Evaluation of Anti-Inflammatory Effects of Six Ginsenosides and Rg1 Regulation of Macrophage Polarization and Metabolites to Alleviate Colitis
Abstract
1. Introduction
2. Materials and Methods
2.1. Reagents and Antibodies
2.2. Cell Culture
2.3. Measurement of Cell Viability
2.4. Quantitative Real-Time PCR (qPCR) for Cells
2.5. Measurement of ROS
2.6. Animal Experiments
2.7. Quantitative Real-Time PCR (qPCR) for Colon Tissue
2.8. Histopathology
2.9. Enzyme-Linked Immunosorbent Assay (ELISA)
2.10. Flow Cytometry
2.11. LC-MS/MS
2.12. Statistical Analysis
3. Results
3.1. Anti-Inflammatory Effect of Different Ginsenosides
3.2. The Inhibitory Activity of Different Ginsenosides on Pyroptosis
3.3. The Effect of Different Ginsenosides on ROS
3.4. The Effect of Different Ginsenosides on Ferroptosis
3.5. The Effect of Rg1, Rg3, and Rf on Improving Colitis
3.6. The Effect of Rg1, Rg3, and Rf on Serum Cytokines and the Intestinal Barrier
3.7. Modulation of Macrophage Polarization by Rg1
3.8. Regulation of Gut Metabolite Composition by Rg1
3.9. Changes in Key Metabolites by Rg1
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Gao, Q.; Li, G.; Zu, Y.; Xu, Y.; Wang, C.; Xiang, D.; He, W.; Shang, T.; Cheng, X.; Liu, D.; et al. Ginsenoside Rg1 alleviates ANIT-induced cholestatic liver injury by inhibiting hepatic inflammation and oxidative stress via SIRT1 activation. J. Ethnopharmacol. 2024, 319, 117089. [Google Scholar] [CrossRef] [PubMed]
- Wang, Y.F.; Peng, M.Y.; Wang, W.J.; Chen, Y.L.; He, Z.H.; Cao, J.J.; Lin, Z.Y.; Yang, Z.M.; Gong, M.J.; Yin, Y.Q. Verification of miRNAs in ginseng decoction by high-throughput sequencing and quantitative real-time PCR. Heliyon 2019, 5, e01418. [Google Scholar] [CrossRef] [PubMed]
- Qu, Q.; Li, S.P.; Dong, Q.; Du, H.L.; Wang, Z.H.; Ma, Y.M.; Gong, X.P.; Ding, Y.Q.; Zhou, J.; Chen, J.Y.; et al. Transcriptome profiling Revealed the potential mechanisms of Shen Lin Bai Zhu San n-butanol extract on DSS induced Colitis in Mice and LC-MS analysis. Phytomedicine 2023, 110, 154645. [Google Scholar] [CrossRef] [PubMed]
- Wang, Z.; Zhang, Z.; Liu, J.; Guo, M.; Li, H. Panax Ginseng in the treatment of Alzheimer’s disease and vascular dementia. J. Ginseng Res. 2023, 47, 506–514. [Google Scholar] [CrossRef] [PubMed]
- Wang, D.; Guo, M.; Li, X.; Zhao, D.; Wang, M. Microbiota, co-metabolites, and network pharmacology reveal the alteration of the ginsenoside fraction on inflammatory bowel disease. J. Ginseng Res. 2023, 47, 54–64. [Google Scholar] [CrossRef] [PubMed]
- Hou, J.H.; Shin, H.; Shin, H.; Kil, Y.; Yang, D.H.; Park, M.K.; Lee, W.; Seong, J.Y.; Lee, S.H.; Cho, H.S.; et al. Influence of Panax ginseng formulation on skin microbiota: A randomized, split face comparative clinical study. J. Ginseng Res. 2022, 46, 296–303. [Google Scholar] [CrossRef] [PubMed]
- Li, Y.G.; Yu, P.; Fu, W.W.; Wang, J.; Ma, Y.; Wu, Y.; Cui, H.M.; Zhao, W.J.; Zhang, F.Y.; Yu, X.F.; et al. Polysaccharides from Panax ginseng C. A. Meyer alleviated DSS-induced IBD by inhibiting JAK2/STAT1/NLPR3 inflammasome signalling pathway in mice. J. Funct. Foods 2022, 91, 105013. [Google Scholar] [CrossRef]
- Niu, Z.Q.; Liu, Y.N.; Shen, R.Y.; Jiang, X.J.; Wang, Y.T.; He, Z.L.; Li, J.Y.; Hu, Y.Y.; Zhang, J.; Jiang, Y.Y.; et al. Ginsenosides from as potential therapeutic candidates for the treatment of inflammatory bowel disease. Phytomedicine 2024, 127, 155474. [Google Scholar] [CrossRef]
- Zhao, L.X.; Zhang, T.B.; Zhang, K. Pharmacological effects of ginseng and ginsenosides on intestinal inflammation and the immune system. Front. Immunol. 2024, 15, 1353614. [Google Scholar] [CrossRef] [PubMed]
- Nag, S.A.; Qin, J.J.; Wang, W.; Wang, M.H.; Wang, H.; Zhang, R.W. Ginsenosides as anticancer agents: And activities, structure-activity relationships, and molecular mechanisms of action. Front. Pharmacol. 2012, 3, 25. [Google Scholar] [CrossRef]
- Im, D.S. Pro-Resolving Effect of Ginsenosides as an Anti-Inflammatory Mechanism of. Biomolecules 2020, 10, 444. [Google Scholar] [CrossRef]
- Hu, Q.; Lyon, C.J.; Fletcher, J.K.; Tang, W.F.; Wan, M.H.; Hu, T.Y. Extracellular vesicle activities regulating macrophage- and tissue-mediated injury and repair responses. Acta Pharm. Sin. B 2021, 11, 1493–1512. [Google Scholar] [CrossRef] [PubMed]
- Zhang, K.; Guo, J.; Yan, W.L.; Xu, L.F. Macrophage polarization in inflammatory bowel disease. Cell Commun. Signal. 2023, 21, 367. [Google Scholar] [CrossRef]
- Du, Y.; Rong, L.; Cong, Y.; Shen, L.; Zhang, N.; Wang, B. Macrophage polarization: An effective approach to targeted therapy of inflammatory bowel disease. Expert. Opin. Ther. Targets 2021, 25, 191–209. [Google Scholar] [CrossRef] [PubMed]
- Huang, C.Y.; Wang, J.; Liu, H.B.; Huang, R.; Yan, X.W.; Song, M.Y.; Tan, G.; Zhi, F.C. Ketone body β-hydroxybutyrate ameliorates colitis by promoting M2 macrophage polarization through the STAT6-dependent signaling pathway. BMC Med. 2022, 20, 148. [Google Scholar] [CrossRef]
- Zhao, Y.; Yin, W.; Yang, Z.; Sun, J.; Chang, J.; Huang, L.; Xue, L.; Zhang, X.; Zhi, H.; Chen, S.; et al. Nanotechnology-enabled M2 macrophage polarization and ferroptosis inhibition for targeted inflammatory bowel disease treatment. J. Control. Release 2024, 367, 339–353. [Google Scholar] [CrossRef] [PubMed]
- Yang, Y.; Wang, Y.; Guo, L.; Gao, W.; Tang, T.L.; Yan, M. Interaction between macrophages and ferroptosis. Cell Death Dis. 2022, 13, 355. [Google Scholar] [CrossRef] [PubMed]
- Ye, Y.L.; Liu, L.M.; Cao, X.C.; Zhao, J.W. Butyrate Inhibits Ferroptosis of M2-Like Macrophage by Activating Nrf2/Gpx4 in Response to Dextran Sulfate Sodium-Induced Experimental Colitis. Gastroenterology 2023, 164, S1151. [Google Scholar] [CrossRef]
- Ma, H.J.; Shu, Q.; Li, D.; Wang, T.Q.; Li, L.Y.; Song, X.D.; Lou, K.Y.; Xu, H. Accumulation of Intracellular Ferrous Iron in Inflammatory-Activated Macrophages. Biol. Trace Elem. Res. 2022, 201, 2303–2310. [Google Scholar] [CrossRef] [PubMed]
- Xiong, Y.Y.; Lou, Y.; Su, H.; Fu, Y.; Kong, J. Cholecalciterol cholesterol emulsion ameliorates experimental colitis via down-regulating the pyroptosis signaling pathway. Exp. Mol. Pathol. 2016, 100, 386–392. [Google Scholar] [CrossRef] [PubMed]
- Hyun, S.H.; Bhilare, K.D.; In, G.; Park, C.K.; Kim, J.H. Effects of Panax ginseng and ginsenosides on oxidative stress and cardiovascular diseases: Pharmacological and therapeutic roles. J. Ginseng Res. 2022, 46, 33–38. [Google Scholar] [CrossRef] [PubMed]
- Yang, L.; Zou, H.C.; Gao, Y.C.; Luo, J.J.; Xie, X.N.; Meng, W.H.; Zhou, H.H.; Tan, Z.R. Insights into gastrointestinal microbiota-generated ginsenoside metabolites and their bioactivities. Drug Metab. Rev. 2020, 52, 125–138. [Google Scholar] [CrossRef] [PubMed]
- Zhong, Y.; Xiao, Q.; Huang, J.; Yu, S.; Chen, L.; Wan, Q.; Zhang, Z.; Luo, L.; Song, L.; Zhao, H.; et al. Ginsenoside Rg1 Alleviates Ulcerative Colitis in Obese Mice by Regulating the Gut Microbiota-Lipid Metabolism-Th1/Th2/Th17 Cells Axis. J. Agric. Food Chem. 2023, 71, 20073–20091. [Google Scholar] [CrossRef]
- Liu, D.; Tian, Q.; Liu, K.; Ren, F.; Liu, G.; Zhou, J.; Yuan, L.; Fang, Z.; Zou, B.; Wang, S. Ginsenoside Rg3 Ameliorates DSS-Induced Colitis by Inhibiting NLRP3 Inflammasome Activation and Regulating Microbial Homeostasis. J. Agric. Food Chem. 2023, 71, 3472–3483. [Google Scholar] [CrossRef] [PubMed]
- Ahn, S.; Simu, S.Y.; Yang, D.C.; Jang, M.; Um, B.H. Effects of Ginsenoside Rf on dextran sodium sulfate-induced colitis in mice. Food Agric. Immunol. 2021, 32, 360–372. [Google Scholar] [CrossRef]
- Liu, C.; Wang, J.N.; Yang, Y.; Liu, X.T.; Zhu, Y.B.; Zou, J.J.; Peng, S.S.; Le, T.H.; Chen, Y.; Zhao, S.L.; et al. Ginsenoside Rd ameliorates colitis by inducing p62-driven mitophagy-mediated NLRP3 inflammasome inactivation in mice. Biochem. Pharmacol. 2018, 155, 366–379. [Google Scholar] [CrossRef] [PubMed]
- Lee, I.A.; Hyam, S.R.; Jang, S.E.; Han, M.J.; Kim, D.H. Ginsenoside Re Ameliorates Inflammation by Inhibiting the Binding of Lipopolysaccharide to TLR4 on Macrophages. J. Agric. Food Chem. 2012, 60, 9595–9602. [Google Scholar] [CrossRef]
- Li, S.Y.; Yuan, R.Y.K.; Fan, Q.M.; Zhang, C.T.; Han, S.; Li, J.L.; Xu, Z.P.; Sun, K.L.; Xu, Q.M.; Yao, C.; et al. Ginsenoside Rb1 exerts therapeutic effects on ulcerative colitis through regulating the Nrf2/PIP2/NLRP3 inflammasome signaling pathway. J. Funct. Foods 2023, 102, 105475. [Google Scholar] [CrossRef]
- Chao, L.; Li, Z.; Zhou, J.; Chen, W.; Li, Y.; Lv, W.; Guo, A.; Qu, Q.; Guo, S. Shen-Ling-Bai-Zhu-San Improves Dextran Sodium Sulfate-Induced Colitis by Inhibiting Caspase-1/Caspase-11-Mediated Pyroptosis. Front. Pharmacol. 2020, 11, 814. [Google Scholar] [CrossRef] [PubMed]
- Pawate, S.; Shen, Q.; Fan, F.; Bhat, N.R. Redox regulation of glial inflammatory response to lipopolysaccharide and interferongamma. J. Neurosci. Res. 2004, 77, 540–551. [Google Scholar] [CrossRef] [PubMed]
- Park, G.C.; Bang, S.-Y.; Kim, J.M.; Shin, S.-C.; Cheon, Y.-I.; Kim, K.M.; Park, H.; Sung, E.-S.; Lee, M.; Lee, J.-C.; et al. Inhibiting Ferroptosis Prevents the Progression of Steatotic Liver Disease in Obese Mice. Antioxidants 2024, 13, 1336. [Google Scholar] [CrossRef]
- Kim, J.H.; Yi, Y.S.; Kim, M.Y.; Cho, J.Y. Role of ginsenosides, the main active components of, in inflammatory responses and diseases. J. Ginseng Res. 2017, 41, 435–443. [Google Scholar] [CrossRef] [PubMed]
- Paik, D.J.; Lee, C.H. Review of cases of patient risk associated with ginseng abuse and misuse. J. Ginseng Res. 2015, 39, 89–93. [Google Scholar] [CrossRef] [PubMed]
- Park, J.S.; Kim, S.H.; Han, K.M.; Kim, Y.S.; Kwon, E.; Paek, S.H.; Seo, Y.K.; Yun, J.W.; Kang, B.C. Efficacy and safety evaluation of black ginseng (Panax ginseng C.A. Mey.) extract (CJ EnerG): Broad spectrum cytotoxic activity in human cancer cell lines and 28-day repeated oral toxicity study in Sprague-Dawley rats. BMC Complement. Med. Ther. 2022, 22, 44. [Google Scholar] [CrossRef] [PubMed]
- Zhu, G.; Wang, H.N.; Wang, T.C.; Shi, F.S. Ginsenoside Rg1 attenuates the inflammatory response in DSS-induced mice colitis. Int. Immunopharmacol. 2017, 50, 1–5. [Google Scholar] [CrossRef] [PubMed]
- Zhang, Z.Y.; Jiang, Q.Q.; Huang, L.; Huang, J.Q.; Wan, Q.; Zhong, Y.B.; Liu, D.Y.; Zhou, W.; Zhao, H.M. Ginsenoside Rg1 regulated subpopulation homeostasis of Tfh cells ameliorate experimental colitis by inhibiting TLR/MyD88 pathway. J. Funct. Foods 2024, 113, 106011. [Google Scholar] [CrossRef]
- Lissner, D.; Schumann, M.; Batra, A.; Kredel, L.I.; Kuhl, A.A.; Erben, U.; May, C.; Schulzke, J.D.; Siegmund, B. Monocyte and M1 Macrophage-induced Barrier Defect Contributes to Chronic Intestinal Inflammation in IBD. Inflamm. Bowel Dis. 2015, 21, 1297–1305. [Google Scholar] [CrossRef] [PubMed]
- Lv, W.; Jin, W.; Lin, J.; Wang, Z.; Ma, Y.; Zhang, W.; Zhu, Y.; Hu, Y.; Qu, Q.; Guo, S. Forsythia suspensa polyphenols regulate macrophage M1 polarization to alleviate intestinal inflammation in mice. Phytomedicine 2024, 125, 155336. [Google Scholar] [CrossRef] [PubMed]
- Liu, L.; Wu, Y.; Wang, B.; Jiang, Y.; Lin, L.; Li, X.; Yang, S. DA-DRD5 signaling controls colitis by regulating colonic M1/M2 macrophage polarization. Cell Death Dis. 2021, 12, 500. [Google Scholar] [CrossRef]
- Lü, J.M.; Yao, Q.Z.; Chen, C.Y. Ginseng Compounds: An Update on their Molecular Mechanisms and Medical Applications. Curr. Vasc. Pharmacol. 2009, 7, 293–302. [Google Scholar] [CrossRef]
- Cao, Y.; Tao, F.; Yu, Y.; Song, L.; Zhang, R.; Feng, J.; Zhai, Q.; Xue, P. Safety evaluation of rare ginsenosides of stems and leaves from American ginseng: 90-day exposure toxicity study combined with intestinal flora analysis and metabonomics in rats. Ecotoxicol. Environ. Saf. 2023, 264, 115429. [Google Scholar] [CrossRef] [PubMed]
- Paydas Hataysal, E.; Korez, M.K.; Guler, E.M.; Vatansev, H.; Bozali, K.; Basaranoglu, M.; Vatansev, H. Impaired Kynurenine Pathway in Inflammatory Bowel Disease. J. Clin. Med. 2024, 13, 6147. [Google Scholar] [CrossRef]
- Recharla, N.; Geesala, R.; Shi, X.Z. Gut Microbial Metabolite Butyrate and Its Therapeutic Role in Inflammatory Bowel Disease: A Literature Review. Nutrients 2023, 15, 2275. [Google Scholar] [CrossRef]
- Yan, B.F.; Chen, X.; Wang, Y.; Yuan, M.Q.; Xian, J.Q.; Lu, D.Y.; Shao, Z.T.; Qiu, M.M.; Fu, T.M.; Zheng, X. ameliorates ulcerative colitis by tuning intestinal microecology: Butyric acid is a crucial player. J. Funct. Foods 2024, 121, 106414. [Google Scholar] [CrossRef]
- Walker, A.; Schmitt-Kopplin, P. The role of fecal sulfur metabolome in inflammatory bowel diseases. Int. J. Med. Microbiol. 2021, 311, 151513. [Google Scholar] [CrossRef] [PubMed]
- Ge, H.F.; Qi, F.X.; Shen, Z.Y.; Wang, H.Y.; Zhu, S.L.; Zhou, S.M.; Xie, Z.W.; Li, D.X. Large-leaf yellow tea protein derived-peptides alleviated dextran sodium sulfate-induced acute colitis and restored intestinal microbiota balance in C57BL/6 J mice. Food Chem. 2024, 456, 139936. [Google Scholar] [CrossRef] [PubMed]
- Caetano, M.A.F.; Magalhaes, H.I.R.; Duarte, J.R.L.; Conceiçao, L.B.; Castelucci, P. Butyrate Protects Myenteric Neurons Loss in Mice Following Experimental Ulcerative Colitis. Cells 2023, 12, 1672. [Google Scholar] [CrossRef] [PubMed]
Target Gene | Direction | Sequence (5′–3′) |
---|---|---|
TNF-α | Forward | CTCACACTCACAAACCACCAAG |
Reverse | CAATGACTCCAAAGTAGACCTGC | |
IL-1β | Forward | AGGCAGGCAGTATCACTCATTG |
Reverse | CGTCACACACCAGCAGGTTATC | |
IL-6 | Forward | AGTTGCCTTCTTGGGACTGATG |
Reverse | CATTGGAAATTGGGG TAGGAAG | |
iNOS | Forward | CTGCCAGGGTCACAACTTTAC |
Reverse | CAGCTCAGTCCCTTCACCAA | |
IL-10 | Forward | TGGACAACATACTGCTAACCG |
Reverse | GGATCATTTCCGATAAGGCT | |
Arg-1 | Forward | CGGGAGGGTAACCATAAGCC |
Reverse | CTTGGGAGGAGAAGGCGTTT | |
IL-18 | Forward | TCAGACAACTTTGGCCGACT |
Reverse | TCAGTCTGGTCTGGGGTTCA | |
Caspase-11 | Forward | ACAAACACCCTGACAAACCAC |
Reverse | CACTGCGTTCAGCATTGTTAAA | |
GSDMA | Forward | CCTCCTGGAGAAAAGCCAGG |
Reverse | TCTTCGTGCATCTCCCCAAC | |
GSDMD | Forward | CCATCGGCCTTTGAGAAAGTG |
Reverse | ACACATGAATAACGGGGTTTCC | |
GSDMC | Forward | CCTGCTAAAAGGAAGGAGACAGT |
Reverse | TTCCAGGCAGAAGCTGCGTT | |
Claudin1 | Forward | TGGCATGAAGTGCATGAGGT |
Reverse | TTGTTTTCCGGGGACAGGAG | |
Occludin | Forward | ACGGACCCTGACCACTATGA |
Reverse | TCAGCAGCAGCCATGTACTC | |
ZO-1 | Forward | CACTTCCAAAGACAGCGGGT |
Reverse | CCCAGCGTCTCGTAGTTCA | |
β-Actin | Forward | TGCTGTCCCTGTATGCCTCTG |
Reverse | CTGTAGCCACGCTCGGTCA |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Qu, Q.; Zhang, W.; Xuan, Z.; Chen, R.; Ma, Y.; Huang, Y.; Hu, Y.; Lin, Y.; Liu, M.; Lv, W.; et al. Evaluation of Anti-Inflammatory Effects of Six Ginsenosides and Rg1 Regulation of Macrophage Polarization and Metabolites to Alleviate Colitis. Antioxidants 2025, 14, 283. https://doi.org/10.3390/antiox14030283
Qu Q, Zhang W, Xuan Z, Chen R, Ma Y, Huang Y, Hu Y, Lin Y, Liu M, Lv W, et al. Evaluation of Anti-Inflammatory Effects of Six Ginsenosides and Rg1 Regulation of Macrophage Polarization and Metabolites to Alleviate Colitis. Antioxidants. 2025; 14(3):283. https://doi.org/10.3390/antiox14030283
Chicago/Turabian StyleQu, Qian, Wenbo Zhang, Zhaoying Xuan, Rong Chen, Yimu Ma, Yiwen Huang, Yifan Hu, Yulin Lin, Mengjie Liu, Weijie Lv, and et al. 2025. "Evaluation of Anti-Inflammatory Effects of Six Ginsenosides and Rg1 Regulation of Macrophage Polarization and Metabolites to Alleviate Colitis" Antioxidants 14, no. 3: 283. https://doi.org/10.3390/antiox14030283
APA StyleQu, Q., Zhang, W., Xuan, Z., Chen, R., Ma, Y., Huang, Y., Hu, Y., Lin, Y., Liu, M., Lv, W., & Guo, S. (2025). Evaluation of Anti-Inflammatory Effects of Six Ginsenosides and Rg1 Regulation of Macrophage Polarization and Metabolites to Alleviate Colitis. Antioxidants, 14(3), 283. https://doi.org/10.3390/antiox14030283