oxygenase-1: Potential roles of Akt and ERK1/2. Biochem. Pharmacol. 2008, 76, 1577–1589. [Google Scholar] [CrossRef] [Scilit]
- Li, J.; Wang, T.; Liu, P.; Yang, F.; Wang, X.; Zheng, W.; Sun, W. Hesperetin ameliorates hepatic oxidative stress and inflammation via the PI3K/AKT-Nrf2-ARE pathway in oleic acid-induced HepG2 cells and a rat model of high-fat diet-induced NAFLD. Food Funct. 2021, 12, 3898–3918. [Google Scholar] [CrossRef] [Scilit]









| Gene | Primer Sequence (5′-3′) |
|---|---|
| MUC2 | F: AATGCTGAGTTCTTGCCTAA |
| R: TGTTGCAGTTCATATCCTGGT | |
| ZO-1 | F: CCACTGCCTACACCACCATCTC |
| R: CGTGTCACTGGGGTCCTTCAT | |
| Occludin | F: CCTCATCGTCATCCTGCTCT |
| R: GGTCCCAGTAGATGTTGGCT | |
| Claudin 1 | F: GGGGACAACATCGTGACCG |
| R: AGGAGTCGAAGACTTTGCACT | |
| SOD | F: TTGTCTGATGGAGATCATGGCTTC |
| R: TGCTTGCCTTCAGGATTAAAGTGA | |
| CAT | F: GTTGGCGGTAGGAGTCTGGTCT |
| R: GTGGTCAAGGCATCTGGCTTCTG | |
| GSH-Px | F: AACCAATTCGGGCACCAG |
| R: CCGTTCACCTCGCACTTCTC | |
| PI3K | F: CGGATGTTGCCTTACGGTTGT |
| R: GTTCTTGTCCTTGAGCCACTGAT | |
| AKT | F: TCACTCCTCCTGACCAAGATGACAG |
| R: GCGGTTCCACTGGCTGAATAGG | |
| Nrf2 | F: GATGTCACCCTGCCCTTAG |
| R: CTGCCACCATGTTATTCC | |
| Keap1 | F: CTGCTGGAGTTCGCCTACAC |
| R: CACGCTGTCGATCTGGTACA | |
| HO-1 | F: CACTCTGGAGATGACACCTGAG |
| R: GTGTTCCTCTGTCAGCATCACC | |
| NQO1 | F: TCGCCGAGCAGAAGAAGATTGAAG |
| R: CGGTGGTGAGTGACAGCATGG | |
| GADPH | F: GACCACTGTCCATGCCATCA |
| R: AACTGAGCGGTGGTGAAGAG |
| Item | CON | DQ | PLE | p |
|---|---|---|---|---|
| ADG(g/d) | 84.59 ± 1.14 bc | 84.21 ± 1.75 c | 90.62 ± 1.60 a | <0.01 |
| ADFI(g/d) | 114.11 ± 3.59 | 112.64 ± 3.17 | 108.23 ± 3.54 | >0.05 |
| F/G(g/g) | 1.36 ± 0.03 a | 1.35 ± 0.03 a | 1.19 ± 0.02 b | <0.01 |
| Liver index (mg/g) | 20.12 ± 0.41 b | 20.20 ± 0.56 b | 23.92 ± 0.64 a | <0.001 |
| Kidney index (mg/g) | 1.22 ± 0.06 b | 1.18 ± 0.06 b | 2.09 ± 0.07 a | <0.001 |
| Spleen index (mg/g) | 1.04 ± 0.12 | 1.08 ± 0.08 | 1.07 ± 0.27 | >0.05 |
| Thymus index (mg/g) | 4.45 ± 0.12 a | 3.07 ± 0.07 b | 4.91 ± 0.41 a | <0.001 |
| Thymus index (mg/g) | 0.58 ± 0.08 | 0.54 ± 0.02 | 0.54 ± 0.01 | >0.05 |
| Category | Compound Name | Molecular Formula |
|---|---|---|
| Polyphenolic compounds | Chlorogenic acid | C16H18O9 |
| Pyrogallol | C6H6O3 | |
| Syringic acid | C9H10O5 | |
| Caulophyllogenin | C6H6O2 | |
| Hydroxycinnamic acid | C9H8O3 | |
| (−)-catechin | C15H14O6 | |
| Ellagic acid | C14H6O8 | |
| Resveratrol | C14H12O3 | |
| Piceatannol | C14H12O4 | |
| Ferulic acid | C10H10O4 | |
| 5-Hydroxyferulate | C10H10O5 | |
| 2-Hydroxycinnamic acid | C9H8O3 | |
| Flavonoids | (+/−)-Naringenin | C15H12O5 |
| Kaempferol | C15H10O6 | |
| 2-(3-Hydroxyphenyl)-6-methyl-4H-chromen-4-one | C6H12O3 | |
| Quercetin | C15H10O7 | |
| Taxifolin | C15H12O7 | |
| Xanthurenic acid | C10H7NO4 | |
| Genistein | C15H10O5 | |
| Organic acids | 2-isopropylmalic acid | C7H12O5 |
| Hexahydro-1,3,4,5-tetrahydroxybenzoic acid | C6H8O2 | |
| Cis-4-coumaric acid | C9H8O3 | |
| Benzoic acid | C7H6O2 | |
| Lauric acid | C12H24O2 | |
| (S)-(−)-PERILLIC ACID | C10H14O2 | |
| Azelaic acid | C9H16O4 | |
| Organic acids | Oxypaeoniflorin | C23H28O12 |
| 6′-O-Glucopyranosylalbiflorin | C29H38O16 | |
| Paeoniflorin | C23H28O11 | |
| Galloylalbiflorin | C30H32O15 | |
| Benzoylpaeoniflorin | C30H32O12 | |
| Astragalin | C21H20O11 | |
| Salidroside | C14H20O7 | |
| Cyanidin3-O-rutinoside | C27H30O15 | |
| albiflorin | C23H28O11 | |
| Picroside II | C23H28O13 | |
| Other compounds | (S)-10-Hydroxycamptothecin | C20H16N2O5 |
| Coumarin | C9H6O2 | |
| 4-Isopropylbenzaldehyde | C10H12O | |
| Caprolactam | C6H11NO | |
| L(−)-Carvone | C10H14O | |
| Pleuromutilin | C22H34O5 | |
| CARMINIC ACID | C22H20O13 | |
| Coniferyl alcohol | C10H12O3 | |
| Costunolide | C15H20O2 | |
| Genistein | C15H10O5 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Wang, M.-H.; Liu, L.; Li, J.; Zhou, W.-W.; Tian, W.; Zhao, J.-H.; Li, X.-M. The Extract from the Stem and Leaf of Paeonia lactiflora Pall Has Demonstrated an Anti-Oxidative Stress Effect in Alleviating Diarrhea by Regulating the Gut-Liver Axis. Antioxidants 2025, 14, 592. https://doi.org/10.3390/antiox14050592
Wang M-H, Liu L, Li J, Zhou W-W, Tian W, Zhao J-H, Li X-M. The Extract from the Stem and Leaf of Paeonia lactiflora Pall Has Demonstrated an Anti-Oxidative Stress Effect in Alleviating Diarrhea by Regulating the Gut-Liver Axis. Antioxidants. 2025; 14(5):592. https://doi.org/10.3390/antiox14050592
Chicago/Turabian StyleWang, Ming-Hua, Ling Liu, Jun Li, Wei-Wei Zhou, Wei Tian, Jin-Hua Zhao, and Xiu-Mei Li. 2025. "The Extract from the Stem and Leaf of Paeonia lactiflora Pall Has Demonstrated an Anti-Oxidative Stress Effect in Alleviating Diarrhea by Regulating the Gut-Liver Axis" Antioxidants 14, no. 5: 592. https://doi.org/10.3390/antiox14050592
APA StyleWang, M.-H., Liu, L., Li, J., Zhou, W.-W., Tian, W., Zhao, J.-H., & Li, X.-M. (2025). The Extract from the Stem and Leaf of Paeonia lactiflora Pall Has Demonstrated an Anti-Oxidative Stress Effect in Alleviating Diarrhea by Regulating the Gut-Liver Axis. Antioxidants, 14(5), 592. https://doi.org/10.3390/antiox14050592

