Effects of Sulforaphane Treatment on Skeletal Muscle from Exhaustive Exercise-Induced Inflammation and Oxidative Stress Through the Nrf2/HO-1 Signaling Pathway
Abstract
1. Introduction
2. Materials and Methods
2.1. Animal Maintenance and Diet
2.2. Acute Exhaustive Exercise and SFN Ingestion Protocol
2.3. Plasma Glucose Measurement
2.4. Real-Time (RT) Quantitative Polymerase Chain Reaction (qPCR)
2.5. Statistical Analysis
3. Results
3.1. Effects of SFN Treatment on Endurance Capacity Test and Plasma Glucose Level
3.2. Effect of SFN on Exercise-Induced Pro-Inflammatory Cytokines Gene Expression in Both Soleus and Gastrocnemius Muscles
3.3. Effect of SFN on Antioxidant Defense Enzyme Gene Expression
3.4. Effect of SFN on Nrf2/HO-1 Gene Expression in Skeletal Muscle Tissue
4. Discussion
5. Future Perspective and Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Yin, L.; Li, N.; Jia, W.; Wang, N.; Liang, M.; Yang, X.; Du, G. Skeletal muscle atrophy: From mechanisms to treatments. Pharmacol. Res. 2021, 172, 105807. [Google Scholar] [CrossRef] [PubMed]
- Reggiani, C.; Schiaffino, S. Muscle hypertrophy and muscle strength: Dependent or independent variables? A provocative review. Eur. J. Transl. Myol. 2020, 30, 9311. [Google Scholar] [CrossRef] [PubMed]
- Scicchitano, B.M.; Dobrowolny, G.; Sica, G.; Musaro, A. Molecular insights into muscle homeostasis, atrophy and wasting. Curr. Genom. 2018, 19, 356. [Google Scholar] [CrossRef]
- Aagaard, P.; Andersen, J.L. Effects of strength training on endurance capacity in top-level endurance athletes. Scand. J. Med. Sci. Sports 2010, 20, 39–47. [Google Scholar] [CrossRef] [PubMed]
- Nemes, R.; Koltai, E.; Taylor, A.W.; Suzuki, K.; Gyori, F.; Radak, Z. Reactive oxygen and nitrogen species regulate key metabolic, anabolic, and catabolic pathways in skeletal muscle. Antioxidants 2018, 7, 85. [Google Scholar] [CrossRef] [PubMed]
- Radak, Z.; Torma, F.; Berkes, I.; Goto, S.; Mimura, T.; Posa, A.; Balogh, L.; Boldogh, I.; Suzuki, K.; Higuchi, M. Exercise effects on physiological function during aging. Free Radic. Biol. Med. 2019, 132, 33–41. [Google Scholar] [CrossRef]
- Scott, W.; Stevens, J.; Binder-Macleod, S.A. Human skeletal muscle fiber type classifications. Phys. Ther. 2001, 81, 1810–1816. [Google Scholar] [CrossRef]
- Westerblad, H.; Bruton, J.D.; Katz, A. Skeletal muscle: Energy metabolism, fiber types, fatigue and adaptability. Exp. Cell Res. 2010, 316, 3093–3099. [Google Scholar] [CrossRef]
- Schiaffino, S.; Reggiani, C. Fiber types in mammalian skeletal muscles. Physiol. Rev. 2011, 91, 1447–1531. [Google Scholar] [CrossRef]
- Zierath, J.R.; Hawley, J.A. Skeletal muscle fiber type: Influence on contractile and metabolic properties. PLoS Biol. 2004, 2, e348. [Google Scholar] [CrossRef]
- Memme, J.M.; Erlich, A.T.; Phukan, G.; Hood, D.A. Exercise and mitochondrial health. J. Physiol. 2021, 599, 803–817. [Google Scholar] [CrossRef]
- Booth, F.W.; Ruegsegger, G.N.; Toedebusch, R.G.; Yan, Z. Chapter Six—Endurance Exercise and the Regulation of Skeletal Muscle Metabolism. In Progress in Molecular Biology and Translational Science; Bouchard, C., Ed.; Academic Press: Cambridge, MA, USA, 2015; Volume 135, pp. 129–151. [Google Scholar]
- Balan, E.; Schwalm, C.; Naslain, D.; Nielens, H.; Francaux, M.; Deldicque, L. Regular endurance exercise promotes fission, mitophagy, and oxidative phosphorylation in human skeletal muscle independently of age. Front. Physiol. 2019, 10, 1088. [Google Scholar] [CrossRef]
- Wackerhage, H.; Woods, N.M. Exercise-induced signal transduction and gene regulation in skeletal muscle. J. Sports Sci. Med. 2002, 1, 103. [Google Scholar]
- Li, T.; He, S.; Liu, S.; Kong, Z.; Wang, J.; Zhang, Y. Effects of different exercise durations on Keap1-Nrf2-ARE pathway activation in mouse skeletal muscle. Free. Radic. Res. 2015, 49, 1269–1274. [Google Scholar] [CrossRef] [PubMed]
- Urso, M.L.; Clarkson, P.M. Oxidative stress, exercise, and antioxidant supplementation. Toxicology 2003, 189, 41–54. [Google Scholar] [CrossRef] [PubMed]
- Halliwell, B.B.; Poulsen, H.E. Oxidative stress. In Cigarette Smoke and Oxidative Stress; Springer: Berlin/Heidelberg, Germany, 2006; pp. 1–4. [Google Scholar]
- Radak, Z.; Chung, H.Y.; Goto, S. Systemic adaptation to oxidative challenge induced by regular exercise. Free Radic. Biol. Med. 2008, 44, 153–159. [Google Scholar] [CrossRef]
- Scheffer, D.L.; Silva, L.A.; Tromm, C.B.; da Rosa, G.L.; Silveira, P.C.L.; de Souza, C.T.; Latini, A.; Pinho, R.A. Impact of different resistance training protocols on muscular oxidative stress parameters. Appl. Physiol. Nutr. Metab. 2012, 37, 1239–1246. [Google Scholar] [CrossRef]
- Hawley, J.A. Adaptations of skeletal muscle to prolonged, intense endurance training. Clin. Exp. Pharmacol. Physiol. 2002, 29, 218–222. [Google Scholar] [CrossRef]
- Westerblad, H.; Allen, D.G. Emerging roles of ROS/RNS in muscle function and fatigue. Antioxid. Redox Signal. 2011, 15, 2487–2499. [Google Scholar] [CrossRef]
- Mironczuk-Chodakowska, I.; Witkowska, A.M.; Zujko, M.E. Endogenous non-enzymatic antioxidants in the human body. Adv. Med. Sci. 2018, 63, 68–78. [Google Scholar] [CrossRef]
- Ighodaro, O.; Akinloye, O. First line defence antioxidants-superoxide dismutase (SOD), catalase (CAT) and glutathione peroxidase (GPX): Their fundamental role in the entire antioxidant defence grid. Alex. J. Med. 2018, 54, 287–293. [Google Scholar] [CrossRef]
- Powers, S.K.; Deminice, R.; Ozdemir, M.; Yoshihara, T.; Bomkamp, M.P.; Hyatt, H. Exercise-induced oxidative stress: Friend or foe? J. Sport Health Sci. 2020, 9, 415–425. [Google Scholar] [CrossRef]
- Suzuki, K. Cytokine Response to Exercise and Its Modulation. Antioxidants 2018, 7, 17. [Google Scholar] [CrossRef]
- Ruhee, R.T.; Roberts, L.A.; Ma, S.; Suzuki, K. Organosulfur compounds: A review of their anti-inflammatory effects in human health. Front. Nutr. 2020, 7, 64. [Google Scholar] [CrossRef] [PubMed]
- Suzuki, K.; Tominaga, T.; Ruhee, R.T.; Ma, S. Characterization and modulation of systemic inflammatory response to exhaustive exercise in relation to oxidative stress. Antioxidants 2020, 9, 401. [Google Scholar] [CrossRef] [PubMed]
- Peake, J.M.; Suzuki, K.; Hordern, M.; Wilson, G.; Nosaka, K.; Coombes, J.S. Plasma cytokine changes in relation to exercise intensity and muscle damage. Eur. J. Appl. Physiol. 2005, 95, 514–521. [Google Scholar] [CrossRef] [PubMed]
- Huang, Q.; Ma, S.; Tominaga, T.; Suzuki, K.; Liu, C. An 8-Week, Low Carbohydrate, High Fat, Ketogenic Diet Enhanced Exhaustive Exercise Capacity in Mice Part 2: Effect on Fatigue Recovery, Post-Exercise Biomarkers and Anti-Oxidation Capacity. Nutrients 2018, 10, 1339. [Google Scholar] [CrossRef]
- Cerqueira, É.; Marinho, D.A.; Neiva, H.P.; Lourenço, O. Inflammatory effects of high and moderate intensity exercise—A systematic review. Front. Physiol. 2020, 10, 1550. [Google Scholar] [CrossRef]
- Wang, J.; Mao, S.; Liang, M.; Zhang, W.; Chen, F.; Huang, K.; Wu, Q. Preharvest Methyl Jasmonate Treatment Increased Glucosinolate Biosynthesis, Sulforaphane Accumulation, and Antioxidant Activity of Broccoli. Antioxidants 2022, 11, 1298. [Google Scholar] [CrossRef]
- Ruhee, R.T.; Suzuki, K. The integrative role of sulforaphane in preventing inflammation, oxidative stress and fatigue: A review of a potential protective phytochemical. Antioxidants 2020, 9, 521. [Google Scholar] [CrossRef] [PubMed]
- Kim, J.K.; Park, S.U. Current potential health benefits of sulforaphane. EXCLI J. 2016, 15, 571. [Google Scholar] [PubMed]
- Elbarbry, F.; Elrody, N. Potential health benefits of sulforaphane: A review of the experimental, clinical and epidemiological evidences and underlying mechanisms. J. Med. Plants Res. 2011, 5, 473–484. [Google Scholar]
- Shahrajabian, M.H.; Sun, W.; Cheng, Q. The most important pharmaceutical benefits of sulforaphane, a sulfur-rich compound in cruciferous. Res. Crop Ecophysiol. 2019, 14, 66–75. [Google Scholar]
- Vanduchova, A.; Anzenbacher, P.; Anzenbacherova, E. Isothiocyanate from broccoli, sulforaphane, and its properties. J. Med. Food 2019, 22, 121–126. [Google Scholar] [CrossRef]
- Treasure, K.; Harris, J.; Williamson, G. Exploring the anti-inflammatory activity of sulforaphane. Immunol. Cell Biol. 2023, 101, 805–828. [Google Scholar] [CrossRef]
- Khan, S.; Awan, K.A.; Iqbal, M.J. Sulforaphane as a potential remedy against cancer: Comprehensive mechanistic review. J. Food Biochem. 2022, 46, e13886. [Google Scholar]
- Zhang, Y.-Q.; Shi, C.-X.; Zhang, D.-M.; Zhang, L.-Y.; Wang, L.-W.; Gong, Z.-J. Sulforaphane, an NRF2 agonist, alleviates ferroptosis in acute liver failure by regulating HDAC6 activity. J. Integr. Med. 2023, 21, 464–473. [Google Scholar] [CrossRef] [PubMed]
- de Figueiredo, S.M.; Binda, N.S.; Nogueira-Machado, J.A.; Vieira-Filho, S.A.; Caligiorne, R.B. The antioxidant properties of organosulfur compounds (sulforaphane). Recent Pat.Endocr. Metab. Immune Drug Discov. 2015, 9, 24–39. [Google Scholar] [CrossRef] [PubMed]
- Sheweita, S.; Tilmisany, A. Cancer and phase II drug-metabolizing enzymes. Curr. Drug Metab. 2003, 4, 45–58. [Google Scholar] [CrossRef] [PubMed]
- Zhang, Y. Phase II Enzymes. In Encyclopedia of Cancer; Schwab, M., Ed.; Springer: Berlin/Heidelberg, Germany, 2011; pp. 2853–2855. [Google Scholar] [CrossRef]
- Esteve, M. Mechanisms underlying biological effects of cruciferous glucosinolate-derived isothiocyanates/indoles: A focus on metabolic syndrome. Front. Nutr. 2020, 7, 111. [Google Scholar] [CrossRef]
- Connolly, E.L.; Sim, M.; Travica, N.; Marx, W.; Beasy, G.; Lynch, G.S.; Bondonno, C.P.; Lewis, J.R.; Hodgson, J.M.; Blekkenhorst, L.C. Glucosinolates from cruciferous vegetables and their potential role in chronic disease: Investigating the preclinical and clinical evidence. Front. Pharmacol. 2021, 12, 767975. [Google Scholar] [CrossRef] [PubMed]
- Sato, K.; Kihara, H.; Kumazawa, Y.; Tatara, K. Oral chronic sulforaphane effects on heavy resistance exercise: Implications for inflammatory and muscle damage parameters in young practitioners. Nutrition 2021, 90, 111266. [Google Scholar] [CrossRef] [PubMed]
- Malaguti, M.; Angeloni, C.; Garatachea, N.; Baldini, M.; Leoncini, E.; Collado, P.S.; Teti, G.; Falconi, M.; Gonzalez-Gallego, J.; Hrelia, S. Sulforaphane treatment protects skeletal muscle against damage induced by exhaustive exercise in rats. J. Appl. Physiol. 2009, 107, 1028–1036. [Google Scholar] [CrossRef] [PubMed]
- Ruhee, R.T.; Ma, S.; Suzuki, K. Protective effects of sulforaphane on exercise-induced organ damage via inducing antioxidant defense responses. Antioxidants 2020, 9, 136. [Google Scholar] [CrossRef] [PubMed]
- Komine, S.; Miura, I.; Miyashita, N.; Oh, S.; Tokinoya, K.; Shoda, J.; Ohmori, H. Effect of a sulforaphane supplement on muscle soreness and damage induced by eccentric exercise in young adults: A pilot study. Physiol. Rep. 2021, 9, e15130. [Google Scholar] [CrossRef]
- Wang, Y.; Xiang, Y.; Wang, R.; Li, X.; Wang, J.; Yu, S.; Zhang, Y. Sulforaphane enhances Nrf2-mediated antioxidant responses of skeletal muscle induced by exhaustive exercise in HIIT mice. Food Sci. Hum. Wellness 2022, 11, 1355–1361. [Google Scholar] [CrossRef]
- Bose, C.; Alves, I.; Singh, P.; Palade, P.T.; Carvalho, E.; Børsheim, E.; Jun, S.R.; Cheema, A.; Boerma, M.; Awasthi, S. Sulforaphane prevents age-associated cardiac and muscular dysfunction through Nrf2 signaling. Aging Cell 2020, 19, e13261. [Google Scholar] [CrossRef] [PubMed]
- Flockhart, M.; Nilsson, L.; Tillqvist, E.; Vinge, F.; Millbert, F.; Lännerström, J.; Nilsson, P.H.; Samyn, D.; Apró, W.; Sundqvist, M.L. Glucosinolate-rich broccoli sprouts protect against oxidative stress and improve adaptations to intense exercise training. Redox Biol. 2023, 67, 102873. [Google Scholar] [CrossRef] [PubMed]
- Sun, C.; Yang, C.; Xue, R.; Li, S.; Zhang, T.; Pan, L.; Ma, X.; Wang, L.; Li, D. Sulforaphane alleviates muscular dystrophy in mdx mice by activation of Nrf2. J. Appl. Physiol. 2015, 118, 224–237. [Google Scholar] [CrossRef] [PubMed]
- Yang, J.; Guo, X.; Li, T.; Xie, Y.; Wang, D.; Yi, L.; Mi, M. Sulforaphane Inhibits Exhaustive Exercise-Induced Liver Injury and Transcriptome-Based Mechanism Analysis. Nutrients 2023, 15, 3220. [Google Scholar] [CrossRef]
- Oh, S.; Komine, S.; Warabi, E.; Akiyama, K.; Ishii, A.; Ishige, K.; Mizokami, Y.; Kuga, K.; Horie, M.; Miwa, Y. Nuclear factor (erythroid derived 2)-like 2 activation increases exercise endurance capacity via redox modulation in skeletal muscles. Sci. Rep. 2017, 7, 12902. [Google Scholar] [CrossRef]
- Ruhee, R.T.; Suzuki, K. The Immunomodulatory Effects of Sulforaphane in Exercise-Induced Inflammation and Oxidative Stress: A Prospective Nutraceutical. Int. J. Mol. Sci. 2024, 25, 1790. [Google Scholar] [CrossRef]
- Jones, S.B.; Brooks, J.D. Modest induction of phase 2 enzyme activity in the F-344 rat prostate. BMC Cancer 2006, 6, 62. [Google Scholar] [CrossRef]
- Biswas, S.; Rahman, I. Dietary Bioactive Functional Polyphenols in Chronic Lung Diseases. In Bioactive Food as Dietary Interventions for Liver and Gastrointestinal Disease; Elsevier: Amsterdam, The Netherlands, 2013; pp. 513–525. [Google Scholar]
- Yada, K.; Suzuki, K.; Oginome, N.; Ma, S.; Fukuda, Y.; Iida, A.; Radak, Z. Single dose administration of taheebo polyphenol enhances endurance capacity in mice. Sci. Rep. 2018, 8, 14625. [Google Scholar] [CrossRef] [PubMed]
- Yada, K.; Roberts, L.A.; Oginome, N.; Suzuki, K. Effect of acacia polyphenol supplementation on exercise-induced oxidative stress in mice liver and skeletal muscle. Antioxidants 2019, 9, 29. [Google Scholar] [CrossRef] [PubMed]
- Bogdanis, G.; Stavrinou, P.; Fatouros, I.; Philippou, A.; Chatzinikolaou, A.; Draganidis, D.; Ermidis, G.; Maridaki, M. Short-term high-intensity interval exercise training attenuates oxidative stress responses and improves antioxidant status in healthy humans. Food Chem. Toxicol. 2013, 61, 171–177. [Google Scholar] [CrossRef] [PubMed]
- Suzuki, K.; Yamada, M.; Kurakake, S.; Okamura, N.; Yamaya, K.; Liu, Q.; Kudoh, S.; Kowatari, K.; Nakaji, S.; Sugawara, K. Circulating cytokines and hormones with immunosuppressive but neutrophil-priming potentials rise after endurance exercise in humans. Eur. J. Appl. Physiol. 2000, 81, 281–287. [Google Scholar] [CrossRef] [PubMed]
- Jonsdottir, I.; Schjerling, P.; Ostrowski, K.; Asp, S.; Richter, E.; Pedersen, B. Muscle contractions induce interleukin-6 mRNA production in rat skeletal muscles. J. Physiol. 2000, 528, 157–163. [Google Scholar] [CrossRef] [PubMed]
- Tominaga, T.; Ma, S.; Saitou, K.; Suzuki, K. Glucose ingestion inhibits endurance exercise-induced IL-6 producing macrophage infiltration in mice muscle. Nutrients 2019, 11, 1496. [Google Scholar] [CrossRef]
- Suzuki, K. Characterization of exercise-induced cytokine release, the impacts on the body, the mechanisms and modulations. Int. J. Sports Exerc. Med. 2019, 5, 10-23937. [Google Scholar] [CrossRef]
- Buford, T.W.; Cooke, M.B.; Willoughby, D.S. Resistance exercise-induced changes of inflammatory gene expression within human skeletal muscle. Eur. J. Appl. Physiol. 2009, 107, 463–471. [Google Scholar] [CrossRef]
- Ji, L.; Gomez Cabrera, M.C.; Steinhafel, N.; Vina, J. Acute exercise activates nuclear factor (NF)-κB signaling pathway in rat skeletal muscle. FASEB J. 2004, 18, 1499–1506. [Google Scholar] [CrossRef] [PubMed]
- Moynagh, P.N. The NF-κB pathway. J. Cell Sci. 2005, 118, 4589–4592. [Google Scholar] [CrossRef]
- Tripathi, P.; Aggarwal, A. NF-kB transcription factor: A key player in the generation of immune response. Curr. Sci. 2006, 90, 519–531. [Google Scholar]
- Thirumalai, T.; Therasa, S.V.; Elumalai, E.; David, E. Intense and exhaustive exercise induce oxidative stress in skeletal muscle. Asian Pac. J. Trop. Dis. 2011, 1, 63–66. [Google Scholar] [CrossRef]
- Tsukiyama, Y.; Ito, T.; Nagaoka, K.; Eguchi, E.; Ogino, K. Effects of exercise training on nitric oxide, blood pressure and antioxidant enzymes. J. Clin. Biochem. Nutr. 2017, 60, 180–186. [Google Scholar] [CrossRef] [PubMed]
- Nikolaidis, M.G.; Jamurtas, A.Z.; Paschalis, V.; Fatouros, I.G.; Koutedakis, Y.; Kouretas, D. The effect of muscle-damaging exercise on blood and skeletal muscle oxidative stress: Magnitude and time-course considerations. Sports Med. 2008, 38, 579–606. [Google Scholar] [CrossRef]
- Merry, T.L.; Ristow, M. Do antioxidant supplements interfere with skeletal muscle adaptation to exercise training? J. Physiol. 2016, 594, 5135–5147. [Google Scholar] [CrossRef]
- Bentley, D.J.; Ackerman, J.; Clifford, T.; Slattery, K.S. Acute and chronic effects of antioxidant supplementation on exercise performance. In Antioxidants in Sport Nutrition, 1st ed.; CRC Press: Boca Raton, FL, USA, 2015; p. 141. [Google Scholar]
- Peternelj, T.-T.; Coombes, J.S. Antioxidant supplementation during exercise training: Beneficial or detrimental? Sports Med. 2011, 41, 1043–1069. [Google Scholar] [CrossRef]
- Mason, S.A.; Trewin, A.J.; Parker, L.; Wadley, G.D. Antioxidant supplements and endurance exercise: Current evidence and mechanistic insights. Redox Biol. 2020, 35, 101471. [Google Scholar] [CrossRef]
- Oh-ishi, S.; Kizaki, T.; Ookawara, T.; Toshinai, K.; Haga, S.; Karasawa, F.; Satoh, T.; Nagata, N.; Ji, L.L.; Ohno, H. The effect of exhaustive exercise on the antioxidant enzyme system in skeletal muscle from calcium-deficient rats. Pflügers Arch. 1998, 435, 767–774. [Google Scholar] [CrossRef]
- Supruniuk, E.; Górski, J.; Chabowski, A. Endogenous and Exogenous Antioxidants in Skeletal Muscle Fatigue Development during Exercise. Antioxidants 2023, 12, 501. [Google Scholar] [CrossRef]
- Chen, L.; Zhang, W.-L.; Xie, D.-Q.; Jia, W. Sulforaphane alleviates hepatic ischemia–reperfusion injury through promoting the activation of Nrf-2/HO-1 signaling. Transpl. Immunol. 2021, 68, 101439. [Google Scholar] [CrossRef] [PubMed]
- Fasipe, B.; Laher, I. Nrf2 modulates the benefits of evening exercise in type 2 diabetes. Sports Med. Health Sci. 2023, 5, 251–258. [Google Scholar] [CrossRef] [PubMed]
- Uruno, A.; Yagishita, Y.; Katsuoka, F.; Kitajima, Y.; Nunomiya, A.; Nagatomi, R.; Pi, J.; Biswal, S.S.; Yamamoto, M. Nrf2-Mediated Regulation of Skeletal Muscle Glycogen Metabolism. Mol. Cell. Biol. 2016, 36, 1655–1672. [Google Scholar] [CrossRef] [PubMed]
- Yagishita, Y.; Fukutomi, T.; Sugawara, A.; Kawamura, H.; Takahashi, T.; Pi, J.; Uruno, A.; Yamamoto, M. Nrf2 protects pancreatic β-cells from oxidative and nitrosative stress in diabetic model mice. Diabetes 2014, 63, 605–618. [Google Scholar] [CrossRef]
- Houghton, C.A. Sulforaphane: Its “coming of age” as a clinically relevant nutraceutical in the prevention and treatment of chronic disease. Oxidative Med. Cell. Longev. 2019, 2019, 2716870. [Google Scholar] [CrossRef]






| Target Gene | Accession Number (Size, bp) | Forward (5′ → 3′) | Reverse (5′ → 3′) |
|---|---|---|---|
| Rn18s | NM_011296 (127) | TTCTGGCCAACGGTCTAGACAAC | CCAGTGGTCTTGGTGTGCTGA |
| Il6 | NM_031168 (76) | TAGTCCTTCCTACCCCAATTTCC | TTGGTCCTTAGCCACTCCTTC |
| Tnfα | NM_013693.1 (102) | CCTCCCTCTCATCAGTTCTA | ACTTGGTGGTTTGCTACGAC |
| Il1β | NM_008361.4 (183) | GGGCCTCAAAGGAAAGAATC | TTGCTTGGGATCCACACTCT |
| Sod1 | NM_011434 (661) | GAGACCTGGGCAATGTGACT | GTTTACTGCGCAATCCCAAT |
| Cat | XM_028766902 (100) | CAGAGAGCGGATTCCTGAGAGA | CTTTGCCTTGGAGTATCTGGTGAT |
| Gpx1 | NM_001329527.1 (751) | AGTACGGATTCCACGTTTGA | GGAACTTCTCAAAGTTCCAG |
| Nfe212 | NM_010902 (100) | GAGTCGCTTGCCCTGGATATC | TCATGGCTGCCTCCAGAGAA |
| Hmox1 | NM_010442 (175) | CACGCATATACCCGCTACCT | CCAGAGTGTTCATTCGAGCA |
| Measured Indicators | Findings (Main Interaction Between SFN and Ex) | |
|---|---|---|
| Gastrocnemius | Soleus | |
| IL-6 mRNA | Significant interaction found between the groups | Significant interaction found between the groups |
| IL-1β mRNA | Significant interaction found between the groups | Significant interaction found between the groups |
| TNF-α mRNA | Significant interaction found between the groups | Main interaction was not significant |
| SOD1 mRNA | Main interaction was not significant | Significant interaction found between the groups |
| CAT mRNA | Main interaction was not significant | Significant interaction found between the groups |
| GPx-1 mRNA | Main interaction was not significant | Significant interaction found between the groups |
| Nrf2 mRNA | Significant interaction found between the groups | Significant interaction found between the groups |
| HO-1 mRNA | Significant interaction found between the groups | Significant interaction found between the groups |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Ruhee, R.T.; Ma, S.; Suzuki, K. Effects of Sulforaphane Treatment on Skeletal Muscle from Exhaustive Exercise-Induced Inflammation and Oxidative Stress Through the Nrf2/HO-1 Signaling Pathway. Antioxidants 2025, 14, 210. https://doi.org/10.3390/antiox14020210
Ruhee RT, Ma S, Suzuki K. Effects of Sulforaphane Treatment on Skeletal Muscle from Exhaustive Exercise-Induced Inflammation and Oxidative Stress Through the Nrf2/HO-1 Signaling Pathway. Antioxidants. 2025; 14(2):210. https://doi.org/10.3390/antiox14020210
Chicago/Turabian StyleRuhee, Ruheea Taskin, Sihui Ma, and Katsuhiko Suzuki. 2025. "Effects of Sulforaphane Treatment on Skeletal Muscle from Exhaustive Exercise-Induced Inflammation and Oxidative Stress Through the Nrf2/HO-1 Signaling Pathway" Antioxidants 14, no. 2: 210. https://doi.org/10.3390/antiox14020210
APA StyleRuhee, R. T., Ma, S., & Suzuki, K. (2025). Effects of Sulforaphane Treatment on Skeletal Muscle from Exhaustive Exercise-Induced Inflammation and Oxidative Stress Through the Nrf2/HO-1 Signaling Pathway. Antioxidants, 14(2), 210. https://doi.org/10.3390/antiox14020210
