Therapeutic and Pharmaceutical Potential of Scutellaria baicalensis-Derived Exosomes for Oily Skin Disorders
Abstract
1. Introduction
2. Materials and Methods
2.1. Scutellaria baicalensis Extraction and Cell Culture
2.2. Establishment of Treating Doses and Purification of Induced Exosomes
2.3. Flowcytometry
2.4. Conventional PCR
2.5. Oil Red O Stain
2.6. Enzyme Immunosorbent Assay
2.7. Profiling of miRNAs in SBEIEs and Transfection of miRNA Candidates
2.8. Evaluation of Clinical Effects by the Induced Exosomes
2.9. Statistics
3. Results
3.1. Modulation of Lipogenic Cytokines by Two Materials
3.2. Modulation of Lipogenesis by SBEIEs in ASCs
3.3. Immune Modulation of SBEIEs
3.4. miRNA Profiling and Their Characteristics in SBEIEs
3.5. Clinical Effects of SBEIEs
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Zuk, P.A.; Zhu, M.; Mizuno, H.; Huang, J.; Futrell, J.W.; Katz, A.J.; Benhaim, P.; Lorenz, H.P.; Hedrick, M.H. Multilineage cells from human adipose tissue: Implications for cell-based therapies. Tissue Eng. 2001, 7, 211–228. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Rodeheffer, M.S.; Birsoy, K.; Friedman, J.M. Identification of white adipocyte progenitor cells in vivo. Cell 2008, 135, 240–249. [Google Scholar] [CrossRef] [Scilit]
- Berry, D.C.; Stenesen, D.; Zeve, D.; Graff, J.M. The developmental origins of adipose tissue. Development 2013, 140, 3939–3949. [Google Scholar] [CrossRef] [Scilit]
- Tchkonia, T.; Thomou, T.; Zhu, Y.; Karagiannides, I.; Pothoulakis, C.; Jensen, M.D.; Kirkland, J.L. Mechanisms and metabolic implications of regional differences among fat depots. Cell Metab. 2013, 17, 644–656. [Google Scholar] [CrossRef] [Scilit]
- Wozniak, S.E.; Gee, L.L.; Wachtel, M.S.; Frezza, E.E. Adipose tissue: The new endocrine organ? A review article. Dig. Dis. Sci. 2009, 54, 1847–1856. [Google Scholar] [CrossRef] [Scilit]
- Eder, K.; Baffy, N.; Falus, A.; Fulop, A.K. The major inflammatory mediator interleukin-6 and obesity. Inflamm. Res. 2009, 58, 727–736. [Google Scholar] [CrossRef] [Scilit]
- Kim, D.-W.; Jeon, B.-J.; Hwang, N.-H.; Kim, M.-S.; Park, S.-H.; Dhong, E.-S.; Yoon, E.-S.; Lee, B.-I. Adipose-derived stem cells inhibit epidermal melanocytes through an interleukin-6–mediated mechanism. Plast. Reconstr. Surg. 2014, 134, 470–480. [Google Scholar] [CrossRef] [Scilit]
- Hotamisligil, G.S. Inflammation and metabolic disorders. Nature 2006, 444, 860–867. [Google Scholar] [CrossRef] [Scilit]
- Cataldi, S.; Aprile, M.; Melillo, D.; Mucel, I.; Giorgetti-Peraldi, S.; Cormont, M.; Italiani, P.; Blüher, M.; Tanti, J.-F.; Ciccodicola, A. TNFα mediates inflammation-induced effects on PPARG splicing in adipose tissue and mesenchymal precursor cells. Cells 2021, 11, 42. [Google Scholar] [CrossRef] [Scilit]
- Song, A.; Park, Y.; Kim, B.; Lee, S.G. Modulation of lipid metabolism by trans-anethole in hepatocytes. Molecules 2020, 25, 4946. [Google Scholar] [CrossRef] [Scilit]
- Rada, T.; Reis, R.L.; Gomes, M.E. Adipose tissue-derived stem cells and their application in bone and cartilage tissue engineering. Tissue Eng. Part B Rev. 2009, 15, 113–125. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Owczarczyk-Saczonek, A.; Wociór, A.; Placek, W.; Maksymowicz, W.; Wojtkiewicz, J. The use of adipose-derived stem cells in selected skin diseases (vitiligo, alopecia, and nonhealing wounds). Stem Cells Int. 2017, 2017, 4740709. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Sullivan, J.V.; Myers, S. Skin structure and function, wound healing and scarring. In Plastic Surgery-Principles and Practice; Elsevier: Amsterdam, The Netherlands, 2022; pp. 1–14. [Google Scholar]
- Tang, P.; Virtue, S.; Goie, J.Y.G.; Png, C.W.; Guo, J.; Li, Y.; Jiao, H.; Chua, Y.L.; Campbell, M.; Moreno-Navarrete, J.M. Regulation of adipogenic differentiation and adipose tissue inflammation by interferon regulatory factor 3. Cell Death Differ. 2021, 28, 3022–3035. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Koh, Y.-C.; Yang, G.; Lai, C.-S.; Weerawatanakorn, M.; Pan, M.-H. Chemopreventive effects of phytochemicals and medicines on M1/M2 polarized macrophage role in inflammation-related diseases. Int. J. Mol. Sci. 2018, 19, 2208. [Google Scholar] [CrossRef] [Scilit]
- Kong, P.; Cui, Z.-Y.; Huang, X.-F.; Zhang, D.-D.; Guo, R.-J.; Han, M. Inflammation and atherosclerosis: Signaling pathways and therapeutic intervention. Signal Transduct. Target. Ther. 2022, 7, 131. [Google Scholar] [CrossRef] [Scilit]
- Zhao, Q.; Chen, X.-Y.; Martin, C. Scutellaria baicalensis, the golden herb from the garden of Chinese medicinal plants. Sci. Bull. 2016, 61, 1391–1398. [Google Scholar] [CrossRef] [Scilit]
- Yao, J.; Cao, X.; Zhang, R.; Li, Y.-X.; Xu, Z.-L.; Zhang, D.-G.; Wang, L.-S.; Wang, J.-Y. Protective effect of baicalin against experimental colitis via suppression of oxidant stress and apoptosis. Pharmacogn. Mag. 2016, 12, 225. [Google Scholar]
- Yun, M.; Kim, B. Effects of Scutellaria baicalensis Extract-Induced Exosomes on the Periodontal Stem Cells and Immune Cells under Fine Dust. Nanomaterials 2024, 14, 1396. [Google Scholar] [CrossRef] [Scilit]
- Zhu, Q.; Zhuang, X.; Lu, J. Neuroprotective effects of baicalein in animal models of Parkinson’s disease: A systematic review of experimental studies. Phytomedicine 2019, 55, 302–309. [Google Scholar] [CrossRef] [Scilit]
- Kowal, J.; Tkach, M.; Théry, C. Biogenesis and secretion of exosomes. Curr. Opin. Cell Biol. 2014, 29, 116–125. [Google Scholar] [CrossRef] [Scilit]
- Théry, C.; Witwer, K.W.; Aikawa, E.; Alcaraz, M.J.; Anderson, J.D.; Andriantsitohaina, R.; Antoniou, A.; Arab, T.; Archer, F.; Atkin-Smith, G.K. Minimal information for studies of extracellular vesicles 2018 (MISEV2018): A position statement of the International Society for Extracellular Vesicles and update of the MISEV2014 guidelines. J. Extracell. Vesicles 2018, 7, 1535750. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Yáñez-Mó, M.; Siljander, P.R.-M.; Andreu, Z.; Bedina Zavec, A.; Borràs, F.E.; Buzas, E.I.; Buzas, K.; Casal, E.; Cappello, F.; Carvalho, J. Biological properties of extracellular vesicles and their physiological functions. J. Extracell. Vesicles 2015, 4, 27066. [Google Scholar] [CrossRef] [Scilit]
- Lou, G.; Chen, Z.; Zheng, M.; Liu, Y. Mesenchymal stem cell-derived exosomes as a new therapeutic strategy for liver diseases. Exp. Mol. Med. 2017, 49, e346. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Aqil, F.; Jeyabalan, J.; Agrawal, A.K.; Kyakulaga, A.-H.; Munagala, R.; Parker, L.; Gupta, R.C. Exosomal delivery of berry anthocyanidins for the management of ovarian cancer. Food Funct. 2017, 8, 4100–4107. [Google Scholar] [CrossRef] [Scilit]
- Ha, D.; Yang, N.; Nadithe, V. Exosomes as therapeutic drug carriers and delivery vehicles across biological membranes: Current perspectives and future challenges. Acta Pharm. Sin. B 2016, 6, 287–296. [Google Scholar] [CrossRef] [Scilit]
- World Health Organization. Review of Evidence on Health Aspects of Air Pollution: REVIHAAP Project: Technical Report; World Health Organization, Regional Office for Europe: Geneva, Switzerland, 2021. [Google Scholar]
- Kim, K.-H.; Kabir, E.; Kabir, S. A review on the human health impact of airborne particulate matter. Environ. Int. 2015, 74, 136–143. [Google Scholar] [CrossRef] [Scilit]
- Krutmann, J.; Liu, W.; Li, L.; Pan, X.; Crawford, M.; Sore, G.; Seite, S. Pollution and skin: From epidemiological and mechanistic studies to clinical implications. J. Dermatol. Sci. 2014, 76, 163–168. [Google Scholar] [CrossRef] [Scilit]
- Ngoc, L.T.N.; Park, D.; Lee, Y.; Lee, Y.-C. Systematic review and meta-analysis of human skin diseases due to particulate matter. Int. J. Environ. Res. Public Health 2017, 14, 1458. [Google Scholar] [CrossRef] [Scilit]
- Vierkötter, A.; Schikowski, T.; Ranft, U.; Sugiri, D.; Matsui, M.; Krämer, U.; Krutmann, J. Airborne particle exposure and extrinsic skin aging. J. Investig. Dermatol. 2010, 130, 2719–2726. [Google Scholar] [CrossRef] [Scilit]
- Diao, P.; He, H.; Tang, J.; Xiong, L.; Li, L. Natural compounds protect the skin from airborne particulate matter by attenuating oxidative stress. Biomed. Pharmacother. 2021, 138, 111534. [Google Scholar] [CrossRef] [Scilit]
- Lee, J.; Kwon, J.; Jo, Y.-J.; Yoon, S.-B.; Hyeon, J.-H.; Park, B.-J.; You, H.-J.; Youn, C.; Kim, Y.; Choi, H.W. Particulate matter 10 induces oxidative stress and apoptosis in rhesus macaques skin fibroblast. PeerJ 2023, 11, e16589. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Fu, P.; Zhao, Y.; Dong, C.; Cai, Z.; Li, R.; Yung, K.K.L. An integrative analysis of miRNA and mRNA expression in the brains of Alzheimer’s disease transgenic mice after real-world PM2. 5 exposure. J. Environ. Sci. 2022, 122, 25–40. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Park, T.; Park, S.; Cho, M.; Kim, S. Associations of particulate matter with atopic dermatitis and chronic inflammatory skin diseases in South Korea. Clin. Exp. Dermatol. 2022, 47, 325–334. [Google Scholar] [CrossRef] [Scilit]
- Mehta, A.K.; Gracias, D.T.; Croft, M. TNF activity and T cells. Cytokine 2018, 101, 14–18. [Google Scholar] [CrossRef] [Scilit]
- Hänel, K.H.; Cornelissen, C.; Lüscher, B.; Baron, J.M. Cytokines and the skin barrier. Int. J. Mol. Sci. 2013, 14, 6720–6745. [Google Scholar] [CrossRef] [Scilit]
- Kalliolias, G.D.; Ivashkiv, L.B. TNF biology, pathogenic mechanisms and emerging therapeutic strategies. Nat. Rev. Rheumatol. 2016, 12, 49–62. [Google Scholar] [CrossRef] [Scilit]
- Gustafson, B.; Hammarstedt, A.; Hedjazifar, S.; Smith, U. Restricted adipogenesis in hypertrophic obesity: The role of WISP2, WNT, and BMP4. Diabetes 2013, 62, 2997–3004. [Google Scholar] [CrossRef] [Scilit]
- Cawthorn, W.P.; Sethi, J.K. TNF-α and adipocyte biology. FEBS Lett. 2008, 582, 117–131. [Google Scholar] [CrossRef] [Scilit]
- Rosen, E.D.; Spiegelman, B.M. Adipocytes as regulators of energy balance and glucose homeostasis. Nature 2006, 444, 847–853. [Google Scholar] [CrossRef] [Scilit]
- Chen, X.; Xun, K.; Chen, L.; Wang, Y. TNF-α, a potent lipid metabolism regulator. Cell Biochem. Funct. Cell. Biochem. Its Modul. Act. Agents Dis. 2009, 27, 407–416. [Google Scholar] [CrossRef] [Scilit]
- Tanaka, T.; Narazaki, M.; Kishimoto, T. IL-6 in inflammation, immunity, and disease. Cold Spring Harb. Perspect. Biol. 2014, 6, a016295. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Neuner, P.; Urbanski, A.; Trautinger, F.; Möller, A.; Kirnbauer, R.; Kapp, A.; Schöpf, E.; Schwarz, T.; Luger, T.A. Increased IL-6 production by monocytes and keratinocytes in patients with psoriasis. J. Investig. Dermatol. 1991, 97, 27–33. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zouboulis, C.C.; Coenye, T.; He, L.; Kabashima, K.; Kobayashi, T.; Niemann, C.; Nomura, T.; Oláh, A.; Picardo, M.; Quist, S.R. Sebaceous immunobiology-skin homeostasis, pathophysiology, coordination of innate immunity and inflammatory response and disease associations. Front. Immunol. 2022, 13, 1029818. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Rizwan, S.; ReddySekhar, P.; MalikAsrar, B. Reactive oxygen species in inflammation and tissue injury. Antioxid. Redox Signal. 2014, 20, 1126–1167. [Google Scholar]
- Hirano, T. IL-6 in inflammation, autoimmunity and cancer. Int. Immunol. 2021, 33, 127–148. [Google Scholar] [CrossRef] [Scilit]
- Kim, H.-J.; Bae, I.-H.; Son, E.D.; Park, J.; Cha, N.; Na, H.-W.; Jung, C.; Go, Y.-S.; Kim, D.-Y.; Lee, T.R. Transcriptome analysis of airborne PM2. 5-induced detrimental effects on human keratinocytes. Toxicol. Lett. 2017, 273, 26–35. [Google Scholar] [CrossRef] [Scilit]
- Ma, Q. Role of nrf2 in oxidative stress and toxicity. Annu. Rev. Pharmacol. Toxicol. 2013, 53, 401–426. [Google Scholar] [CrossRef] [Scilit]
- Zouboulis, C.; Jourdan, E.; Picardo, M. Acne is an inflammatory disease and alterations of sebum composition initiate acne lesions. J. Eur. Acad. Dermatol. Venereol. 2014, 28, 527–532. [Google Scholar] [CrossRef] [Scilit]
- Dréno, B.; Pécastaings, S.; Corvec, S.; Veraldi, S.; Khammari, A.; Roques, C. Cutibacterium acnes (Propionibacterium acnes) and acne vulgaris: A brief look at the latest updates. J. Eur. Acad. Dermatol. Venereol. 2018, 32, 5–14. [Google Scholar] [CrossRef] [Scilit]
- Listenberger, L.L.; Han, X.; Lewis, S.E.; Cases, S.; Farese, R.V., Jr.; Ory, D.S.; Schaffer, J.E. Triglyceride accumulation protects against fatty acid-induced lipotoxicity. Proc. Natl. Acad. Sci. USA 2003, 100, 3077–3082. [Google Scholar] [CrossRef] [Scilit]
- Rerknimitr, P.; Otsuka, A.; Nakashima, C.; Kabashima, K. Skin barrier function and atopic dermatitis. Curr. Dermatol. Rep. 2018, 7, 209–220. [Google Scholar] [CrossRef] [Scilit]
- Melnik, B.C. The role of mTORC1 in acne pathogenesis and treatment. Expert Rev. Dermatol. 2013, 8, 617–622. [Google Scholar] [CrossRef] [Scilit]
- Park, Y.; Choi, S.; Kim, B.; Lee, S.G. Effects of Cordyceps militaris Extracts on Macrophage as Immune Conductors. Appl. Sci. 2021, 11, 2206. [Google Scholar] [CrossRef] [Scilit]
- Honda, K.; Taniguchi, T. IRFs: Master regulators of signalling by Toll-like receptors and cytosolic pattern-recognition receptors. Nat. Rev. Immunol. 2006, 6, 644–658. [Google Scholar] [CrossRef] [Scilit]
- Mao, Y.; Luo, W.; Zhang, L.; Wu, W.; Yuan, L.; Xu, H.; Song, J.; Fujiwara, K.; Abe, J.-I.; LeMaire, S.A. STING–IRF3 triggers endothelial inflammation in response to free fatty acid-induced mitochondrial damage in diet-induced obesity. Arterioscler. Thromb. Vasc. Biol. 2017, 37, 920–929. [Google Scholar] [CrossRef] [Scilit]
- Coates, M.; Blanchard, S.; MacLeod, A.S. Innate antimicrobial immunity in the skin: A protective barrier against bacteria, viruses, and fungi. PLoS Pathog. 2018, 14, e1007353. [Google Scholar] [CrossRef] [Scilit]
- Morhenn, V.B. Keratinocyte proliferation in wound healing and skin diseases. Immunol. Today 1988, 9, 104–107. [Google Scholar] [CrossRef] [Scilit]
- Qian, X.; Yang, Z.; Mao, E.; Chen, E. Regulation of fatty acid synthesis in immune cells. Scand. J. Immunol. 2018, 88, e12713. [Google Scholar] [CrossRef] [Scilit]
- Hartal-Benishay, L. Novel Roles for Ifn-β in the Regulation of Energy Metabolism in Mice. Ph.D. Thesis, University of Haifa, Haifa, Israel, 2020. [Google Scholar]
- Moore, K.W.; de Waal Malefyt, R.; Coffman, R.L.; O’Garra, A. Interleukin-10 and the interleukin-10 receptor. Annu. Rev. Immunol. 2001, 19, 683–765. [Google Scholar] [CrossRef] [Scilit]
- King, A.; Balaji, S.; Le, L.D.; Crombleholme, T.M.; Keswani, S.G. Regenerative wound healing: The role of interleukin-10. Adv. Wound Care 2014, 3, 315–323. [Google Scholar] [CrossRef] [Scilit]
- Makrantonaki, E.; Ganceviciene, R.; Zouboulis, C.C. An update on the role of the sebaceous gland in the pathogenesis of acne. Derm.-Endocrinol. 2011, 3, 41–49. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Rajbhandari, P.; Thomas, B.J.; Feng, A.-C.; Hong, C.; Wang, J.; Vergnes, L.; Sallam, T.; Wang, B.; Sandhu, J.; Seldin, M.M. IL-10 signaling remodels adipose chromatin architecture to limit thermogenesis and energy expenditure. Cell 2018, 172, 218–233.e217. [Google Scholar] [CrossRef] [Scilit]
- Serhan, C.N.; Yacoubian, S.; Yang, R. Anti-inflammatory and proresolving lipid mediators. Annu. Rev. Pathol. Mech. Dis. 2008, 3, 279–312. [Google Scholar] [CrossRef] [Scilit]
- Pakshir, K.; Badali, H.; Nami, S.; Mirzaei, H.; Ebrahimzadeh, V.; Morovati, H. Interactions between immune response to fungal infection and microRNAs: The pioneer tuners. Mycoses 2020, 63, 4–20. [Google Scholar] [CrossRef] [Scilit]
- Zhao, X.; Yang, Y.; Wang, Y.; Chen, X.; Yao, Y.; Yuan, T.; Li, J.; Li, Y.; Song, X. Roles of noncoding RNA in allergic rhinitis. In Proceedings of the International Forum of Allergy & Rhinology, Tokio, Japan, 4–6 April 2024; Wiley: Hoboken, NJ, USA, 2024; pp. 1757–1775. [Google Scholar]
- Raaby, L.; Langkilde, A.; Kjellerup, R.; Vinter, H.; Khatib, S.; Hjuler, K.; Johansen, C.; Iversen, L. Changes in mRNA expression precede changes in microRNA expression in lesional psoriatic skin during treatment with adalimumab. Br. J. Dermatol. 2015, 173, 436–447. [Google Scholar] [CrossRef] [Scilit]
- Cuadrado, A.; Rojo, A.I.; Wells, G.; Hayes, J.D.; Cousin, S.P.; Rumsey, W.L.; Attucks, O.C.; Franklin, S.; Levonen, A.-L.; Kensler, T.W. Therapeutic targeting of the NRF2 and KEAP1 partnership in chronic diseases. Nat. Rev. Drug Discov. 2019, 18, 295–317. [Google Scholar] [CrossRef] [Scilit]
- Fu, Y.; Chen, J.; Huang, Z. Recent progress in microRNA-based delivery systems for the treatment of human disease. ExRNA 2019, 1, 24. [Google Scholar] [CrossRef] [Scilit]
- Kalluri, R.; LeBleu, V.S. The biology, function, and biomedical applications of exosomes. Science 2020, 367, eaau6977. [Google Scholar] [CrossRef] [Scilit]
- Zhang, Y.; Liu, Y.; Liu, H.; Tang, W.H. Exosomes: Biogenesis, biologic function and clinical potential. Cell Biosci. 2019, 9, 19. [Google Scholar] [CrossRef] [Scilit]







| Gene | Sequence (5′→3′) |
|---|---|
| GAPDH (Glyceraldehyde 3-phosphate dehydrogenase) NM_002046.7 | Forward: GTGGTCTCCTCTGACTTCAACA Reverse: CTCTTCCTCTTGTGCTCTTGCT |
| IRF3 (Interferon regulatory factor 3) NM_001571.6 | Forward: GTGGGAGTTCGAGGTGACAG Reverse: CTACAATGAAGGGCCCCAGG |
| PPARγ (Peroxisome proliferator-activated receptor gamma) NM_138712.3 | Forward: TCTGAGGACCACGACCTG Reverse: GCTGGTGCTGGTCTTGAG |
| miRNA | Sequence |
|---|---|
| miR-146a-5p | UGAGAACUGAAUUCCAUGGGUU |
| miR-21-5p | UAGCUUAUCAGACUGAUGUUGA |
| miR-155-5p | UUAAUGCUAAUCGUGAUAGGGG |
| miR-124-3p | UUAAGGCACGCGGUGAAUGCCA |
| miR-223-3p | UGUCAGUUUGUCAAAUACCCCA |
| miR-31-5p | AGGCAAGAUGCUGGCAUAGCU |
| miR-200c-3p | UAAUACUGCCGGGUAAUGAUGGA |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Gong, G.; Yun, M.; Kwon, O.; Kim, B. Therapeutic and Pharmaceutical Potential of Scutellaria baicalensis-Derived Exosomes for Oily Skin Disorders. Antioxidants 2025, 14, 364. https://doi.org/10.3390/antiox14030364
Gong G, Yun M, Kwon O, Kim B. Therapeutic and Pharmaceutical Potential of Scutellaria baicalensis-Derived Exosomes for Oily Skin Disorders. Antioxidants. 2025; 14(3):364. https://doi.org/10.3390/antiox14030364
Chicago/Turabian StyleGong, Guybin, Mihae Yun, Ohhyuk Kwon, and Boyong Kim. 2025. "Therapeutic and Pharmaceutical Potential of Scutellaria baicalensis-Derived Exosomes for Oily Skin Disorders" Antioxidants 14, no. 3: 364. https://doi.org/10.3390/antiox14030364
APA StyleGong, G., Yun, M., Kwon, O., & Kim, B. (2025). Therapeutic and Pharmaceutical Potential of Scutellaria baicalensis-Derived Exosomes for Oily Skin Disorders. Antioxidants, 14(3), 364. https://doi.org/10.3390/antiox14030364

